Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG001832 | AES60398.2 | 86.567 | 134 | 18 | 0 | 1 | 134 | 1 | 134 | 3.22e-73 | 224 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG001832 | tr|G7I6L4|G7I6L4_MEDTR | 86.567 | 134 | 18 | 0 | 1 | 134 | 1 | 134 | 1.54e-73 | 224 |
| Gene ID | Type | Classification |
|---|---|---|
| MsaG001832 | TF | C2C2-GATA |
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG001832 | MtrunA17_Chr5g0399781 | 50.000 | 54 | 26 | 1 | 3 | 56 | 12 | 64 | 6.93e-11 | 58.2 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Find 21 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| AACAAAAGCTTCAAAGTCTA+TGG | 0.184389 | 1:+27397697 | MsaT001832.1:CDS |
| CGCTTGTGGGCTACATTTCA+AGG | 0.378248 | 1:+27397102 | MsaT001832.1:CDS |
| CAATACTATGTAACGCTTGT+GGG | 0.416623 | 1:+27397089 | MsaT001832.1:CDS |
| CCACAAGCGTTACATAGTAT+TGG | 0.447482 | 1:-27397088 | None:intergenic |
| TGGAGATTGGTTTGAAAGCT+CGG | 0.447768 | 1:-27397215 | None:intergenic |
| ATCAGACCTTGACGTTGAAA+AGG | 0.465983 | 1:+27397177 | MsaT001832.1:CDS |
| GAAACTAAACTTTGGCGTAA+AGG | 0.477501 | 1:+27397052 | MsaT001832.1:CDS |
| TCTTCGGAAGATAGTTATCA+AGG | 0.478433 | 1:-27397135 | None:intergenic |
| TGTATACCAAGCAATGAGAT+AGG | 0.478624 | 1:+27397786 | MsaT001832.1:CDS |
| CATAGTATTGGCTTCTCATA+CGG | 0.490978 | 1:-27397076 | None:intergenic |
| ATCGATTGTGAAGAATCAAA+TGG | 0.491491 | 1:+27397665 | MsaT001832.1:CDS |
| GGGCTACATTTCAAGGCTAA+AGG | 0.492067 | 1:+27397109 | MsaT001832.1:CDS |
| GGAGATTGGTTTGAAAGCTC+GGG | 0.493147 | 1:-27397214 | None:intergenic |
| CCAAGCAATGAGATAGGCAT+TGG | 0.496933 | 1:+27397792 | MsaT001832.1:CDS |
| ATTTGATTCTTCACAATCGA+TGG | 0.523804 | 1:-27397663 | None:intergenic |
| CCAATACTATGTAACGCTTG+TGG | 0.549603 | 1:+27397088 | MsaT001832.1:CDS |
| ACAAAAGCTTCAAAGTCTAT+GGG | 0.556384 | 1:+27397698 | MsaT001832.1:CDS |
| CCAATGCCTATCTCATTGCT+TGG | 0.566560 | 1:-27397792 | None:intergenic |
| GAGCTTTCAAACCAATCTCC+AGG | 0.568278 | 1:+27397217 | MsaT001832.1:CDS |
| CTTCGGAAGATAGTTATCAA+GGG | 0.629882 | 1:-27397134 | None:intergenic |
| GATTGTGAAGAATCAAATGG+AGG | 0.680011 | 1:+27397668 | MsaT001832.1:CDS |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| Chr1 | gene | 27397040 | 27397860 | 27397040 | ID=MsaG001832 |
| Chr1 | mRNA | 27397040 | 27397860 | 27397040 | ID=MsaT001832.1;Parent=MsaG001832 |
| Chr1 | exon | 27397040 | 27397238 | 27397040 | ID=MsaT001832.1.exon1;Parent=MsaT001832.1 |
| Chr1 | CDS | 27397040 | 27397238 | 27397040 | ID=cds.MsaT001832.1;Parent=MsaT001832.1 |
| Chr1 | exon | 27397655 | 27397860 | 27397655 | ID=MsaT001832.1.exon2;Parent=MsaT001832.1 |
| Chr1 | CDS | 27397655 | 27397860 | 27397655 | ID=cds.MsaT001832.1;Parent=MsaT001832.1 |
| Gene Sequence |
| Protein sequence |
