Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG001432 | XP_039688434.1 | 65.657 | 297 | 93 | 6 | 1 | 293 | 1 | 292 | 4.50e-123 | 369 |
MsaG001432 | XP_039688434.1 | 80.000 | 75 | 15 | 0 | 219 | 293 | 355 | 429 | 5.18e-30 | 128 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG001432 | sp|Q8L3W1|VRN1_ARATH | 28.313 | 332 | 189 | 15 | 7 | 291 | 4 | 333 | 6.00e-23 | 99.8 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG001432 | tr|A0A396JPN4|A0A396JPN4_MEDTR | 65.657 | 297 | 93 | 6 | 1 | 293 | 1 | 292 | 2.15e-123 | 369 |
MsaG001432 | tr|A0A396JPN4|A0A396JPN4_MEDTR | 80.000 | 75 | 15 | 0 | 219 | 293 | 355 | 429 | 2.47e-30 | 128 |
Gene ID | Type | Classification |
---|---|---|
MsaG001432 | TF | B3 |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000107 | MsaG001432 | 0.811260 | 1.311722e-50 | 2.310081e-48 |
MsaG000115 | MsaG001432 | 0.813315 | 4.692739e-51 | 8.695355e-49 |
MsaG000180 | MsaG001432 | 0.837996 | 6.867066e-57 | 2.518168e-54 |
MsaG000250 | MsaG001432 | 0.838421 | 5.342316e-57 | 1.985006e-54 |
MsaG000419 | MsaG001432 | 0.851189 | 1.992590e-60 | 1.125121e-57 |
MsaG000707 | MsaG001432 | 0.800356 | 2.503597e-48 | 3.412383e-46 |
MsaG000888 | MsaG001432 | 0.813441 | 4.403211e-51 | 8.185087e-49 |
MsaG000941 | MsaG001432 | 0.825390 | 8.543313e-54 | 2.172204e-51 |
MsaG001325 | MsaG001432 | 0.814658 | 2.380652e-51 | 4.562375e-49 |
MsaG001406 | MsaG001432 | 0.824816 | 1.165406e-53 | 2.916915e-51 |
MsaG001432 | MsaG002214 | 0.833453 | 9.590871e-56 | 3.068225e-53 |
MsaG001432 | MsaG002911 | 0.822319 | 4.445878e-53 | 1.039932e-50 |
MsaG001432 | MsaG003180 | 0.829649 | 8.213956e-55 | 2.353423e-52 |
MsaG001432 | MsaG003192 | 0.813898 | 3.498339e-51 | 6.577901e-49 |
MsaG001432 | MsaG003466 | 0.821687 | 6.219494e-53 | 1.430372e-50 |
MsaG001432 | MsaG003536 | 0.811679 | 1.065130e-50 | 1.895106e-48 |
MsaG001432 | MsaG003667 | 0.809298 | 3.460639e-50 | 5.810138e-48 |
MsaG001432 | MsaG003679 | 0.826238 | 5.386986e-54 | 1.402328e-51 |
MsaG001432 | MsaG003680 | 0.824173 | 1.648509e-53 | 4.054213e-51 |
MsaG001432 | MsaG003998 | 0.803180 | 6.634492e-49 | 9.642946e-47 |
MsaG001432 | MsaG004092 | 0.809209 | 3.614251e-50 | 6.055219e-48 |
MsaG001432 | MsaG004185 | 0.837315 | 1.024821e-56 | 3.680414e-54 |
MsaG001432 | MsaG004500 | 0.825511 | 8.002352e-54 | 2.041532e-51 |
MsaG001432 | MsaG004534 | 0.822623 | 3.782007e-53 | 8.918959e-51 |
MsaG001432 | MsaG004621 | 0.808300 | 5.641398e-50 | 9.247173e-48 |
MsaG001432 | MsaG004648 | 0.824420 | 1.443488e-53 | 3.574018e-51 |
MsaG001432 | MsaG004684 | 0.824714 | 1.231856e-53 | 3.074510e-51 |
MsaG001432 | MsaG004711 | 0.801898 | 1.215405e-48 | 1.715441e-46 |
MsaG001432 | MsaG005074 | 0.810126 | 2.300866e-50 | 3.941257e-48 |
MsaG001432 | MsaG005354 | 0.819734 | 1.739526e-52 | 3.798713e-50 |
MsaG001432 | MsaG005774 | 0.805957 | 1.758424e-49 | 2.726070e-47 |
MsaG001432 | MsaG005813 | 0.826828 | 3.902065e-54 | 1.032585e-51 |
MsaG001432 | MsaG006020 | 0.826751 | 4.069237e-54 | 1.074565e-51 |
MsaG001432 | MsaG006639 | 0.800073 | 2.857520e-48 | 3.869909e-46 |
MsaG001432 | MsaG006683 | 0.815737 | 1.374247e-51 | 2.706547e-49 |
MsaG001432 | MsaG006741 | 0.812115 | 8.564573e-51 | 1.540247e-48 |
MsaG001432 | MsaG006777 | 0.801869 | 1.232261e-48 | 1.738085e-46 |
MsaG001432 | MsaG006855 | 0.827830 | 2.251194e-54 | 6.126967e-52 |
MsaG001432 | MsaG006873 | 0.817461 | 5.670319e-52 | 1.167210e-49 |
MsaG001432 | MsaG006889 | 0.805471 | 2.221693e-49 | 3.405213e-47 |
MsaG001432 | MsaG006988 | 0.814679 | 2.354781e-51 | 4.515258e-49 |
MsaG001432 | MsaG007215 | 0.826498 | 4.672726e-54 | 1.225292e-51 |
MsaG001432 | MsaG007354 | 0.830518 | 5.051170e-55 | 1.483589e-52 |
MsaG001432 | MsaG007600 | 0.820364 | 1.250179e-52 | 2.776265e-50 |
MsaG001432 | MsaG007684 | 0.828021 | 2.025502e-54 | 5.542297e-52 |
MsaG001432 | MsaG007834 | 0.806067 | 1.667878e-49 | 2.592464e-47 |
MsaG001432 | MsaG008088 | 0.815729 | 1.379637e-51 | 2.716672e-49 |
MsaG001432 | MsaG008126 | 0.800835 | 2.001485e-48 | 2.757639e-46 |
MsaG001432 | MsaG008218 | 0.833505 | 9.307926e-56 | 2.982305e-53 |
MsaG001432 | MsaG008220 | 0.801132 | 1.742118e-48 | 2.416371e-46 |
MsaG001432 | MsaG008237 | 0.844849 | 1.097926e-58 | 5.006291e-56 |
MsaG001432 | MsaG008356 | 0.820776 | 1.006769e-52 | 2.260093e-50 |
MsaG001432 | MsaG008434 | 0.807910 | 6.825043e-50 | 1.108319e-47 |
MsaG001432 | MsaG008525 | 0.814158 | 3.066538e-51 | 5.803556e-49 |
MsaG001432 | MsaG008634 | 0.815916 | 1.254209e-51 | 2.481391e-49 |
MsaG001432 | MsaG009389 | 0.831640 | 2.686539e-55 | 8.151665e-53 |
MsaG001432 | MsaG009477 | 0.805521 | 2.169127e-49 | 3.328504e-47 |
MsaG001432 | MsaG009767 | 0.806920 | 1.104279e-49 | 1.751295e-47 |
MsaG001432 | MsaG009787 | 0.820425 | 1.210528e-52 | 2.692619e-50 |
MsaG001432 | MsaG010104 | 0.803712 | 5.151892e-49 | 7.580872e-47 |
MsaG001432 | MsaG010902 | 0.818365 | 3.551805e-52 | 7.483544e-50 |
MsaG001432 | MsaG011010 | 0.820779 | 1.005155e-52 | 2.256659e-50 |
MsaG001432 | MsaG011018 | 0.824998 | 1.056333e-53 | 2.657063e-51 |
MsaG001432 | MsaG011225 | 0.818438 | 3.418745e-52 | 7.216872e-50 |
MsaG001432 | MsaG011244 | 0.815894 | 1.268214e-51 | 2.507721e-49 |
MsaG001432 | MsaG011217 | 0.842971 | 3.476785e-58 | 1.491533e-55 |
MsaG001432 | MsaG011363 | 0.804093 | 4.296793e-49 | 6.378936e-47 |
MsaG001432 | MsaG011861 | 0.807974 | 6.615787e-50 | 1.075961e-47 |
MsaG001432 | MsaG011774 | 0.811972 | 9.199089e-51 | 1.648614e-48 |
MsaG001432 | MsaG011952 | 0.804692 | 3.228077e-49 | 4.858991e-47 |
MsaG001432 | MsaG012170 | 0.814610 | 2.439087e-51 | 4.668675e-49 |
MsaG001432 | MsaG012586 | 0.823587 | 2.258929e-53 | 5.468016e-51 |
MsaG001432 | MsaG012591 | 0.836827 | 1.363571e-56 | 4.825189e-54 |
MsaG001432 | MsaG015132 | 0.801471 | 1.485646e-48 | 2.076543e-46 |
MsaG001432 | MsaG015184 | 0.817245 | 6.340673e-52 | 1.297981e-49 |
MsaG001432 | MsaG015705 | 0.808215 | 5.880515e-50 | 9.619319e-48 |
MsaG001432 | MsaG015829 | 0.819778 | 1.699987e-52 | 3.716833e-50 |
MsaG001432 | MsaG015851 | 0.803083 | 6.946997e-49 | 1.007453e-46 |
MsaG001432 | MsaG016421 | 0.842471 | 4.713855e-58 | 1.990170e-55 |
MsaG001432 | MsaG016517 | 0.855609 | 1.089288e-61 | 7.194353e-59 |
MsaG001432 | MsaG017303 | 0.835019 | 3.900871e-56 | 1.307411e-53 |
MsaG001432 | MsaG017480 | 0.847184 | 2.560889e-59 | 1.261813e-56 |
MsaG001432 | MsaG017690 | 0.854149 | 2.875026e-61 | 1.801853e-58 |
MsaG001432 | MsaG018598 | 0.808785 | 4.450262e-50 | 7.380403e-48 |
MsaG001432 | MsaG018786 | 0.806310 | 1.483534e-49 | 2.319272e-47 |
MsaG001432 | MsaG019237 | 0.822058 | 5.108732e-53 | 1.186587e-50 |
MsaG001432 | MsaG019356 | 0.845575 | 7.000524e-59 | 3.269071e-56 |
MsaG001432 | MsaG019795 | 0.804139 | 4.204150e-49 | 6.247807e-47 |
MsaG001432 | MsaG019814 | 0.825542 | 7.868271e-54 | 2.009027e-51 |
MsaG001432 | MsaG019913 | 0.808710 | 4.617635e-50 | 7.644346e-48 |
MsaG001432 | MsaG019935 | 0.833703 | 8.310868e-56 | 2.678448e-53 |
MsaG001432 | MsaG020334 | 0.815040 | 1.960931e-51 | 3.794381e-49 |
MsaG001432 | MsaG020338 | 0.801478 | 1.480953e-48 | 2.070303e-46 |
MsaG001432 | MsaG020420 | 0.843323 | 2.805456e-58 | 1.217206e-55 |
MsaG001432 | MsaG020421 | 0.801127 | 1.746295e-48 | 2.421889e-46 |
MsaG001432 | MsaG020467 | 0.840787 | 1.304545e-57 | 5.219899e-55 |
MsaG001432 | MsaG020531 | 0.808891 | 4.224908e-50 | 7.024666e-48 |
MsaG001432 | MsaG020596 | 0.805144 | 2.599377e-49 | 3.954098e-47 |
MsaG001432 | MsaG020787 | 0.801734 | 1.313395e-48 | 1.846773e-46 |
MsaG001432 | MsaG020866 | 0.821357 | 7.408454e-53 | 1.688913e-50 |
MsaG001432 | MsaG021049 | 0.836903 | 1.304077e-56 | 4.625154e-54 |
MsaG001432 | MsaG021200 | 0.812122 | 8.537278e-51 | 1.535580e-48 |
MsaG001432 | MsaG021650 | 0.811661 | 1.074533e-50 | 1.911025e-48 |
MsaG001432 | MsaG021720 | 0.828404 | 1.639235e-54 | 4.533986e-52 |
MsaG001432 | MsaG022547 | 0.814799 | 2.215510e-51 | 4.261180e-49 |
MsaG001432 | MsaG022624 | 0.815811 | 1.323643e-51 | 2.611797e-49 |
MsaG001432 | MsaG022729 | 0.800401 | 2.452181e-48 | 3.345694e-46 |
MsaG001432 | MsaG022993 | 0.829946 | 6.957694e-55 | 2.010553e-52 |
MsaG001432 | MsaG023762 | 0.828836 | 1.290482e-54 | 3.612632e-52 |
MsaG001432 | MsaG023960 | 0.831311 | 3.235592e-55 | 9.722615e-53 |
MsaG001432 | MsaG024008 | 0.800172 | 2.727869e-48 | 3.702505e-46 |
MsaG001432 | MsaG024010 | 0.828095 | 1.944362e-54 | 5.331244e-52 |
MsaG001432 | MsaG024272 | 0.809251 | 3.540248e-50 | 5.937246e-48 |
MsaG001432 | MsaG024958 | 0.803059 | 7.026401e-49 | 1.018399e-46 |
MsaG001432 | MsaG025732 | 0.833245 | 1.080231e-55 | 3.434782e-53 |
MsaG001432 | MsaG026192 | 0.808398 | 5.378521e-50 | 8.836722e-48 |
MsaG001432 | MsaG026841 | 0.839166 | 3.436060e-57 | 1.306699e-54 |
MsaG001432 | MsaG026849 | 0.810526 | 1.887896e-50 | 3.265666e-48 |
MsaG001432 | MsaG026830 | 0.878222 | 7.007110e-69 | 1.165270e-65 |
MsaG001432 | MsaG026831 | 0.866072 | 7.466863e-65 | 7.363688e-62 |
MsaG001432 | MsaG026962 | 0.833641 | 8.613671e-56 | 2.770882e-53 |
MsaG001432 | MsaG027026 | 0.807307 | 9.153244e-50 | 1.464997e-47 |
MsaG001432 | MsaG026985 | 0.828871 | 1.266029e-54 | 3.547710e-52 |
MsaG001432 | MsaG026987 | 0.806845 | 1.144978e-49 | 1.812656e-47 |
MsaG001432 | MsaG027302 | 0.835938 | 2.289128e-56 | 7.886394e-54 |
MsaG001432 | MsaG027395 | 0.834903 | 4.170210e-56 | 1.392817e-53 |
MsaG001432 | MsaG027776 | 0.808882 | 4.243470e-50 | 7.054046e-48 |
MsaG001432 | MsaG027780 | 0.802403 | 9.580526e-49 | 1.367908e-46 |
MsaG001432 | MsaG028040 | 0.813748 | 3.772550e-51 | 7.066853e-49 |
MsaG001432 | MsaG028109 | 0.806036 | 1.692982e-49 | 2.629510e-47 |
MsaG001432 | MsaG028568 | 0.823869 | 1.941305e-53 | 4.735136e-51 |
MsaG001432 | MsaG028825 | 0.830078 | 6.463685e-55 | 1.874830e-52 |
MsaG001432 | MsaG029461 | 0.814962 | 2.039838e-51 | 3.939458e-49 |
MsaG001432 | MsaG029591 | 0.801492 | 1.471120e-48 | 2.057221e-46 |
MsaG001432 | MsaG029801 | 0.825375 | 8.613579e-54 | 2.189201e-51 |
MsaG001432 | MsaG029802 | 0.804187 | 4.109913e-49 | 6.114532e-47 |
MsaG001432 | MsaG029919 | 0.814768 | 2.251521e-51 | 4.327025e-49 |
MsaG001432 | MsaG030045 | 0.847319 | 2.353776e-59 | 1.164983e-56 |
MsaG001432 | MsaG031201 | 0.820763 | 1.013660e-52 | 2.274758e-50 |
MsaG001432 | MsaG032046 | 0.800998 | 1.855110e-48 | 2.565296e-46 |
MsaG001432 | MsaG032064 | 0.806971 | 1.077560e-49 | 1.710984e-47 |
MsaG001432 | MsaG032373 | 0.806359 | 1.448351e-49 | 2.266907e-47 |
MsaG001432 | MsaG032413 | 0.835856 | 2.401631e-56 | 8.253336e-54 |
MsaG001432 | MsaG032636 | 0.811078 | 1.435950e-50 | 2.517591e-48 |
MsaG001432 | MsaG032928 | 0.822498 | 4.042625e-53 | 9.501348e-51 |
MsaG001432 | MsaG033593 | 0.804863 | 2.974995e-49 | 4.495982e-47 |
MsaG001432 | MsaG033815 | 0.842006 | 6.253843e-58 | 2.601211e-55 |
MsaG001432 | MsaG034147 | 0.851248 | 1.918733e-60 | 1.085622e-57 |
MsaG001432 | MsaG034336 | 0.800368 | 2.490113e-48 | 3.394911e-46 |
MsaG001432 | MsaG035162 | 0.873788 | 2.310559e-67 | 3.150741e-64 |
MsaG001432 | MsaG036241 | 0.817244 | 6.342491e-52 | 1.298339e-49 |
MsaG001432 | MsaG036420 | 0.804085 | 4.314459e-49 | 6.403890e-47 |
MsaG001432 | MsaG036974 | 0.811833 | 9.863833e-51 | 1.761686e-48 |
MsaG001432 | MsaG037910 | 0.806058 | 1.675466e-49 | 2.603658e-47 |
MsaG001432 | MsaG038030 | 0.800641 | 2.191733e-48 | 3.006661e-46 |
MsaG001432 | MsaG039166 | 0.821307 | 7.606192e-53 | 1.731746e-50 |
MsaG001432 | MsaG039487 | 0.823111 | 2.915151e-53 | 6.965894e-51 |
MsaG001432 | MsaG039599 | 0.806256 | 1.522708e-49 | 2.377498e-47 |
MsaG001432 | MsaG039921 | 0.816414 | 9.717703e-52 | 1.947133e-49 |
MsaG001432 | MsaG040853 | 0.805242 | 2.480690e-49 | 3.782064e-47 |
MsaG001432 | MsaG042566 | 0.821344 | 7.458667e-53 | 1.699777e-50 |
MsaG001432 | MsaG042679 | 0.809748 | 2.773154e-50 | 4.707038e-48 |
MsaG001432 | MsaG042994 | 0.801650 | 1.365687e-48 | 1.916672e-46 |
MsaG001432 | MsaG043000 | 0.868507 | 1.254716e-65 | 1.366675e-62 |
MsaG001432 | MsaG043804 | 0.800986 | 1.865126e-48 | 2.578496e-46 |
MsaG001432 | MsaG043924 | 0.805762 | 1.931746e-49 | 2.981072e-47 |
MsaG001432 | MsaG044107 | 0.841129 | 1.062051e-57 | 4.295944e-55 |
MsaG001432 | MsaG044278 | 0.865141 | 1.463463e-64 | 1.390514e-61 |
MsaG001432 | MsaG044333 | 0.815814 | 1.321472e-51 | 2.607706e-49 |
MsaG001432 | MsaG044453 | 0.801576 | 1.414500e-48 | 1.981792e-46 |
MsaG001432 | MsaG044516 | 0.849566 | 5.661210e-60 | 3.023512e-57 |
MsaG001432 | MsaG044722 | 0.824959 | 1.078807e-53 | 2.710759e-51 |
MsaG001432 | MsaG044880 | 0.816068 | 1.160367e-51 | 2.304590e-49 |
MsaG001432 | MsaG044889 | 0.866377 | 5.983387e-65 | 5.973674e-62 |
MsaG001432 | MsaG045016 | 0.855169 | 1.461350e-61 | 9.498232e-59 |
MsaG001432 | MsaG045109 | 0.832371 | 1.776301e-55 | 5.505237e-53 |
MsaG001432 | MsaG045118 | 0.839522 | 2.779647e-57 | 1.068907e-54 |
MsaG001432 | MsaG045371 | 0.814740 | 2.282873e-51 | 4.384135e-49 |
MsaG001432 | MsaG045412 | 0.840726 | 1.353487e-57 | 5.405221e-55 |
MsaG001432 | MsaG045769 | 0.801258 | 1.641821e-48 | 2.283759e-46 |
MsaG001432 | MsaG046126 | 0.817560 | 5.386696e-52 | 1.111677e-49 |
MsaG001432 | MsaG046373 | 0.823446 | 2.436047e-53 | 5.874087e-51 |
MsaG001432 | MsaG046472 | 0.846367 | 4.273291e-59 | 2.048767e-56 |
MsaG001432 | MsaG046488 | 0.821277 | 7.725242e-53 | 1.757516e-50 |
MsaG001432 | MsaG046497 | 0.832842 | 1.359141e-55 | 4.270398e-53 |
MsaG001432 | MsaG046730 | 0.823421 | 2.468623e-53 | 5.948758e-51 |
MsaG001432 | MsaG046930 | 0.834848 | 4.304522e-56 | 1.435343e-53 |
MsaG001432 | MsaG046972 | 0.813182 | 5.017658e-51 | 9.266783e-49 |
MsaG001432 | MsaG001564 | 0.851321 | 1.829916e-60 | 1.038004e-57 |
MsaG001432 | MsaG002316 | 0.879587 | 2.323951e-69 | 4.115880e-66 |
MsaG001432 | MsaG003734 | 0.816055 | 1.167979e-51 | 2.318955e-49 |
MsaG001432 | MsaG002984 | 0.860086 | 5.186819e-63 | 4.045990e-60 |
MsaG001432 | MsaG002433 | 0.825839 | 6.693096e-54 | 1.723176e-51 |
MsaG001432 | MsaG002954 | 0.813922 | 3.455707e-51 | 6.501676e-49 |
MsaG001432 | MsaG002307 | 0.816841 | 7.805481e-52 | 1.581208e-49 |
MsaG001432 | MsaG001893 | 0.807144 | 9.908257e-50 | 1.579716e-47 |
MsaG001432 | MsaG008854 | 0.804175 | 4.133043e-49 | 6.147237e-47 |
MsaG001432 | MsaG009209 | 0.858955 | 1.130096e-62 | 8.444893e-60 |
MsaG001432 | MsaG007590 | 0.800588 | 2.247105e-48 | 3.078878e-46 |
MsaG001432 | MsaG007673 | 0.830607 | 4.806696e-55 | 1.415349e-52 |
MsaG001432 | MsaG014164 | 0.802062 | 1.125320e-48 | 1.594172e-46 |
MsaG001432 | MsaG013406 | 0.816714 | 8.329424e-52 | 1.681905e-49 |
MsaG001432 | MsaG013967 | 0.811655 | 1.077930e-50 | 1.916761e-48 |
MsaG001432 | MsaG013252 | 0.810925 | 1.549491e-50 | 2.706408e-48 |
MsaG001432 | MsaG018864 | 0.809739 | 2.784562e-50 | 4.725473e-48 |
MsaG001432 | MsaG017934 | 0.838727 | 4.456885e-57 | 1.671988e-54 |
MsaG001432 | MsaG019407 | 0.826127 | 5.723503e-54 | 1.485403e-51 |
MsaG001432 | MsaG023445 | 0.845518 | 7.252192e-59 | 3.380125e-56 |
MsaG001432 | MsaG017935 | 0.837610 | 8.617657e-57 | 3.122998e-54 |
MsaG001432 | MsaG028734 | 0.824426 | 1.439028e-53 | 3.563580e-51 |
MsaG001432 | MsaG029782 | 0.858048 | 2.100532e-62 | 1.517390e-59 |
MsaG001432 | MsaG027166 | 0.814853 | 2.155944e-51 | 4.152221e-49 |
MsaG001432 | MsaG025855 | 0.818292 | 3.688587e-52 | 7.756967e-50 |
MsaG001432 | MsaG028076 | 0.804805 | 3.059012e-49 | 4.616666e-47 |
MsaG001432 | MsaG032663 | 0.835441 | 3.055629e-56 | 1.037126e-53 |
MsaG001432 | MsaG034613 | 0.857667 | 2.722330e-62 | 1.938732e-59 |
MsaG001432 | MsaG033153 | 0.802894 | 7.596410e-49 | 1.096836e-46 |
MsaG001432 | MsaG032261 | 0.833495 | 9.361076e-56 | 2.998493e-53 |
MsaG001432 | MsaG032935 | 0.812466 | 7.186344e-51 | 1.303748e-48 |
MsaG001432 | MsaG030638 | 0.816446 | 9.560470e-52 | 1.917187e-49 |
MsaG001432 | MsaG031625 | 0.800181 | 2.717329e-48 | 3.688915e-46 |
MsaG001432 | MsaG030688 | 0.858785 | 1.269663e-62 | 9.427623e-60 |
MsaG001432 | MsaG031340 | 0.838480 | 5.158620e-57 | 1.920350e-54 |
MsaG001432 | MsaG031188 | 0.818993 | 2.562208e-52 | 5.487739e-50 |
MsaG001432 | MsaG031025 | 0.834583 | 5.015809e-56 | 1.659320e-53 |
MsaG001432 | MsaG033504 | 0.835654 | 2.700173e-56 | 9.223305e-54 |
MsaG001432 | MsaG035313 | 0.812761 | 6.200229e-51 | 1.133092e-48 |
MsaG001432 | MsaG036651 | 0.802597 | 8.741325e-49 | 1.253622e-46 |
MsaG001432 | MsaG034912 | 0.833862 | 7.586964e-56 | 2.456390e-53 |
MsaG001432 | MsaG042585 | 0.813521 | 4.229454e-51 | 7.877920e-49 |
MsaG001432 | MsaG042698 | 0.825176 | 9.592451e-54 | 2.424718e-51 |
MsaG001432 | MsaG041446 | 0.809922 | 2.544775e-50 | 4.337539e-48 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG001432 | MtrunA17_Chr1g0163181 | 65.657 | 297 | 93 | 6 | 1 | 293 | 1 | 292 | 4.14e-127 | 369 |
MsaG001432 | MtrunA17_Chr1g0163181 | 80.000 | 75 | 15 | 0 | 219 | 293 | 355 | 429 | 4.76e-34 | 128 |
MsaG001432 | MtrunA17_Chr1g0163251 | 51.163 | 301 | 117 | 4 | 1 | 293 | 1 | 279 | 6.38e-98 | 293 |
MsaG001432 | MtrunA17_Chr1g0163201 | 59.155 | 284 | 89 | 6 | 20 | 293 | 18 | 284 | 1.70e-95 | 287 |
MsaG001432 | MtrunA17_Chr1g0163201 | 66.667 | 105 | 30 | 1 | 189 | 293 | 293 | 392 | 3.76e-38 | 139 |
MsaG001432 | MtrunA17_Chr1g0163191 | 73.373 | 169 | 37 | 2 | 1 | 169 | 1 | 161 | 1.58e-75 | 228 |
MsaG001432 | MtrunA17_Chr1g0163261 | 37.864 | 309 | 149 | 6 | 1 | 293 | 1 | 282 | 1.70e-64 | 204 |
MsaG001432 | MtrunA17_Chr1g0163241 | 60.335 | 179 | 47 | 4 | 1 | 178 | 7 | 162 | 2.30e-62 | 194 |
MsaG001432 | MtrunA17_Chr1g0163231 | 38.889 | 306 | 146 | 9 | 1 | 293 | 1 | 278 | 8.39e-62 | 197 |
MsaG001432 | MtrunA17_Chr1g0171611 | 38.889 | 306 | 134 | 8 | 1 | 293 | 1 | 266 | 2.15e-59 | 191 |
MsaG001432 | MtrunA17_Chr1g0163131 | 41.438 | 292 | 147 | 9 | 14 | 293 | 27 | 306 | 2.79e-57 | 186 |
MsaG001432 | MtrunA17_Chr1g0163111 | 81.818 | 77 | 14 | 0 | 217 | 293 | 152 | 228 | 9.36e-38 | 133 |
MsaG001432 | MtrunA17_Chr1g0163111 | 42.478 | 113 | 59 | 3 | 184 | 293 | 1 | 110 | 7.96e-18 | 80.5 |
MsaG001432 | MtrunA17_Chr1g0163151 | 77.333 | 75 | 17 | 0 | 219 | 293 | 147 | 221 | 3.04e-36 | 129 |
MsaG001432 | MtrunA17_Chr1g0163151 | 43.363 | 113 | 61 | 2 | 184 | 293 | 1 | 113 | 2.42e-22 | 92.8 |
MsaG001432 | MtrunA17_Chr3g0103181 | 28.720 | 289 | 179 | 8 | 9 | 292 | 12 | 278 | 2.87e-33 | 123 |
MsaG001432 | MtrunA17_Chr3g0103171 | 29.137 | 278 | 174 | 8 | 20 | 292 | 5 | 264 | 6.63e-32 | 119 |
MsaG001432 | MtrunA17_Chr3g0131891 | 31.849 | 292 | 168 | 9 | 14 | 292 | 28 | 301 | 1.64e-30 | 117 |
MsaG001432 | MtrunA17_Chr1g0163101 | 39.394 | 165 | 80 | 4 | 14 | 178 | 26 | 170 | 3.32e-30 | 112 |
MsaG001432 | MtrunA17_Chr7g0233561 | 29.836 | 305 | 183 | 10 | 8 | 292 | 17 | 310 | 9.39e-30 | 115 |
MsaG001432 | MtrunA17_Chr8g0390841 | 28.571 | 294 | 183 | 9 | 14 | 292 | 48 | 329 | 3.45e-29 | 116 |
MsaG001432 | MtrunA17_Chr7g0233541 | 29.553 | 291 | 172 | 8 | 21 | 292 | 2 | 278 | 1.13e-28 | 111 |
MsaG001432 | MtrunA17_Chr7g0233521 | 28.470 | 281 | 171 | 7 | 21 | 292 | 2 | 261 | 6.98e-28 | 108 |
MsaG001432 | MtrunA17_Chr1g0162161 | 37.975 | 158 | 80 | 6 | 21 | 178 | 4 | 143 | 6.15e-27 | 103 |
MsaG001432 | MtrunA17_Chr3g0103191 | 29.070 | 258 | 159 | 7 | 9 | 260 | 12 | 251 | 3.70e-26 | 103 |
MsaG001432 | MtrunA17_Chr1g0208771 | 27.835 | 291 | 178 | 11 | 20 | 292 | 12 | 288 | 4.63e-26 | 107 |
MsaG001432 | MtrunA17_Chr1g0163121 | 45.614 | 114 | 57 | 2 | 19 | 132 | 9 | 117 | 5.05e-26 | 100 |
MsaG001432 | MtrunA17_Chr6g0476181 | 38.037 | 163 | 85 | 5 | 21 | 178 | 2 | 153 | 9.22e-26 | 100 |
MsaG001432 | MtrunA17_Chr1g0163081 | 41.071 | 112 | 61 | 2 | 21 | 132 | 6 | 112 | 7.13e-24 | 94.7 |
MsaG001432 | MtrunA17_Chr7g0233571 | 31.707 | 246 | 107 | 8 | 1 | 214 | 1 | 217 | 1.52e-22 | 93.2 |
MsaG001432 | MtrunA17_Chr7g0233531 | 28.723 | 282 | 169 | 8 | 21 | 292 | 2 | 261 | 2.82e-22 | 94.0 |
MsaG001432 | MtrunA17_Chr3g0103151 | 32.692 | 156 | 88 | 4 | 9 | 158 | 12 | 156 | 8.22e-22 | 89.7 |
MsaG001432 | MtrunA17_Chr1g0163141 | 32.544 | 169 | 101 | 4 | 17 | 178 | 7 | 169 | 4.93e-21 | 88.2 |
MsaG001432 | MtrunA17_Chr1g0163071 | 27.869 | 305 | 166 | 10 | 21 | 292 | 2 | 285 | 1.75e-20 | 89.4 |
MsaG001432 | MtrunA17_Chr1g0163221 | 29.286 | 280 | 162 | 9 | 14 | 280 | 20 | 276 | 4.20e-20 | 89.0 |
MsaG001432 | MtrunA17_Chr1g0163161 | 42.000 | 100 | 54 | 3 | 33 | 132 | 1 | 96 | 2.04e-19 | 82.4 |
MsaG001432 | MtrunA17_Chr4g0067431 | 28.276 | 290 | 183 | 10 | 9 | 280 | 15 | 297 | 2.09e-19 | 86.7 |
MsaG001432 | MtrunA17_Chr5g0419201 | 32.653 | 147 | 90 | 3 | 14 | 158 | 25 | 164 | 8.95e-19 | 82.4 |
MsaG001432 | MtrunA17_Chr6g0467351 | 36.697 | 109 | 66 | 2 | 13 | 118 | 23 | 131 | 1.69e-16 | 77.0 |
MsaG001432 | MtrunA17_Chr3g0103201 | 25.862 | 232 | 152 | 6 | 64 | 292 | 5 | 219 | 3.24e-14 | 70.5 |
MsaG001432 | MtrunA17_Chr4g0033961 | 37.624 | 101 | 57 | 2 | 7 | 101 | 4 | 104 | 1.06e-13 | 70.9 |
MsaG001432 | MtrunA17_Chr6g0476171 | 50.820 | 61 | 30 | 0 | 233 | 293 | 185 | 245 | 2.26e-13 | 68.6 |
MsaG001432 | MtrunA17_Chr1g0162441 | 33.333 | 111 | 67 | 3 | 7 | 110 | 5 | 115 | 2.96e-12 | 66.6 |
MsaG001432 | MtrunA17_Chr1g0163091 | 31.624 | 117 | 72 | 3 | 184 | 292 | 1 | 117 | 9.88e-12 | 62.4 |
MsaG001432 | MtrunA17_Chr3g0077461 | 21.111 | 270 | 151 | 7 | 14 | 281 | 246 | 455 | 1.20e-11 | 64.7 |
MsaG001432 | MtrunA17_Chr1g0163061 | 36.264 | 91 | 55 | 2 | 14 | 101 | 24 | 114 | 1.66e-11 | 63.5 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG001432 | AT3G18990.1 | 28.313 | 332 | 189 | 15 | 7 | 291 | 4 | 333 | 6.10e-24 | 99.8 |
MsaG001432 | AT3G18990.2 | 28.313 | 332 | 189 | 15 | 7 | 291 | 4 | 333 | 8.06e-24 | 100 |
Find 47 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
CAACACCGTTTGGAAATTTA+AGG | 0.151014 | 1:+20061949 | None:intergenic |
TAGAGGTTGGATAAAATTTA+TGG | 0.178729 | 1:-20059667 | MsaT001432.1:CDS |
TTTGCAAAGTCTTTCAAATA+TGG | 0.208675 | 1:-20061864 | MsaT001432.1:CDS |
GCCAAAGGAGTTTATGAAAA+TGG | 0.215569 | 1:-20059784 | MsaT001432.1:CDS |
AAATATTGTGGAGTTGAAAA+TGG | 0.256652 | 1:-20059751 | MsaT001432.1:CDS |
TTCATCAACTGATTTGATAT+TGG | 0.273749 | 1:+20061758 | None:intergenic |
TATTTCTCCACATATATCTT+AGG | 0.281171 | 1:+20061999 | None:intergenic |
TGGAGAGTAATGGTGATATT+TGG | 0.287546 | 1:-20061908 | MsaT001432.1:CDS |
TTATGCCAATGGCTATTTCT+TGG | 0.296975 | 1:-20061090 | MsaT001432.1:intron |
TTTGGAAATTTAAGGAATAT+AGG | 0.302976 | 1:+20061957 | None:intergenic |
CCAACTAAAATGATAATAAA+TGG | 0.306043 | 1:-20061603 | MsaT001432.1:CDS |
CTCTTAACTTTCAAATTCAT+TGG | 0.314459 | 1:-20061837 | MsaT001432.1:CDS |
CATTAACAGCTTCAGATGTT+AGG | 0.318603 | 1:+20061147 | None:intergenic |
AGATATATGTGGAGAAATAT+TGG | 0.326941 | 1:-20061995 | MsaT001432.1:CDS |
TTGGAAATTTAAGGAATATA+GGG | 0.346499 | 1:+20061958 | None:intergenic |
TGGCAAGAGAAAATTGAGTA+TGG | 0.387713 | 1:-20061583 | MsaT001432.1:CDS |
ATAATTTATTTCTAAAGTAT+TGG | 0.398912 | 1:+20061782 | None:intergenic |
CATGTCATTTCAATATGTTC+CGG | 0.405450 | 1:-20062186 | MsaT001432.1:CDS |
CCAAAGGAGTTTATGAAAAT+GGG | 0.408096 | 1:-20059783 | MsaT001432.1:CDS |
GAAGAATGCAAAGTGGAGAT+TGG | 0.433387 | 1:-20059645 | MsaT001432.1:CDS |
AATATTGTGGAGTTGAAAAT+GGG | 0.451536 | 1:-20059750 | MsaT001432.1:CDS |
AAGATTATCCTATGAAAATC+CGG | 0.460649 | 1:+20062167 | None:intergenic |
CAAAGTAGCCATGGTGAAGA+AGG | 0.465707 | 1:-20061180 | MsaT001432.1:CDS |
TTAACTTTCAAATTCATTGG+TGG | 0.475675 | 1:-20061834 | MsaT001432.1:CDS |
CGTGGCTGTAGGTTCGGTAG+AGG | 0.492240 | 1:-20059684 | MsaT001432.1:CDS |
CTCTTCATGACTTTCTTCTG+TGG | 0.498976 | 1:+20061674 | None:intergenic |
AACTATTACGAGAGTATTCG+TGG | 0.500607 | 1:-20059702 | MsaT001432.1:CDS |
AGTATTCGTGGCTGTAGGTT+CGG | 0.502330 | 1:-20059690 | MsaT001432.1:CDS |
AGTCATTATAACTTCAAAAG+AGG | 0.507233 | 1:+20061118 | None:intergenic |
ACCACCCAACCAAAATTCTC+AGG | 0.510316 | 1:-20061552 | MsaT001432.1:intron |
GGGATATCATGAAAATATTG+TGG | 0.512948 | 1:-20059763 | MsaT001432.1:CDS |
GTCATTATAACTTCAAAAGA+GGG | 0.514498 | 1:+20061119 | None:intergenic |
GCTGTAGGTTCGGTAGAGGT+TGG | 0.515331 | 1:-20059680 | MsaT001432.1:CDS |
ATATTCCTTAAATTTCCAAA+CGG | 0.536219 | 1:-20061954 | MsaT001432.1:CDS |
AATATCAAATCAGTTGATGA+AGG | 0.540855 | 1:-20061756 | MsaT001432.1:CDS |
TGATGACAGTTCAGATGAGG+TGG | 0.583984 | 1:-20061637 | MsaT001432.1:CDS |
GAGGGTTCCTAAGATATATG+TGG | 0.586451 | 1:-20062006 | MsaT001432.1:CDS |
ATGACTCGATCTTATGCCAA+TGG | 0.587654 | 1:-20061101 | MsaT001432.1:CDS |
AGGTAGTAACAAAGTAGCCA+TGG | 0.603454 | 1:-20061189 | MsaT001432.1:CDS |
GTATCTGCAGTGTGTGCCAA+AGG | 0.603540 | 1:-20059799 | MsaT001432.1:intron |
ACTTACCAAGAAATAGCCAT+TGG | 0.604417 | 1:+20061085 | None:intergenic |
TATGTGGAGAAATATTGGAA+AGG | 0.617787 | 1:-20061990 | MsaT001432.1:CDS |
ACGAGAGTATTCGTGGCTGT+AGG | 0.618825 | 1:-20059695 | MsaT001432.1:CDS |
ATTTATGGAAGAATGCAAAG+TGG | 0.635124 | 1:-20059652 | MsaT001432.1:CDS |
TGAAAATGGGGAGAAAGTCA+TGG | 0.640455 | 1:-20059737 | MsaT001432.1:CDS |
AAGTGATGACAGTTCAGATG+AGG | 0.649994 | 1:-20061640 | MsaT001432.1:CDS |
ATATTGTGGAGTTGAAAATG+GGG | 0.692849 | 1:-20059749 | MsaT001432.1:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr1 | gene | 20059581 | 20062207 | 20059581 | ID=MsaG001432 |
Chr1 | mRNA | 20059581 | 20062207 | 20059581 | ID=MsaT001432.1;Parent=MsaG001432 |
Chr1 | exon | 20059581 | 20059811 | 20059581 | ID=MsaT001432.1.exon4;Parent=MsaT001432.1 |
Chr1 | CDS | 20059581 | 20059811 | 20059581 | ID=cds.MsaT001432.1;Parent=MsaT001432.1 |
Chr1 | exon | 20061091 | 20061209 | 20061091 | ID=MsaT001432.1.exon3;Parent=MsaT001432.1 |
Chr1 | CDS | 20061091 | 20061209 | 20061091 | ID=cds.MsaT001432.1;Parent=MsaT001432.1 |
Chr1 | exon | 20061553 | 20062027 | 20061553 | ID=MsaT001432.1.exon2;Parent=MsaT001432.1 |
Chr1 | CDS | 20061553 | 20062027 | 20061553 | ID=cds.MsaT001432.1;Parent=MsaT001432.1 |
Chr1 | exon | 20062151 | 20062207 | 20062151 | ID=MsaT001432.1.exon1;Parent=MsaT001432.1 |
Chr1 | CDS | 20062151 | 20062207 | 20062151 | ID=cds.MsaT001432.1;Parent=MsaT001432.1 |
Gene Sequence |
Protein sequence |