AlfalfaGEDB | MsaG004967

M. sativa ssp. caerulea / MsaG004967

KEGG: -
GO: GO:0005575 GO:0005623 GO:0005886 GO:0005911 GO:0009506 GO:0016020 GO:0030054 GO:0044464 GO:0055044 GO:0071944
PFAM: PF12819.10

Nr:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG004967	AES62459.1	81.992	733	44	3	1	645	62	794	0.0	1194

Swissprot:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG004967	sp\|Q9FLW0\|Y5241_ARATH	54.571	722	218	9	1	616	51	768	0.0	753

Trembl:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG004967	tr\|G7IE06\|G7IE06_MEDTR	81.992	733	44	3	1	645	62	794	0.0	1194

TFs/TRs:

Gene ID	Type	Classification

Protein Kinases:

Gene ID	Type	Classification

Network:

Co-expression Network

Gene1	Gene2	correlation coefficient	p_value	FDR
MsaG000032	MsaG004967	0.831667	2.646277e-55	8.036051e-53
MsaG000048	MsaG004967	0.853844	3.516725e-61	2.180127e-58
MsaG000069	MsaG004967	0.855290	1.347612e-61	8.798221e-59
MsaG000137	MsaG004967	0.876723	2.319179e-68	3.601823e-65
MsaG000202	MsaG004967	0.893855	9.526310e-75	3.448506e-71
MsaG000286	MsaG004967	0.890040	3.101061e-73	9.157313e-70
MsaG000316	MsaG004967	0.813363	4.579816e-51	8.496522e-49
MsaG000350	MsaG004967	0.842034	6.148063e-58	2.559518e-55
MsaG000413	MsaG004967	0.855255	1.379480e-61	8.994440e-59
MsaG000416	MsaG004967	0.899383	4.799133e-77	2.368528e-73
MsaG000488	MsaG004967	0.871405	1.432041e-66	1.761445e-63
MsaG000430	MsaG004967	0.839241	3.285192e-57	1.252293e-54
MsaG000621	MsaG004967	0.825422	8.394687e-54	2.136302e-51
MsaG000694	MsaG004967	0.826019	6.071040e-54	1.570844e-51
MsaG000705	MsaG004967	0.841511	8.436898e-58	3.454186e-55
MsaG000719	MsaG004967	0.810403	2.006597e-50	3.460640e-48
MsaG000753	MsaG004967	0.850453	3.203345e-60	1.763358e-57
MsaG000792	MsaG004967	0.888366	1.373873e-72	3.721006e-69
MsaG000793	MsaG004967	0.873870	2.168830e-67	2.968529e-64
MsaG000801	MsaG004967	0.814897	2.108808e-51	4.065901e-49
MsaG000881	MsaG004967	0.838621	4.747780e-57	1.775225e-54
MsaG000944	MsaG004967	0.853046	5.944106e-61	3.582295e-58
MsaG001036	MsaG004967	0.830585	4.865684e-55	1.431822e-52
MsaG001045	MsaG004967	0.850200	3.771458e-60	2.057928e-57
MsaG001048	MsaG004967	0.827666	2.463998e-54	6.675094e-52
MsaG000999	MsaG004967	0.836626	1.533910e-56	5.394745e-54
MsaG001147	MsaG004967	0.906206	4.506172e-80	3.342546e-76
MsaG001294	MsaG004967	0.928869	4.241231e-92	1.577548e-87
MsaG001272	MsaG004967	0.837357	9.997608e-57	3.595114e-54
MsaG001277	MsaG004967	0.809167	3.690357e-50	6.176576e-48
MsaG001373	MsaG004967	0.905068	1.494321e-79	1.033818e-75
MsaG001490	MsaG004967	0.892924	2.256306e-74	7.767270e-71
MsaG001618	MsaG004967	0.811902	9.528952e-51	1.704774e-48
MsaG001619	MsaG004967	0.861986	1.379675e-63	1.157261e-60
MsaG001767	MsaG004967	0.910799	3.034820e-82	3.021959e-78
MsaG001852	MsaG004967	0.830783	4.354172e-55	1.288662e-52
MsaG001875	MsaG004967	0.800858	1.980062e-48	2.729538e-46
MsaG001936	MsaG004967	0.831934	2.276004e-55	6.965525e-53
MsaG002114	MsaG004967	0.913583	1.282064e-83	1.538195e-79
MsaG002122	MsaG004967	0.807297	9.195981e-50	1.471516e-47
MsaG002213	MsaG004967	0.909160	1.863299e-81	1.667816e-77
MsaG002298	MsaG004967	0.858720	1.327949e-62	9.835981e-60
MsaG002636	MsaG004967	0.869260	7.171752e-66	8.057086e-63
MsaG002738	MsaG004967	0.855089	1.540853e-61	9.986046e-59
MsaG002884	MsaG004967	0.858874	1.195052e-62	8.903151e-60
MsaG003042	MsaG004967	0.811929	9.402391e-51	1.683276e-48
MsaG003111	MsaG004967	0.812181	8.288282e-51	1.493013e-48
MsaG003114	MsaG004967	0.804427	3.664103e-49	5.481665e-47
MsaG003184	MsaG004967	0.873604	2.662820e-67	3.601532e-64
MsaG003274	MsaG004967	0.808697	4.646518e-50	7.689837e-48
MsaG003293	MsaG004967	0.857328	3.425895e-62	2.409539e-59
MsaG003300	MsaG004967	0.845647	6.695825e-59	3.134415e-56
MsaG003309	MsaG004967	0.867294	3.064585e-65	3.175924e-62
MsaG003355	MsaG004967	0.826727	4.124155e-54	1.088327e-51
MsaG003435	MsaG004967	0.835473	2.998502e-56	1.018734e-53
MsaG003505	MsaG004967	0.805896	1.811368e-49	2.804126e-47
MsaG003604	MsaG004967	0.871224	1.642260e-66	2.004309e-63
MsaG003605	MsaG004967	0.919046	1.865262e-86	3.279099e-82
MsaG003615	MsaG004967	0.855636	1.069379e-61	7.069921e-59
MsaG003616	MsaG004967	0.898255	1.446921e-76	6.688860e-73
MsaG003635	MsaG004967	0.824241	1.589950e-53	3.917440e-51
MsaG003637	MsaG004967	0.808622	4.819831e-50	7.961897e-48
MsaG003646	MsaG004967	0.872587	5.821001e-67	7.532757e-64
MsaG003738	MsaG004967	0.869909	4.418683e-66	5.101073e-63
MsaG003756	MsaG004967	0.828749	1.354320e-54	3.782031e-52
MsaG003806	MsaG004967	0.873107	3.905517e-67	5.170051e-64
MsaG004007	MsaG004967	0.840830	1.270886e-57	5.092319e-55
MsaG003930	MsaG004967	0.863469	4.837881e-64	4.301109e-61
MsaG003939	MsaG004967	0.900345	1.852295e-77	9.672014e-74
MsaG003976	MsaG004967	0.802726	8.223964e-49	1.182875e-46
MsaG004031	MsaG004967	0.848502	1.114329e-59	5.738455e-57
MsaG004086	MsaG004967	0.905255	1.228182e-79	8.592191e-76
MsaG004102	MsaG004967	0.830106	6.362883e-55	1.847078e-52
MsaG004165	MsaG004967	0.890362	2.323525e-73	6.979119e-70
MsaG004191	MsaG004967	0.928967	3.689944e-92	1.383002e-87
MsaG004296	MsaG004967	0.803769	5.013955e-49	7.387583e-47
MsaG004377	MsaG004967	0.900376	1.795507e-77	9.393333e-74
MsaG004339	MsaG004967	0.881855	3.605146e-70	7.098586e-67
MsaG004348	MsaG004967	0.895652	1.762555e-75	7.035100e-72
MsaG004433	MsaG004967	0.898950	7.339465e-77	3.531371e-73
MsaG004402	MsaG004967	0.871257	1.601373e-66	1.957241e-63
MsaG004404	MsaG004967	0.828281	1.755166e-54	4.837668e-52
MsaG004445	MsaG004967	0.835657	2.695907e-56	9.209641e-54
MsaG004456	MsaG004967	0.877016	1.837535e-68	2.892040e-65
MsaG004466	MsaG004967	0.904253	3.493000e-79	2.300931e-75
MsaG004506	MsaG004967	0.816871	7.683997e-52	1.557857e-49
MsaG004495	MsaG004967	0.846231	4.652751e-59	2.220608e-56
MsaG004596	MsaG004967	0.848204	1.346236e-59	6.864296e-57
MsaG004619	MsaG004967	0.846155	4.879462e-59	2.322917e-56
MsaG004686	MsaG004967	0.887037	4.404054e-72	1.115500e-68
MsaG004712	MsaG004967	0.878885	4.106890e-69	7.041635e-66
MsaG004967	MsaG005038	0.866144	7.089384e-65	7.011641e-62
MsaG004967	MsaG005052	0.824094	1.720772e-53	4.222928e-51
MsaG004967	MsaG005130	0.843879	1.995736e-58	8.814190e-56
MsaG004967	MsaG005157	0.901455	6.099437e-78	3.399939e-74
MsaG004967	MsaG005213	0.943531	3.078437e-102	3.986466e-97
MsaG004967	MsaG005226	0.843803	2.090829e-58	9.211759e-56
MsaG004967	MsaG005232	0.836864	1.334499e-56	4.727458e-54
MsaG004967	MsaG005338	0.905213	1.284121e-79	8.962615e-76
MsaG004967	MsaG005345	0.832699	1.474567e-55	4.613935e-53
MsaG004967	MsaG005348	0.801813	1.264977e-48	1.781943e-46
MsaG004967	MsaG005424	0.921357	1.022893e-87	2.130558e-83
MsaG004967	MsaG005598	0.808783	4.455745e-50	7.389124e-48
MsaG004967	MsaG005693	0.846936	2.993187e-59	1.462538e-56
MsaG004967	MsaG005631	0.912801	3.150085e-83	3.579429e-79
MsaG004967	MsaG005768	0.893707	1.093287e-74	3.925363e-71
MsaG004967	MsaG005773	0.864843	1.813042e-64	1.702314e-61
MsaG004967	MsaG006002	0.897957	1.934201e-76	8.791520e-73
MsaG004967	MsaG005940	0.850665	2.795090e-60	1.549973e-57
MsaG004967	MsaG006129	0.809321	3.421101e-50	5.746973e-48
MsaG004967	MsaG006186	0.916684	3.323409e-85	4.930883e-81
MsaG004967	MsaG006191	0.867438	2.756487e-65	2.873078e-62
MsaG004967	MsaG006277	0.896212	1.034984e-75	4.261932e-72
MsaG004967	MsaG006281	0.890782	1.592087e-73	4.887802e-70
MsaG004967	MsaG006284	0.826912	3.725745e-54	9.882910e-52
MsaG004967	MsaG006293	0.863583	4.462301e-64	3.985152e-61
MsaG004967	MsaG006355	0.813211	4.945166e-51	9.139583e-49
MsaG004967	MsaG006366	0.877359	1.398326e-68	2.234974e-65
MsaG004967	MsaG006395	0.807992	6.558218e-50	1.067075e-47
MsaG004967	MsaG006426	0.814183	3.028313e-51	5.734878e-49
MsaG004967	MsaG006476	0.915710	1.062077e-84	1.470661e-80
MsaG004967	MsaG006491	0.841064	1.104111e-57	4.457077e-55
MsaG004967	MsaG006504	0.864141	2.998951e-64	2.737864e-61
MsaG004967	MsaG006589	0.837397	9.767119e-57	3.516695e-54
MsaG004967	MsaG006545	0.844384	1.462145e-58	6.565390e-56
MsaG004967	MsaG006549	0.822151	4.861522e-53	1.132022e-50
MsaG004967	MsaG006713	0.818014	4.259843e-52	8.894806e-50
MsaG004967	MsaG006756	0.832329	1.819147e-55	5.631162e-53
MsaG004967	MsaG006831	0.875341	6.892860e-68	1.006160e-64
MsaG004967	MsaG006803	0.819504	1.962428e-52	4.259808e-50
MsaG004967	MsaG006937	0.824009	1.801217e-53	4.410266e-51
MsaG004967	MsaG007064	0.865225	1.377442e-64	1.313253e-61
MsaG004967	MsaG007212	0.887252	3.651967e-72	9.351999e-69
MsaG004967	MsaG007317	0.857627	2.797306e-62	1.989111e-59
MsaG004967	MsaG007375	0.918342	4.443433e-86	7.424281e-82
MsaG004967	MsaG007448	0.811782	1.011406e-50	1.804141e-48
MsaG004967	MsaG007496	0.815863	1.288555e-51	2.545911e-49
MsaG004967	MsaG007497	0.832193	1.965255e-55	6.059597e-53
MsaG004967	MsaG007516	0.920045	5.379821e-87	1.017805e-82
MsaG004967	MsaG007577	0.832938	1.286499e-55	4.053821e-53
MsaG004967	MsaG007607	0.882654	1.853064e-70	3.790049e-67
MsaG004967	MsaG007623	0.900808	1.166924e-77	6.263506e-74
MsaG004967	MsaG007610	0.830365	5.503505e-55	1.609457e-52
MsaG004967	MsaG007862	0.867476	2.681826e-65	2.799500e-62
MsaG004967	MsaG007970	0.955961	3.081207e-113	1.138435e-107
MsaG004967	MsaG008118	0.838824	4.209071e-57	1.583893e-54
MsaG004967	MsaG008152	0.870573	2.684211e-66	3.185840e-63
MsaG004967	MsaG008167	0.852298	9.695008e-61	5.691492e-58
MsaG004967	MsaG008189	0.857037	4.172267e-62	2.902650e-59
MsaG004967	MsaG008305	0.903306	9.293271e-79	5.783507e-75
MsaG004967	MsaG008367	0.939458	3.596775e-99	3.214745e-94
MsaG004967	MsaG008444	0.813678	3.908558e-51	7.308727e-49
MsaG004967	MsaG008409	0.846306	4.441250e-59	2.124945e-56
MsaG004967	MsaG008410	0.846026	5.287762e-59	2.506528e-56
MsaG004967	MsaG008616	0.877260	1.513569e-68	2.408260e-65
MsaG004967	MsaG008647	0.864701	2.007319e-64	1.874047e-61
MsaG004967	MsaG008831	0.819028	2.515105e-52	5.391934e-50
MsaG004967	MsaG008825	0.850291	3.555113e-60	1.945949e-57
MsaG004967	MsaG008834	0.879956	1.721535e-69	3.100068e-66
MsaG004967	MsaG008842	0.857625	2.799800e-62	1.990765e-59
MsaG004967	MsaG008994	0.900557	1.499430e-77	7.928221e-74
MsaG004967	MsaG008998	0.821971	5.350136e-53	1.239764e-50
MsaG004967	MsaG009000	0.843288	2.866051e-58	1.242084e-55
MsaG004967	MsaG009112	0.841037	1.122520e-57	4.527327e-55
MsaG004967	MsaG009270	0.906234	4.375205e-80	3.251056e-76
MsaG004967	MsaG009327	0.879736	2.059156e-69	3.671066e-66
MsaG004967	MsaG009348	0.928710	5.306321e-92	1.950672e-87
MsaG004967	MsaG009423	0.810228	2.188296e-50	3.757789e-48
MsaG004967	MsaG009478	0.926231	1.655283e-90	4.996172e-86
MsaG004967	MsaG009674	0.872479	6.323384e-67	8.145396e-64
MsaG004967	MsaG009714	0.865485	1.141719e-64	1.099762e-61
MsaG004967	MsaG009871	0.908774	2.843389e-81	2.482219e-77
MsaG004967	MsaG009874	0.829977	6.840626e-55	1.978436e-52
MsaG004967	MsaG009880	0.831356	3.153701e-55	9.489323e-53
MsaG004967	MsaG009900	0.894286	6.373555e-75	2.362236e-71
MsaG004967	MsaG010009	0.879797	1.958918e-69	3.502575e-66
MsaG004967	MsaG010113	0.814821	2.191927e-51	4.218070e-49
MsaG004967	MsaG010298	0.902976	1.302800e-78	7.948063e-75
MsaG004967	MsaG010303	0.801508	1.460467e-48	2.043052e-46
MsaG004967	MsaG010305	0.804978	2.815582e-49	4.266382e-47
MsaG004967	MsaG010307	0.803581	5.482687e-49	8.043073e-47
MsaG004967	MsaG010491	0.830725	4.498613e-55	1.329137e-52
MsaG004967	MsaG010567	0.848430	1.166806e-59	5.994130e-57
MsaG004967	MsaG010635	0.828834	1.291942e-54	3.616547e-52
MsaG004967	MsaG010597	0.832075	2.100399e-55	6.454617e-53
MsaG004967	MsaG010603	0.873814	2.263713e-67	3.090547e-64
MsaG004967	MsaG010620	0.812417	7.365380e-51	1.334566e-48
MsaG004967	MsaG010710	0.805210	2.518557e-49	3.837010e-47
MsaG004967	MsaG010767	0.811644	1.083831e-50	1.926721e-48
MsaG004967	MsaG010761	0.807745	7.397753e-50	1.196510e-47
MsaG004967	MsaG010753	0.801833	1.253617e-48	1.766722e-46
MsaG004967	MsaG010792	0.848265	1.294864e-59	6.615690e-57
MsaG004967	MsaG010891	0.917566	1.145513e-85	1.812850e-81
MsaG004967	MsaG010952	0.845776	6.177509e-59	2.904093e-56
MsaG004967	MsaG011034	0.863215	5.794482e-64	5.099653e-61
MsaG004967	MsaG011043	0.864028	3.251050e-64	2.954658e-61
MsaG004967	MsaG011119	0.907574	1.044138e-80	8.447269e-77
MsaG004967	MsaG011199	0.874272	1.588070e-67	2.212055e-64
MsaG004967	MsaG011218	0.895478	2.078503e-75	8.215590e-72
MsaG004967	MsaG011230	0.808483	5.160566e-50	8.496323e-48
MsaG004967	MsaG011238	0.922921	1.362704e-88	3.185775e-84
MsaG004967	MsaG011389	0.954105	2.088615e-111	6.583479e-106
MsaG004967	MsaG011428	0.829126	1.098635e-54	3.100820e-52
MsaG004967	MsaG011438	0.881340	5.524756e-70	1.061356e-66
MsaG004967	MsaG011469	0.846008	5.348119e-59	2.533626e-56
MsaG004967	MsaG011478	0.815206	1.801442e-51	3.500619e-49
MsaG004967	MsaG011575	0.830557	4.941501e-55	1.453017e-52
MsaG004967	MsaG011650	0.847460	2.152775e-59	1.070649e-56
MsaG004967	MsaG011690	0.824768	1.196134e-53	2.989794e-51
MsaG004967	MsaG012001	0.843757	2.150063e-58	9.459177e-56
MsaG004967	MsaG011979	0.859188	9.632867e-63	7.262111e-60
MsaG004967	MsaG012048	0.828528	1.530907e-54	4.249113e-52
MsaG004967	MsaG012078	0.810520	1.894245e-50	3.276095e-48
MsaG004967	MsaG012161	0.924738	1.242024e-89	3.339169e-85
MsaG004967	MsaG012229	0.810265	2.148406e-50	3.692644e-48
MsaG004967	MsaG012301	0.836576	1.578672e-56	5.544058e-54
MsaG004967	MsaG012360	0.814736	2.287721e-51	4.392982e-49
MsaG004967	MsaG012393	0.815239	1.771382e-51	3.445106e-49
MsaG004967	MsaG012396	0.867377	2.884192e-65	2.999051e-62
MsaG004967	MsaG012430	0.888105	1.729459e-72	4.623191e-69
MsaG004967	MsaG012488	0.913131	2.157766e-83	2.510588e-79
MsaG004967	MsaG012620	0.898208	1.514968e-76	6.984109e-73
MsaG004967	MsaG012774	0.803369	6.065270e-49	8.854135e-47
MsaG004967	MsaG012887	0.923751	4.598876e-89	1.145079e-84
MsaG004967	MsaG013231	0.820985	9.015222e-53	2.035223e-50
MsaG004967	MsaG013268	0.806287	1.500022e-49	2.343801e-47
MsaG004967	MsaG013308	0.883398	9.924925e-71	2.103527e-67
MsaG004967	MsaG013503	0.806882	1.124612e-49	1.781990e-47
MsaG004967	MsaG013633	0.887083	4.230320e-72	1.073766e-68
MsaG004967	MsaG013968	0.841739	7.349875e-58	3.030978e-55
MsaG004967	MsaG014043	0.834259	6.043967e-56	1.980064e-53
MsaG004967	MsaG014143	0.849418	6.222705e-60	3.306610e-57
MsaG004967	MsaG014166	0.809360	3.356745e-50	5.644177e-48
MsaG004967	MsaG014221	0.858085	2.048752e-62	1.481992e-59
MsaG004967	MsaG014471	0.800191	2.704342e-48	3.672157e-46
MsaG004967	MsaG014548	0.827071	3.416710e-54	9.102795e-52
MsaG004967	MsaG014554	0.812907	5.761372e-51	1.056740e-48
MsaG004967	MsaG014616	0.801572	1.416916e-48	1.985015e-46
MsaG004967	MsaG014630	0.933796	3.041694e-95	1.695753e-90
MsaG004967	MsaG014642	0.895999	1.267178e-75	5.155802e-72
MsaG004967	MsaG014718	0.896909	5.315222e-76	2.276510e-72
MsaG004967	MsaG014726	0.836436	1.713133e-56	5.991422e-54
MsaG004967	MsaG014840	0.857360	3.352510e-62	2.360654e-59
MsaG004967	MsaG014841	0.832964	1.267957e-55	3.998326e-53
MsaG004967	MsaG014844	0.818743	2.918023e-52	6.208905e-50
MsaG004967	MsaG014909	0.816391	9.835286e-52	1.969543e-49
MsaG004967	MsaG014937	0.808939	4.127499e-50	6.870525e-48
MsaG004967	MsaG014940	0.828618	1.456054e-54	4.051516e-52
MsaG004967	MsaG015012	0.817616	5.235268e-52	1.081916e-49
MsaG004967	MsaG015397	0.819755	1.720550e-52	3.759385e-50
MsaG004967	MsaG015690	0.809121	3.775306e-50	6.311852e-48
MsaG004967	MsaG016228	0.801180	1.703013e-48	2.364725e-46
MsaG004967	MsaG016261	0.869826	4.703234e-66	5.410311e-63
MsaG004967	MsaG016375	0.804413	3.688778e-49	5.516810e-47
MsaG004967	MsaG016472	0.889643	4.422649e-73	1.279598e-69
MsaG004967	MsaG016531	0.883755	7.348322e-71	1.584670e-67
MsaG004967	MsaG016573	0.905425	1.027800e-79	7.268734e-76
MsaG004967	MsaG016687	0.939718	2.324483e-99	2.119613e-94
MsaG004967	MsaG016773	0.863012	6.692340e-64	5.843779e-61
MsaG004967	MsaG016801	0.859550	7.507408e-63	5.737684e-60
MsaG004967	MsaG016976	0.853877	3.440731e-61	2.135553e-58
MsaG004967	MsaG016982	0.886560	6.663080e-72	1.648403e-68
MsaG004967	MsaG017061	0.874651	1.182248e-67	1.674508e-64
MsaG004967	MsaG017055	0.880220	1.386975e-69	2.528709e-66
MsaG004967	MsaG017084	0.811413	1.215651e-50	2.148909e-48
MsaG004967	MsaG017148	0.843812	2.079545e-58	9.164593e-56
MsaG004967	MsaG017162	0.818870	2.732130e-52	5.832706e-50
MsaG004967	MsaG017181	0.850204	3.760643e-60	2.052323e-57
MsaG004967	MsaG017182	0.847631	1.933218e-59	9.668914e-57
MsaG004967	MsaG017243	0.930726	2.948254e-93	1.272189e-88
MsaG004967	MsaG017288	0.813695	3.874236e-51	7.247617e-49
MsaG004967	MsaG017334	0.812943	5.657920e-51	1.038706e-48
MsaG004967	MsaG017335	0.863957	3.419754e-64	3.099117e-61
MsaG004967	MsaG017358	0.809929	2.536251e-50	4.323711e-48
MsaG004967	MsaG017362	0.878453	5.821805e-69	9.781023e-66
MsaG004967	MsaG017405	0.936666	3.447376e-97	2.437643e-92
MsaG004967	MsaG017461	0.905979	5.729957e-80	4.190540e-76
MsaG004967	MsaG017540	0.879296	2.944220e-69	5.144369e-66
MsaG004967	MsaG017541	0.815297	1.720102e-51	3.350203e-49
MsaG004967	MsaG017568	0.851076	2.144431e-60	1.206162e-57
MsaG004967	MsaG017569	0.829739	7.809622e-55	2.243336e-52
MsaG004967	MsaG017572	0.803808	4.921844e-49	7.258399e-47
MsaG004967	MsaG017608	0.801887	1.221659e-48	1.723852e-46
MsaG004967	MsaG017587	0.861114	2.538480e-63	2.059142e-60
MsaG004967	MsaG017705	0.853898	3.394490e-61	2.108376e-58
MsaG004967	MsaG017725	0.895240	2.601299e-75	1.014785e-71
MsaG004967	MsaG017825	0.855603	1.093860e-61	7.222985e-59
MsaG004967	MsaG017783	0.853606	4.113476e-61	2.528457e-58
MsaG004967	MsaG017919	0.869223	7.373431e-66	8.270791e-63
MsaG004967	MsaG017879	0.854436	2.378092e-61	1.505832e-58
MsaG004967	MsaG017899	0.842257	5.368981e-58	2.250976e-55
MsaG004967	MsaG017906	0.827662	2.468333e-54	6.686355e-52
MsaG004967	MsaG017963	0.855937	8.746832e-62	5.845486e-59
MsaG004967	MsaG017992	0.858929	1.150466e-62	8.588529e-60
MsaG004967	MsaG018148	0.868099	1.695818e-65	1.816298e-62
MsaG004967	MsaG018167	0.876684	2.392045e-68	3.708417e-65
MsaG004967	MsaG018260	0.870267	3.379404e-66	3.960135e-63
MsaG004967	MsaG018385	0.841439	8.810640e-58	3.599108e-55
MsaG004967	MsaG018437	0.873643	2.583768e-67	3.501012e-64
MsaG004967	MsaG018439	0.902515	2.085116e-78	1.237067e-74
MsaG004967	MsaG018504	0.849839	4.751636e-60	2.561182e-57
MsaG004967	MsaG018501	0.858996	1.098663e-62	8.222755e-60
MsaG004967	MsaG018539	0.804758	3.128013e-49	4.715711e-47
MsaG004967	MsaG018592	0.888729	9.966557e-73	2.749934e-69
MsaG004967	MsaG018649	0.882962	1.432363e-70	2.973619e-67
MsaG004967	MsaG018705	0.817459	5.677802e-52	1.168674e-49
MsaG004967	MsaG018682	0.912834	3.035400e-83	3.457012e-79
MsaG004967	MsaG018755	0.830067	6.503155e-55	1.885693e-52
MsaG004967	MsaG018807	0.913622	1.226060e-83	1.474673e-79
MsaG004967	MsaG018785	0.833329	1.029739e-55	3.282122e-53
MsaG004967	MsaG018792	0.831798	2.458057e-55	7.493084e-53
MsaG004967	MsaG019034	0.847837	1.697272e-59	8.549295e-57
MsaG004967	MsaG019071	0.921743	6.250152e-88	1.336935e-83
MsaG004967	MsaG019184	0.851692	1.438306e-60	8.264764e-58
MsaG004967	MsaG019209	0.861914	1.450335e-63	1.213223e-60
MsaG004967	MsaG019211	0.872761	5.094822e-67	6.642043e-64
MsaG004967	MsaG019268	0.871099	1.805240e-66	2.191482e-63
MsaG004967	MsaG019276	0.868208	1.564202e-65	1.683021e-62
MsaG004967	MsaG019437	0.848722	9.691754e-60	5.028657e-57
MsaG004967	MsaG019453	0.806758	1.194542e-49	1.887333e-47
MsaG004967	MsaG019532	0.878802	4.392569e-69	7.502717e-66
MsaG004967	MsaG019557	0.921339	1.047112e-87	2.177096e-83
MsaG004967	MsaG019616	0.858196	1.899239e-62	1.379509e-59
MsaG004967	MsaG019641	0.936155	7.769298e-97	5.267799e-92
MsaG004967	MsaG019648	0.860217	4.736804e-63	3.713942e-60
MsaG004967	MsaG019669	0.817803	4.750925e-52	9.866150e-50
MsaG004967	MsaG019740	0.825470	8.180161e-54	2.084487e-51
MsaG004967	MsaG019937	0.813498	4.278749e-51	7.964839e-49
MsaG004967	MsaG019939	0.836227	1.935190e-56	6.725343e-54
MsaG004967	MsaG019945	0.852715	7.386127e-61	4.399612e-58
MsaG004967	MsaG020015	0.840186	1.870167e-57	7.343362e-55
MsaG004967	MsaG020042	0.913940	8.475173e-84	1.041052e-79
MsaG004967	MsaG020075	0.848884	8.741879e-60	4.561113e-57
MsaG004967	MsaG020096	0.802510	9.107389e-49	1.303524e-46
MsaG004967	MsaG020157	0.844202	1.636187e-58	7.303358e-56
MsaG004967	MsaG020255	0.803239	6.449018e-49	9.386302e-47
MsaG004967	MsaG020257	0.831670	2.641201e-55	8.021397e-53
MsaG004967	MsaG020356	0.834802	4.419827e-56	1.471756e-53
MsaG004967	MsaG020370	0.832005	2.185561e-55	6.702612e-53
MsaG004967	MsaG020405	0.816561	9.014364e-52	1.813018e-49
MsaG004967	MsaG020423	0.815274	1.740320e-51	3.387630e-49
MsaG004967	MsaG020499	0.887811	2.238539e-72	5.896477e-69
MsaG004967	MsaG020513	0.810231	2.185007e-50	3.752407e-48
MsaG004967	MsaG020533	0.919618	9.171149e-87	1.679902e-82
MsaG004967	MsaG020558	0.811736	1.035010e-50	1.844133e-48
MsaG004967	MsaG020552	0.895826	1.493723e-75	6.019822e-72
MsaG004967	MsaG020577	0.918042	6.411490e-86	1.048420e-81
MsaG004967	MsaG020576	0.908207	5.266773e-81	4.433729e-77
MsaG004967	MsaG020860	0.896245	1.002712e-75	4.137741e-72
MsaG004967	MsaG021034	0.809769	2.744499e-50	4.660793e-48
MsaG004967	MsaG021042	0.837677	8.283576e-57	3.008062e-54
MsaG004967	MsaG021054	0.910612	3.740002e-82	3.679944e-78
MsaG004967	MsaG021109	0.912327	5.416577e-83	5.959662e-79
MsaG004967	MsaG021135	0.805928	1.783649e-49	2.763274e-47
MsaG004967	MsaG021139	0.822627	3.774768e-53	8.902756e-51
MsaG004967	MsaG021153	0.847796	1.742458e-59	8.764602e-57
MsaG004967	MsaG021160	0.860017	5.436989e-63	4.229967e-60
MsaG004967	MsaG021324	0.824971	1.072242e-53	2.695048e-51
MsaG004967	MsaG021339	0.835094	3.733958e-56	1.254279e-53
MsaG004967	MsaG021313	0.810624	1.798452e-50	3.118352e-48
MsaG004967	MsaG021344	0.807638	7.791203e-50	1.256910e-47
MsaG004967	MsaG021422	0.800039	2.902938e-48	3.928415e-46
MsaG004967	MsaG021438	0.814431	2.670906e-51	5.089709e-49
MsaG004967	MsaG021649	0.846018	5.313790e-59	2.518277e-56
MsaG004967	MsaG021722	0.866772	4.487566e-65	4.553674e-62
MsaG004967	MsaG021869	0.800131	2.780558e-48	3.770572e-46
MsaG004967	MsaG021956	0.810409	2.000267e-50	3.450276e-48
MsaG004967	MsaG022018	0.851078	2.141412e-60	1.204541e-57
MsaG004967	MsaG022226	0.846523	3.877252e-59	1.868506e-56
MsaG004967	MsaG022259	0.818541	3.241336e-52	6.860573e-50
MsaG004967	MsaG022303	0.818888	2.705904e-52	5.779464e-50
MsaG004967	MsaG022321	0.833033	1.218695e-55	3.850888e-53
MsaG004967	MsaG022404	0.894259	6.535327e-75	2.418604e-71
MsaG004967	MsaG022540	0.935625	1.792658e-96	1.161314e-91
MsaG004967	MsaG022550	0.869501	5.992789e-66	6.800653e-63
MsaG004967	MsaG022553	0.815826	1.312986e-51	2.591783e-49
MsaG004967	MsaG022560	0.807955	6.675686e-50	1.085222e-47
MsaG004967	MsaG022793	0.842282	5.287699e-58	2.218776e-55
MsaG004967	MsaG022850	0.838033	6.715734e-57	2.465577e-54
MsaG004967	MsaG022907	0.831123	3.595476e-55	1.074607e-52
MsaG004967	MsaG023035	0.873679	2.512177e-67	3.409661e-64
MsaG004967	MsaG023069	0.851637	1.491011e-60	8.550715e-58
MsaG004967	MsaG023110	0.851798	1.342786e-60	7.745023e-58
MsaG004967	MsaG023140	0.828353	1.686760e-54	4.658698e-52
MsaG004967	MsaG023272	0.848850	8.935793e-60	4.656728e-57
MsaG004967	MsaG023285	0.809711	2.824314e-50	4.789549e-48
MsaG004967	MsaG023375	0.813849	3.585047e-51	6.732781e-49
MsaG004967	MsaG023554	0.925328	5.625728e-90	1.584034e-85
MsaG004967	MsaG023556	0.806450	1.386367e-49	2.174625e-47
MsaG004967	MsaG023522	0.916498	4.153406e-85	6.078428e-81
MsaG004967	MsaG023671	0.804205	4.073715e-49	6.063303e-47
MsaG004967	MsaG023746	0.808214	5.885730e-50	9.627534e-48
MsaG004967	MsaG023747	0.852411	9.009410e-61	5.309838e-58
MsaG004967	MsaG023749	0.820200	1.362447e-52	3.012616e-50
MsaG004967	MsaG023911	0.805997	1.725319e-49	2.677167e-47
MsaG004967	MsaG023912	0.872146	8.148880e-67	1.034782e-63
MsaG004967	MsaG023913	0.838097	6.468293e-57	2.379469e-54
MsaG004967	MsaG023970	0.907771	8.447328e-81	6.916308e-77
MsaG004967	MsaG023979	0.918162	5.536448e-86	9.130755e-82
MsaG004967	MsaG023997	0.834950	4.059064e-56	1.357543e-53
MsaG004967	MsaG024000	0.817575	5.346152e-52	1.103698e-49
MsaG004967	MsaG024046	0.851543	1.584197e-60	9.055339e-58
MsaG004967	MsaG024058	0.830932	4.004153e-55	1.190165e-52
MsaG004967	MsaG024126	0.852334	9.474000e-61	5.568400e-58
MsaG004967	MsaG024118	0.877693	1.070783e-68	1.737740e-65
MsaG004967	MsaG024205	0.825350	8.730888e-54	2.217520e-51
MsaG004967	MsaG024360	0.839536	2.757353e-57	1.060787e-54
MsaG004967	MsaG024380	0.882754	1.704661e-70	3.503319e-67
MsaG004967	MsaG024405	0.859240	9.289609e-63	7.017829e-60
MsaG004967	MsaG024425	0.857440	3.174183e-62	2.241689e-59
MsaG004967	MsaG024459	0.880781	8.754154e-70	1.639105e-66
MsaG004967	MsaG024803	0.806183	1.577419e-49	2.458588e-47
MsaG004967	MsaG024823	0.824272	1.562926e-53	3.854239e-51
MsaG004967	MsaG025076	0.871963	9.370633e-67	1.180524e-63
MsaG004967	MsaG025643	0.824720	1.227535e-53	3.064270e-51
MsaG004967	MsaG026152	0.852367	9.268795e-61	5.454205e-58
MsaG004967	MsaG026513	0.851596	1.530744e-60	8.765975e-58
MsaG004967	MsaG026553	0.875325	6.982923e-68	1.018607e-64
MsaG004967	MsaG026675	0.875969	4.209742e-68	6.321413e-65
MsaG004967	MsaG026696	0.891361	9.426426e-74	2.983484e-70
MsaG004967	MsaG026798	0.876257	3.355190e-68	5.103412e-65
MsaG004967	MsaG026825	0.814729	2.296641e-51	4.409211e-49
MsaG004967	MsaG027021	0.938999	7.724674e-99	6.663734e-94
MsaG004967	MsaG027041	0.876314	3.204994e-68	4.887603e-65
MsaG004967	MsaG027095	0.920044	5.382228e-87	1.018230e-82
MsaG004967	MsaG027129	0.909910	8.153947e-82	7.649345e-78
MsaG004967	MsaG027134	0.889956	3.343398e-73	9.829938e-70
MsaG004967	MsaG027142	0.804366	3.772985e-49	5.636642e-47
MsaG004967	MsaG027183	0.835983	2.230944e-56	7.695961e-54
MsaG004967	MsaG027217	0.907277	1.436872e-80	1.140342e-76
MsaG004967	MsaG027229	0.858128	1.988949e-62	1.440965e-59
MsaG004967	MsaG027313	0.805883	1.822761e-49	2.820916e-47
MsaG004967	MsaG027369	0.860156	4.939667e-63	3.863876e-60
MsaG004967	MsaG027432	0.851138	2.060074e-60	1.161193e-57
MsaG004967	MsaG027408	0.857723	2.621059e-62	1.870650e-59
MsaG004967	MsaG027500	0.827605	2.547663e-54	6.890226e-52
MsaG004967	MsaG027562	0.844872	1.082471e-58	4.939741e-56
MsaG004967	MsaG027566	0.827418	2.823681e-54	7.596502e-52
MsaG004967	MsaG027679	0.899042	6.708817e-77	3.245254e-73
MsaG004967	MsaG027805	0.907253	1.474115e-80	1.168065e-76
MsaG004967	MsaG027909	0.846719	3.429257e-59	1.663555e-56
MsaG004967	MsaG027911	0.874732	1.109788e-67	1.577339e-64
MsaG004967	MsaG027935	0.838480	5.159345e-57	1.920608e-54
MsaG004967	MsaG028003	0.812633	6.609379e-51	1.204022e-48
MsaG004967	MsaG027995	0.813441	4.403634e-51	8.185832e-49
MsaG004967	MsaG028025	0.864585	2.181836e-64	2.027432e-61
MsaG004967	MsaG028158	0.891909	5.722667e-74	1.865170e-70
MsaG004967	MsaG028180	0.863343	5.292462e-64	4.681753e-61
MsaG004967	MsaG028200	0.809941	2.520599e-50	4.298338e-48
MsaG004967	MsaG028232	0.805043	2.729057e-49	4.141651e-47
MsaG004967	MsaG028282	0.814646	2.395498e-51	4.589398e-49
MsaG004967	MsaG028511	0.881147	6.478514e-70	1.233355e-66
MsaG004967	MsaG028585	0.868299	1.462476e-65	1.579336e-62
MsaG004967	MsaG028625	0.892342	3.851029e-74	1.284585e-70
MsaG004967	MsaG028627	0.869650	5.364206e-66	6.125493e-63
MsaG004967	MsaG028632	0.805006	2.777624e-49	4.211687e-47
MsaG004967	MsaG028657	0.858019	2.142876e-62	1.546321e-59
MsaG004967	MsaG028842	0.872949	4.410390e-67	5.797584e-64
MsaG004967	MsaG028874	0.810956	1.525827e-50	2.667128e-48
MsaG004967	MsaG028906	0.801998	1.159691e-48	1.640454e-46
MsaG004967	MsaG028986	0.912292	5.636035e-83	6.188736e-79
MsaG004967	MsaG029064	0.845210	8.779501e-59	4.050657e-56
MsaG004967	MsaG029065	0.858336	1.725622e-62	1.260013e-59
MsaG004967	MsaG029106	0.812778	6.146826e-51	1.123803e-48
MsaG004967	MsaG029174	0.845634	6.749201e-59	3.158113e-56
MsaG004967	MsaG029234	0.869646	5.378344e-66	6.140869e-63
MsaG004967	MsaG029295	0.882205	2.696120e-70	5.395557e-67
MsaG004967	MsaG029313	0.841274	9.733624e-58	3.955253e-55
MsaG004967	MsaG029377	0.800905	1.937560e-48	2.673710e-46
MsaG004967	MsaG029315	0.836551	1.602463e-56	5.623314e-54
MsaG004967	MsaG029352	0.896454	8.220474e-76	3.431265e-72
MsaG004967	MsaG029401	0.848436	1.162282e-59	5.972035e-57
MsaG004967	MsaG029403	0.802874	7.669378e-49	1.106848e-46
MsaG004967	MsaG029451	0.865062	1.549546e-64	1.467578e-61
MsaG004967	MsaG029462	0.834841	4.320674e-56	1.440445e-53
MsaG004967	MsaG029689	0.826890	3.771644e-54	9.998249e-52
MsaG004967	MsaG029820	0.805589	2.099268e-49	3.226481e-47
MsaG004967	MsaG029840	0.844773	1.150455e-58	5.232712e-56
MsaG004967	MsaG029944	0.882493	2.120959e-70	4.303361e-67
MsaG004967	MsaG029916	0.881547	4.653267e-70	9.029372e-67
MsaG004967	MsaG030015	0.817324	6.086680e-52	1.248517e-49
MsaG004967	MsaG030031	0.825920	6.405583e-54	1.652929e-51
MsaG004967	MsaG030113	0.831520	2.875791e-55	8.694830e-53
MsaG004967	MsaG030094	0.848781	9.335368e-60	4.853379e-57
MsaG004967	MsaG030201	0.894074	7.768034e-75	2.845381e-71
MsaG004967	MsaG030215	0.846445	4.070109e-59	1.956346e-56
MsaG004967	MsaG030238	0.857001	4.272361e-62	2.968308e-59
MsaG004967	MsaG030240	0.815539	1.520516e-51	2.979610e-49
MsaG004967	MsaG030337	0.921442	9.180195e-88	1.923887e-83
MsaG004967	MsaG030353	0.901223	7.699444e-78	4.232513e-74
MsaG004967	MsaG030454	0.847401	2.234650e-59	1.109142e-56
MsaG004967	MsaG030476	0.800763	2.070784e-48	2.848521e-46
MsaG004967	MsaG030494	0.817459	5.676621e-52	1.168441e-49
MsaG004967	MsaG030619	0.877200	1.587651e-68	2.519314e-65
MsaG004967	MsaG030698	0.849588	5.580019e-60	2.982425e-57
MsaG004967	MsaG030665	0.879098	3.457433e-69	5.986179e-66
MsaG004967	MsaG030779	0.813771	3.728671e-51	6.988804e-49
MsaG004967	MsaG030760	0.859462	7.974203e-63	6.074608e-60
MsaG004967	MsaG030830	0.809775	2.736643e-50	4.648091e-48
MsaG004967	MsaG030888	0.822287	4.523433e-53	1.057121e-50
MsaG004967	MsaG031023	0.895482	2.069669e-75	8.182945e-72
MsaG004967	MsaG031093	0.858972	1.116701e-62	8.350436e-60
MsaG004967	MsaG031125	0.810758	1.682902e-50	2.927562e-48
MsaG004967	MsaG031216	0.854040	3.090943e-61	1.929593e-58
MsaG004967	MsaG031319	0.819411	2.059745e-52	4.460329e-50
MsaG004967	MsaG031475	0.901205	7.844781e-78	4.308175e-74
MsaG004967	MsaG031500	0.840100	1.969241e-57	7.711465e-55
MsaG004967	MsaG031706	0.923022	1.194615e-88	2.814866e-84
MsaG004967	MsaG032127	0.862803	7.755283e-64	6.716797e-61
MsaG004967	MsaG032227	0.889270	6.167646e-73	1.749894e-69
MsaG004967	MsaG032230	0.805298	2.415205e-49	3.686933e-47
MsaG004967	MsaG032437	0.887470	3.018123e-72	7.815753e-69
MsaG004967	MsaG032492	0.907811	8.086480e-81	6.637486e-77
MsaG004967	MsaG032564	0.831013	3.826998e-55	1.140149e-52
MsaG004967	MsaG032554	0.854366	2.490833e-61	1.573318e-58
MsaG004967	MsaG032712	0.839017	3.754605e-57	1.421355e-54
MsaG004967	MsaG032927	0.800582	2.253145e-48	3.086751e-46
MsaG004967	MsaG033171	0.805467	2.226322e-49	3.412006e-47
MsaG004967	MsaG033289	0.878029	8.185954e-69	1.348948e-65
MsaG004967	MsaG033528	0.899436	4.554967e-77	2.254701e-73
MsaG004967	MsaG033570	0.811325	1.270337e-50	2.240742e-48
MsaG004967	MsaG033936	0.816407	9.751253e-52	1.953540e-49
MsaG004967	MsaG033931	0.813885	3.521203e-51	6.618716e-49
MsaG004967	MsaG033932	0.821438	7.097881e-53	1.621579e-50
MsaG004967	MsaG033856	0.851282	1.876527e-60	1.062968e-57
MsaG004967	MsaG033860	0.835340	3.238849e-56	1.095978e-53
MsaG004967	MsaG033861	0.841366	9.207038e-58	3.752214e-55
MsaG004967	MsaG033924	0.826358	5.044480e-54	1.317609e-51
MsaG004967	MsaG034031	0.842305	5.216040e-58	2.190304e-55
MsaG004967	MsaG034119	0.903995	4.565060e-79	2.959403e-75
MsaG004967	MsaG034365	0.867774	2.154281e-65	2.276899e-62
MsaG004967	MsaG034370	0.851610	1.516924e-60	8.690793e-58
MsaG004967	MsaG034410	0.836288	1.868262e-56	6.504641e-54
MsaG004967	MsaG034401	0.913296	1.785544e-83	2.100672e-79
MsaG004967	MsaG034510	0.931211	1.452760e-93	6.527193e-89
MsaG004967	MsaG034552	0.885723	1.373069e-71	3.258192e-68
MsaG004967	MsaG034689	0.864055	3.188804e-64	2.901326e-61
MsaG004967	MsaG034834	0.811208	1.346087e-50	2.367539e-48
MsaG004967	MsaG035166	0.812911	5.748940e-51	1.054575e-48
MsaG004967	MsaG035157	0.923249	8.880606e-89	2.130424e-84
MsaG004967	MsaG035269	0.823055	3.003188e-53	7.165599e-51
MsaG004967	MsaG035271	0.845442	7.602195e-59	3.534636e-56
MsaG004967	MsaG035467	0.805920	1.789967e-49	2.772570e-47
MsaG004967	MsaG035531	0.862430	1.009234e-63	8.613733e-61
MsaG004967	MsaG035540	0.883707	7.651022e-71	1.646168e-67
MsaG004967	MsaG035553	0.892793	2.544821e-74	8.697784e-71
MsaG004967	MsaG035631	0.807973	6.618723e-50	1.076425e-47
MsaG004967	MsaG035656	0.822986	3.116359e-53	7.421625e-51
MsaG004967	MsaG035658	0.800078	2.850597e-48	3.861002e-46
MsaG004967	MsaG035678	0.845865	5.845074e-59	2.755885e-56
MsaG004967	MsaG035715	0.923468	6.666459e-89	1.625646e-84
MsaG004967	MsaG035857	0.815245	1.766737e-51	3.436543e-49
MsaG004967	MsaG036107	0.805750	1.943448e-49	2.998248e-47
MsaG004967	MsaG036138	0.847561	2.020247e-59	1.008105e-56
MsaG004967	MsaG036159	0.887753	2.354287e-72	6.183043e-69
MsaG004967	MsaG036331	0.823982	1.827599e-53	4.471364e-51
MsaG004967	MsaG036424	0.857149	3.867800e-62	2.701940e-59
MsaG004967	MsaG036431	0.865602	1.049736e-64	1.015757e-61
MsaG004967	MsaG036481	0.841110	1.074328e-57	4.342978e-55
MsaG004967	MsaG036594	0.910833	2.920801e-82	2.914908e-78
MsaG004967	MsaG036658	0.811919	9.447545e-51	1.690959e-48
MsaG004967	MsaG036982	0.825459	8.231509e-54	2.096900e-51
MsaG004967	MsaG037261	0.830275	5.788715e-55	1.688547e-52
MsaG004967	MsaG037309	0.853585	4.171213e-61	2.561966e-58
MsaG004967	MsaG037325	0.886229	8.877101e-72	2.160157e-68
MsaG004967	MsaG037339	0.831205	3.434461e-55	1.028845e-52
MsaG004967	MsaG037569	0.832478	1.671234e-55	5.195875e-53
MsaG004967	MsaG037572	0.867553	2.534623e-65	2.654723e-62
MsaG004967	MsaG037735	0.868199	1.574892e-65	1.693851e-62
MsaG004967	MsaG037805	0.817748	4.888269e-52	1.013671e-49
MsaG004967	MsaG037891	0.888793	9.418670e-73	2.607201e-69
MsaG004967	MsaG037924	0.904657	2.294720e-79	1.548644e-75
MsaG004967	MsaG037967	0.843191	3.040802e-58	1.313678e-55
MsaG004967	MsaG037969	0.885753	1.337442e-71	3.178973e-68
MsaG004967	MsaG038089	0.913013	2.470173e-83	2.848426e-79
MsaG004967	MsaG038236	0.806713	1.220795e-49	1.926722e-47
MsaG004967	MsaG038325	0.804834	3.016905e-49	4.556248e-47
MsaG004967	MsaG038327	0.810429	1.980674e-50	3.418157e-48
MsaG004967	MsaG038503	0.836990	1.239705e-56	4.408312e-54
MsaG004967	MsaG038522	0.801569	1.418826e-48	1.987565e-46
MsaG004967	MsaG038993	0.921686	6.721523e-88	1.432190e-83
MsaG004967	MsaG039483	0.847617	1.950839e-59	9.752786e-57
MsaG004967	MsaG039633	0.849729	5.099974e-60	2.738675e-57
MsaG004967	MsaG039983	0.806706	1.224600e-49	1.932460e-47
MsaG004967	MsaG040153	0.819691	1.779447e-52	3.881574e-50
MsaG004967	MsaG040351	0.952521	6.664530e-110	1.830068e-104
MsaG004967	MsaG040450	0.820085	1.447612e-52	3.191076e-50
MsaG004967	MsaG040540	0.937858	5.041745e-98	3.941764e-93
MsaG004967	MsaG040595	0.892118	4.728466e-74	1.558234e-70
MsaG004967	MsaG040599	0.918937	2.135279e-86	3.724424e-82
MsaG004967	MsaG040685	0.876243	3.392322e-68	5.156750e-65
MsaG004967	MsaG040731	0.896149	1.098631e-75	4.508411e-72
MsaG004967	MsaG041086	0.850702	2.729130e-60	1.515389e-57
MsaG004967	MsaG041115	0.841375	9.158301e-58	3.733340e-55
MsaG004967	MsaG041272	0.800624	2.209290e-48	3.029575e-46
MsaG004967	MsaG041293	0.829415	9.357755e-55	2.663116e-52
MsaG004967	MsaG041505	0.834377	5.646628e-56	1.856584e-53
MsaG004967	MsaG041511	0.825895	6.492464e-54	1.674188e-51
MsaG004967	MsaG041533	0.802350	9.821861e-49	1.400663e-46
MsaG004967	MsaG041680	0.808336	5.545391e-50	9.097323e-48
MsaG004967	MsaG041704	0.873167	3.729781e-67	4.950089e-64
MsaG004967	MsaG041898	0.887011	4.505630e-72	1.139658e-68
MsaG004967	MsaG041935	0.898106	1.673749e-76	7.671907e-73
MsaG004967	MsaG041955	0.928075	1.296640e-91	4.539101e-87
MsaG004967	MsaG042023	0.811543	1.139747e-50	2.021141e-48
MsaG004967	MsaG042032	0.820904	9.406450e-53	2.118951e-50
MsaG004967	MsaG042053	0.856305	6.829795e-62	4.626910e-59
MsaG004967	MsaG042543	0.811744	1.031110e-50	1.837518e-48
MsaG004967	MsaG042623	0.818068	4.143580e-52	8.663763e-50
MsaG004967	MsaG042634	0.917926	7.389072e-86	1.197620e-81
MsaG004967	MsaG042729	0.842416	4.876609e-58	2.055177e-55
MsaG004967	MsaG042790	0.842274	5.315887e-58	2.229949e-55
MsaG004967	MsaG042796	0.855063	1.568096e-61	1.015328e-58
MsaG004967	MsaG042742	0.849549	5.723288e-60	3.054885e-57
MsaG004967	MsaG042917	0.880070	1.568104e-69	2.839040e-66
MsaG004967	MsaG042932	0.801055	1.805821e-48	2.500337e-46
MsaG004967	MsaG043169	0.848941	8.431234e-60	4.407634e-57
MsaG004967	MsaG043183	0.829954	6.926597e-55	2.002023e-52
MsaG004967	MsaG043238	0.802065	1.123636e-48	1.591912e-46
MsaG004967	MsaG043395	0.854284	2.629376e-61	1.655992e-58
MsaG004967	MsaG043554	0.895748	1.609102e-75	6.455788e-72
MsaG004967	MsaG043716	0.804672	3.259281e-49	4.903758e-47
MsaG004967	MsaG043847	0.810865	1.596291e-50	2.784088e-48
MsaG004967	MsaG044023	0.800724	2.108546e-48	2.897929e-46
MsaG004967	MsaG044093	0.911640	1.180322e-82	1.241092e-78
MsaG004967	MsaG044228	0.856185	7.402993e-62	4.993004e-59
MsaG004967	MsaG044267	0.913712	1.104268e-83	1.336393e-79
MsaG004967	MsaG044277	0.831087	3.669536e-55	1.095602e-52
MsaG004967	MsaG044330	0.824601	1.309549e-53	3.258398e-51
MsaG004967	MsaG044473	0.814075	3.198130e-51	6.040054e-49
MsaG004967	MsaG044575	0.838783	4.312447e-57	1.620642e-54
MsaG004967	MsaG044570	0.801833	1.253429e-48	1.766462e-46
MsaG004967	MsaG044542	0.868706	1.082378e-65	1.188576e-62
MsaG004967	MsaG044602	0.818119	4.034808e-52	8.447559e-50
MsaG004967	MsaG044581	0.831184	3.474243e-55	1.040169e-52
MsaG004967	MsaG044851	0.856674	5.329641e-62	3.659576e-59
MsaG004967	MsaG044867	0.834687	4.724347e-56	1.567790e-53
MsaG004967	MsaG044932	0.849795	4.888370e-60	2.630875e-57
MsaG004967	MsaG045044	0.844638	1.250459e-58	5.662387e-56
MsaG004967	MsaG045143	0.880544	1.063464e-69	1.969256e-66
MsaG004967	MsaG045187	0.948249	4.333461e-106	8.446314e-101
MsaG004967	MsaG045234	0.808388	5.405242e-50	8.878568e-48
MsaG004967	MsaG045275	0.923730	4.726335e-89	1.174862e-84
MsaG004967	MsaG045326	0.869309	6.918199e-66	7.788262e-63
MsaG004967	MsaG045427	0.827025	3.503176e-54	9.321294e-52
MsaG004967	MsaG045429	0.801359	1.566294e-48	2.183702e-46
MsaG004967	MsaG045454	0.816116	1.132214e-51	2.251444e-49
MsaG004967	MsaG045456	0.927191	4.431410e-91	1.444104e-86
MsaG004967	MsaG045537	0.868260	1.505444e-65	1.623177e-62
MsaG004967	MsaG045542	0.845099	9.402408e-59	4.322749e-56
MsaG004967	MsaG045665	0.948874	1.257170e-106	2.572778e-101
MsaG004967	MsaG045735	0.875231	7.516047e-68	1.091917e-64
MsaG004967	MsaG045736	0.820695	1.050287e-52	2.352705e-50
MsaG004967	MsaG045753	0.843681	2.252544e-58	9.886447e-56
MsaG004967	MsaG045776	0.913282	1.814674e-83	2.133061e-79
MsaG004967	MsaG045796	0.850198	3.774010e-60	2.059241e-57
MsaG004967	MsaG045869	0.839261	3.247984e-57	1.238858e-54
MsaG004967	MsaG045896	0.811686	1.061377e-50	1.888783e-48
MsaG004967	MsaG045923	0.894352	5.988056e-75	2.227144e-71
MsaG004967	MsaG045994	0.871907	9.780322e-67	1.229369e-63
MsaG004967	MsaG046035	0.808363	5.470516e-50	8.980444e-48
MsaG004967	MsaG046056	0.860311	4.436442e-63	3.491292e-60
MsaG004967	MsaG046172	0.800629	2.204854e-48	3.023777e-46
MsaG004967	MsaG046278	0.837792	7.743474e-57	2.821891e-54
MsaG004967	MsaG046480	0.870884	2.122923e-66	2.553984e-63
MsaG004967	MsaG046511	0.802113	1.098346e-48	1.557754e-46
MsaG004967	MsaG046687	0.834055	6.794290e-56	2.212352e-53
MsaG004967	MsaG046584	0.910273	5.455976e-82	5.245393e-78
MsaG004967	MsaG046766	0.831177	3.488017e-55	1.044081e-52
MsaG004967	MsaG046755	0.945931	3.736066e-104	5.955591e-99
MsaG004967	MsaG046860	0.867092	3.551897e-65	3.651375e-62
MsaG004967	MsaG046784	0.862031	1.336519e-63	1.123045e-60
MsaG004967	MsaG046805	0.926284	1.540970e-90	4.667459e-86
MsaG004967	MsaG046866	0.873578	2.717076e-67	3.670494e-64
MsaG004967	MsaG046967	0.802246	1.031802e-48	1.467835e-46
MsaG004967	MsaG046973	0.922927	1.352951e-88	3.164274e-84
MsaG004967	MsaG047001	0.885993	1.088017e-71	2.616986e-68
MsaG004967	MsaG047023	0.837624	8.547160e-57	3.098760e-54
MsaG004967	MsaG047065	0.828163	1.872890e-54	5.145134e-52
MsaG004967	MsaG047132	0.845132	9.217008e-59	4.241589e-56
MsaG004967	MsaG001761	0.887780	2.301045e-72	6.050873e-69
MsaG004967	MsaG002107	0.851713	1.419407e-60	8.162059e-58
MsaG004967	MsaG002246	0.887715	2.434721e-72	6.382331e-69
MsaG004967	MsaG001492	0.852954	6.315036e-61	3.793513e-58
MsaG004967	MsaG001472	0.876254	3.363033e-68	5.114771e-65
MsaG004967	MsaG005823	0.871979	9.257372e-67	1.167088e-63
MsaG004967	MsaG001311	0.800101	2.820759e-48	3.822455e-46
MsaG004967	MsaG002072	0.815296	1.720813e-51	3.351498e-49
MsaG004967	MsaG003314	0.811035	1.466963e-50	2.569260e-48
MsaG004967	MsaG001093	0.834173	6.348196e-56	2.074391e-53
MsaG004967	MsaG002432	0.877425	1.326827e-68	2.126924e-65
MsaG004967	MsaG001319	0.807603	7.926510e-50	1.277651e-47
MsaG004967	MsaG000821	0.947802	1.040012e-105	1.952384e-100
MsaG004967	MsaG001536	0.916042	7.161623e-85	1.014745e-80
MsaG004967	MsaG001760	0.899189	5.805536e-77	2.831964e-73
MsaG004967	MsaG007676	0.941178	1.937550e-100	2.014954e-95
MsaG004967	MsaG008384	0.925051	8.163132e-90	2.248182e-85
MsaG004967	MsaG010542	0.928133	1.195644e-91	4.207032e-87
MsaG004967	MsaG007270	0.832986	1.251758e-55	3.949872e-53
MsaG004967	MsaG008757	0.852001	1.176931e-60	6.837732e-58
MsaG004967	MsaG006166	0.825336	8.796629e-54	2.233365e-51
MsaG004967	MsaG007963	0.850332	3.464676e-60	1.899061e-57
MsaG004967	MsaG008818	0.808499	5.118456e-50	8.430292e-48
MsaG004967	MsaG009219	0.840876	1.236459e-57	4.961454e-55
MsaG004967	MsaG006009	0.928177	1.123978e-91	3.969128e-87
MsaG004967	MsaG007591	0.821147	8.275950e-53	1.876336e-50
MsaG004967	MsaG010025	0.866754	4.548300e-65	4.611680e-62
MsaG004967	MsaG010536	0.855738	9.989609e-62	6.627900e-59
MsaG004967	MsaG009684	0.878414	6.004560e-69	1.007065e-65
MsaG004967	MsaG007989	0.821985	5.310575e-53	1.231077e-50
MsaG004967	MsaG008985	0.865202	1.400925e-64	1.334380e-61
MsaG004967	MsaG013680	0.871368	1.472550e-66	1.808343e-63
MsaG004967	MsaG013381	0.828723	1.373847e-54	3.833830e-52
MsaG004967	MsaG015407	0.808858	4.293419e-50	7.132981e-48
MsaG004967	MsaG012789	0.801216	1.674343e-48	2.326773e-46
MsaG004967	MsaG014915	0.831686	2.618391e-55	7.955752e-53
MsaG004967	MsaG013966	0.872004	9.083383e-67	1.146371e-63
MsaG004967	MsaG013164	0.852303	9.668648e-61	5.676794e-58
MsaG004967	MsaG012862	0.867334	2.975000e-65	3.088110e-62
MsaG004967	MsaG016450	0.862082	1.289368e-63	1.085535e-60
MsaG004967	MsaG013813	0.884797	3.035263e-71	6.882239e-68
MsaG004967	MsaG013395	0.817041	7.040519e-52	1.433718e-49
MsaG004967	MsaG011693	0.806961	1.082413e-49	1.718322e-47
MsaG004967	MsaG011544	0.852859	6.722528e-61	4.024440e-58
MsaG004967	MsaG012608	0.835004	3.932938e-56	1.317614e-53
MsaG004967	MsaG014424	0.806833	1.151699e-49	1.822783e-47
MsaG004967	MsaG012731	0.931473	9.886546e-94	4.537638e-89
MsaG004967	MsaG015535	0.894170	7.103596e-75	2.615502e-71
MsaG004967	MsaG013208	0.842083	5.966955e-58	2.487888e-55
MsaG004967	MsaG016523	0.838333	5.627785e-57	2.085383e-54
MsaG004967	MsaG013414	0.804850	2.992642e-49	4.521341e-47
MsaG004967	MsaG012243	0.846367	4.273339e-59	2.048788e-56
MsaG004967	MsaG019320	0.822259	4.591954e-53	1.072305e-50
MsaG004967	MsaG019815	0.836522	1.629357e-56	5.712703e-54
MsaG004967	MsaG018510	0.832192	1.965602e-55	6.060614e-53
MsaG004967	MsaG019774	0.814477	2.609086e-51	4.977539e-49
MsaG004967	MsaG020180	0.860808	3.141602e-63	2.519219e-60
MsaG004967	MsaG018733	0.918721	2.788151e-86	4.790250e-82
MsaG004967	MsaG021527	0.825633	7.487776e-54	1.916647e-51
MsaG004967	MsaG018721	0.823315	2.613607e-53	6.279956e-51
MsaG004967	MsaG020996	0.934681	7.815162e-96	4.679636e-91
MsaG004967	MsaG019406	0.911408	1.532346e-82	1.586797e-78
MsaG004967	MsaG018389	0.801118	1.753800e-48	2.431776e-46
MsaG004967	MsaG018137	0.859441	8.094132e-63	6.160866e-60
MsaG004967	MsaG019535	0.834621	4.907467e-56	1.625306e-53
MsaG004967	MsaG023045	0.812771	6.166851e-51	1.127292e-48
MsaG004967	MsaG020541	0.817000	7.191924e-52	1.462980e-49
MsaG004967	MsaG019500	0.839937	2.170223e-57	8.455509e-55
MsaG004967	MsaG026791	0.804342	3.815272e-49	5.696752e-47
MsaG004967	MsaG028128	0.932067	4.104950e-94	1.981892e-89
MsaG004967	MsaG029796	0.893838	9.679297e-75	3.500530e-71
MsaG004967	MsaG028057	0.830916	4.041342e-55	1.200643e-52
MsaG004967	MsaG028008	0.884463	4.033730e-71	8.999810e-68
MsaG004967	MsaG026524	0.921707	6.540226e-88	1.395554e-83
MsaG004967	MsaG028156	0.834943	4.074817e-56	1.362562e-53
MsaG004967	MsaG028378	0.813760	3.749995e-51	7.026719e-49
MsaG004967	MsaG028393	0.879675	2.164893e-69	3.848973e-66
MsaG004967	MsaG026913	0.847319	2.352866e-59	1.164562e-56
MsaG004967	MsaG031529	0.854655	2.055845e-61	1.311926e-58
MsaG004967	MsaG031392	0.826444	4.813031e-54	1.260234e-51
MsaG004967	MsaG032293	0.846093	5.070611e-59	2.408996e-56
MsaG004967	MsaG031608	0.872426	6.584720e-67	8.462080e-64
MsaG004967	MsaG031534	0.841054	1.111200e-57	4.484176e-55
MsaG004967	MsaG031895	0.947790	1.064469e-105	1.994712e-100
MsaG004967	MsaG031458	0.856322	6.751328e-62	4.576665e-59
MsaG004967	MsaG030552	0.927179	4.510523e-91	1.468129e-86
MsaG004967	MsaG032997	0.828275	1.760750e-54	4.852210e-52
MsaG004967	MsaG030622	0.864392	2.506064e-64	2.310824e-61
MsaG004967	MsaG031852	0.828393	1.649926e-54	4.562097e-52
MsaG004967	MsaG033667	0.931408	1.087580e-93	4.963684e-89
MsaG004967	MsaG031942	0.825288	9.028569e-54	2.289159e-51
MsaG004967	MsaG032077	0.863822	3.763617e-64	3.392921e-61
MsaG004967	MsaG030753	0.813877	3.534922e-51	6.643214e-49
MsaG004967	MsaG030906	0.913946	8.418807e-84	1.034595e-79
MsaG004967	MsaG031245	0.802732	8.202730e-49	1.179968e-46
MsaG004967	MsaG032586	0.842765	3.942018e-58	1.680060e-55
MsaG004967	MsaG031035	0.841330	9.409919e-58	3.830362e-55
MsaG004967	MsaG032837	0.856039	8.167514e-62	5.479096e-59
MsaG004967	MsaG030574	0.911068	2.244191e-82	2.274437e-78
MsaG004967	MsaG030876	0.884154	5.240845e-71	1.152113e-67
MsaG004967	MsaG038939	0.855785	9.680242e-62	6.433513e-59
MsaG004967	MsaG036290	0.863860	3.664482e-64	3.308293e-61
MsaG004967	MsaG038165	0.813152	5.093970e-51	9.400598e-49
MsaG004967	MsaG037046	0.842248	5.397487e-58	2.262349e-55
MsaG004967	MsaG038135	0.918410	4.084344e-86	6.858863e-82
MsaG004967	MsaG035353	0.843792	2.104961e-58	9.270906e-56
MsaG004967	MsaG038133	0.842858	3.725198e-58	1.592340e-55
MsaG004967	MsaG038024	0.856058	8.060768e-62	5.411322e-59
MsaG004967	MsaG036611	0.828741	1.360818e-54	3.799341e-52
MsaG004967	MsaG039133	0.818550	3.226214e-52	6.830075e-50
MsaG004967	MsaG036937	0.828207	1.827591e-54	5.027021e-52
MsaG004967	MsaG037651	0.846617	3.655578e-59	1.767167e-56
MsaG004967	MsaG039370	0.837866	7.414158e-57	2.707896e-54
MsaG004967	MsaG036541	0.802967	7.337829e-49	1.061287e-46
MsaG004967	MsaG037437	0.889154	6.838613e-73	1.929004e-69
MsaG004967	MsaG036891	0.903540	7.299594e-79	4.607340e-75
MsaG004967	MsaG036398	0.804398	3.715883e-49	5.555360e-47
MsaG004967	MsaG036208	0.900699	1.301000e-77	6.938178e-74
MsaG004967	MsaG037837	0.913830	9.634205e-84	1.174513e-79
MsaG004967	MsaG036557	0.893219	1.717533e-74	6.005027e-71
MsaG004967	MsaG036763	0.815803	1.328511e-51	2.620897e-49
MsaG004967	MsaG037829	0.898840	8.178578e-77	3.909742e-73
MsaG004967	MsaG036860	0.841625	7.874503e-58	3.235650e-55
MsaG004967	MsaG036052	0.914254	5.883450e-84	7.385790e-80
MsaG004967	MsaG038148	0.804149	4.183512e-49	6.218696e-47
MsaG004967	MsaG036344	0.831224	3.396714e-55	1.018106e-52
MsaG004967	MsaG044593	0.828342	1.696778e-54	4.684969e-52
MsaG004967	MsaG045875	0.831606	2.738831e-55	8.301934e-53
MsaG004967	MsaG043567	0.915756	1.005670e-84	1.396844e-80
MsaG004967	MsaG045902	0.907096	1.744574e-80	1.367707e-76
MsaG004967	MsaG041270	0.811270	1.305488e-50	2.299645e-48
MsaG004967	MsaG044173	0.887702	2.463728e-72	6.454697e-69
MsaG004967	MsaG043110	0.800146	2.761096e-48	3.745467e-46
MsaG004967	MsaG042910	0.828766	1.341455e-54	3.747986e-52
MsaG004967	MsaG041725	0.889182	6.673698e-73	1.884921e-69
MsaG004967	MsaG041132	0.920988	1.636602e-87	3.314102e-83
MsaG004967	MsaG046904	0.892096	4.825990e-74	1.588259e-70
MsaG004967	MsaG046971	0.816078	1.154313e-51	2.293181e-49
MsaG004967	MsaG047198	0.870033	4.026105e-66	4.672427e-63

PPI

Gene1	Gene2	Type

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG004967	MtrunA17_Chr1g0202711	80.615	748	42	4	1	645	65	812	0.0	1191
MsaG004967	MtrunA17_Chr6g0468691	62.003	729	160	10	3	616	50	776	0.0	867
MsaG004967	MtrunA17_Chr4g0030441	39.506	729	310	15	10	616	60	779	3.48e-155	475
MsaG004967	MtrunA17_Chr1g0202701	93.607	219	14	0	624	842	10	228	1.63e-148	436
MsaG004967	MtrunA17_Chr2g0327671	38.265	703	311	11	32	616	85	782	1.04e-141	440
MsaG004967	MtrunA17_Chr8g0352381	38.327	741	312	21	5	616	85	809	1.19e-139	436
MsaG004967	MtrunA17_Chr2g0318301	37.364	736	319	16	32	642	81	799	6.37e-139	432
MsaG004967	MtrunA17_Chr4g0061081	35.241	769	337	20	33	652	95	851	5.21e-121	386
MsaG004967	MtrunA17_Chr4g0053521	37.603	726	298	22	26	614	630	1337	6.14e-113	375
MsaG004967	MtrunA17_Chr4g0053521	32.088	455	248	16	25	444	77	505	7.13e-46	178
MsaG004967	MtrunA17_Chr4g0053571	36.242	745	306	23	24	625	72	790	6.84e-106	345
MsaG004967	MtrunA17_Chr2g0292501	31.874	731	345	17	30	616	79	800	2.47e-102	337
MsaG004967	MtrunA17_Chr7g0245131	32.908	784	362	24	3	630	54	829	1.23e-100	333
MsaG004967	MtrunA17_Chr6g0468771	69.683	221	54	4	624	831	10	230	1.33e-95	299
MsaG004967	MtrunA17_Chr1g0190581	31.465	785	360	26	7	630	50	817	1.70e-92	310
MsaG004967	MtrunA17_Chr4g0053561	32.838	740	313	18	2	620	53	729	4.81e-90	301
MsaG004967	MtrunA17_Chr8g0361611	31.215	724	334	19	3	614	55	726	2.70e-89	299
MsaG004967	MtrunA17_Chr7g0274261	30.000	790	361	23	7	630	60	823	2.32e-86	293
MsaG004967	MtrunA17_Chr7g0248161	42.000	350	186	8	5	344	49	391	3.83e-84	276
MsaG004967	MtrunA17_Chr1g0165521	29.206	743	334	18	14	624	67	749	5.16e-81	277
MsaG004967	MtrunA17_Chr5g0420151	29.359	780	353	25	19	632	72	819	4.09e-74	259
MsaG004967	MtrunA17_Chr5g0420171	29.275	772	342	26	19	632	72	797	3.82e-70	247
MsaG004967	MtrunA17_Chr6g0455321	28.778	761	367	24	17	616	70	816	6.22e-70	248
MsaG004967	MtrunA17_Chr4g0053591	37.556	450	147	10	300	625	2	441	2.57e-69	238
MsaG004967	MtrunA17_Chr5g0420181	29.133	738	337	27	33	616	77	782	7.24e-66	235
MsaG004967	MtrunA17_Chr7g0219601	28.886	772	366	28	21	637	73	816	9.74e-66	236
MsaG004967	MtrunA17_Chr7g0219721	28.968	756	355	27	21	616	81	814	1.17e-65	236
MsaG004967	MtrunA17_Chr7g0219691	29.365	756	352	27	21	616	81	814	1.61e-65	235
MsaG004967	MtrunA17_Chr7g0219671	28.609	755	356	28	24	616	81	814	1.17e-61	224
MsaG004967	MtrunA17_Chr7g0219781	27.800	759	364	26	21	616	80	817	8.17e-61	222
MsaG004967	MtrunA17_Chr7g0219611	28.054	745	358	28	28	622	86	802	4.01e-60	219
MsaG004967	MtrunA17_Chr7g0219681	28.591	745	353	26	24	613	82	802	1.73e-59	217
MsaG004967	MtrunA17_Chr5g0420161	31.023	577	232	21	177	616	11	558	4.15e-58	208
MsaG004967	MtrunA17_Chr4g0025961	28.402	757	359	29	25	620	79	813	1.30e-57	213
MsaG004967	MtrunA17_Chr7g0219651	28.284	746	359	29	21	613	80	802	2.15e-55	208
MsaG004967	MtrunA17_Chr7g0219651	27.358	742	348	28	53	631	1107	1820	3.24e-54	204
MsaG004967	MtrunA17_Chr7g0219571	27.092	753	346	30	52	631	113	835	2.21e-51	194
MsaG004967	MtrunA17_Chr7g0219591	28.778	483	269	19	28	460	86	543	1.60e-37	148
MsaG004967	MtrunA17_Chr7g0219741	28.625	531	285	23	4	474	72	568	2.27e-36	145
MsaG004967	MtrunA17_Chr2g0314201	33.878	245	80	2	432	594	1	245	1.49e-33	129
MsaG004967	MtrunA17_Chr7g0270121	28.278	389	162	7	354	633	303	683	1.90e-28	122
MsaG004967	MtrunA17_Chr3g0123141	26.796	362	169	10	347	620	514	867	1.84e-24	110
MsaG004967	MtrunA17_Chr2g0314821	27.191	445	221	18	165	545	404	809	2.41e-23	106
MsaG004967	MtrunA17_Chr3g0108361	32.143	224	95	4	361	544	558	764	4.04e-23	105
MsaG004967	MtrunA17_Chr3g0108351	40.260	154	55	1	429	545	610	763	4.96e-23	105
MsaG004967	MtrunA17_Chr5g0432871	33.036	224	91	3	358	544	557	758	6.00e-23	105
MsaG004967	MtrunA17_Chr2g0314841	27.602	442	220	18	165	545	404	806	1.05e-22	104
MsaG004967	MtrunA17_Chr5g0427001	33.702	181	78	2	425	563	55	235	1.14e-22	98.6
MsaG004967	MtrunA17_Chr8g0340891	29.658	263	102	5	412	593	540	800	1.38e-22	103
MsaG004967	MtrunA17_Chr8g0392271	32.500	240	104	6	362	545	488	725	1.46e-22	103
MsaG004967	MtrunA17_Chr8g0358821	27.801	241	94	3	429	589	680	920	2.48e-22	103
MsaG004967	MtrunA17_Chr8g0369211	33.484	221	106	4	363	545	555	772	3.94e-22	102
MsaG004967	MtrunA17_Chr8g0341151	26.837	313	125	7	403	613	525	835	4.28e-22	102
MsaG004967	MtrunA17_Chr3g0084441	30.631	222	103	4	362	545	443	651	5.79e-22	102
MsaG004967	MtrunA17_Chr4g0002531	41.509	106	60	2	651	755	49	153	7.93e-22	95.5
MsaG004967	MtrunA17_Chr8g0340971	34.066	182	82	2	400	545	53	232	7.95e-22	96.3
MsaG004967	MtrunA17_Chr8g0340911	28.846	260	103	5	414	593	544	801	8.09e-22	101
MsaG004967	MtrunA17_Chr5g0434141	37.423	163	60	2	425	545	578	740	1.03e-21	101
MsaG004967	MtrunA17_Chr8g0341111	28.938	273	104	6	402	593	452	715	1.14e-21	100
MsaG004967	MtrunA17_Chr1g0181731	38.462	156	55	2	429	545	590	743	1.15e-21	101
MsaG004967	MtrunA17_Chr1g0194541	26.344	372	156	9	357	620	218	579	1.17e-21	100
MsaG004967	MtrunA17_Chr8g0373501	39.610	154	56	1	429	545	327	480	1.28e-21	100
MsaG004967	MtrunA17_Chr3g0084451	31.140	228	111	3	356	545	432	651	1.36e-21	100
MsaG004967	MtrunA17_Chr4g0071221	29.588	267	100	5	410	588	508	774	1.72e-21	100
MsaG004967	MtrunA17_Chr7g0263591	30.870	230	110	3	355	545	530	749	1.78e-21	100
MsaG004967	MtrunA17_Chr3g0112111	27.397	292	110	5	426	615	336	627	1.89e-21	99.8
MsaG004967	MtrunA17_Chr6g0455311	27.901	362	213	16	17	342	70	419	2.92e-21	98.2
MsaG004967	MtrunA17_Chr3g0121971	32.381	210	97	3	425	592	571	777	3.07e-21	99.8
MsaG004967	MtrunA17_Chr8g0340881	28.517	263	105	5	412	593	546	806	4.59e-21	99.0
MsaG004967	MtrunA17_Chr8g0369231	31.390	223	108	3	361	545	204	419	4.85e-21	98.2
MsaG004967	MtrunA17_Chr7g0245221	28.116	345	148	9	273	544	449	766	5.31e-21	99.0
MsaG004967	MtrunA17_Chr3g0129391	30.970	268	128	7	331	544	755	1019	5.39e-21	99.4
MsaG004967	MtrunA17_Chr7g0239381	26.378	254	105	4	429	600	333	586	5.46e-21	98.6
MsaG004967	MtrunA17_Chr8g0340931	33.516	182	83	2	400	545	530	709	5.61e-21	99.0
MsaG004967	MtrunA17_Chr5g0403891	38.272	162	63	1	421	545	238	399	6.34e-21	97.8
MsaG004967	MtrunA17_Chr8g0365691	39.474	152	54	1	432	545	304	455	6.70e-21	97.1
MsaG004967	MtrunA17_Chr7g0259211	36.196	163	62	1	425	545	271	433	6.79e-21	98.2
MsaG004967	MtrunA17_Chr7g0239371	26.721	247	99	4	429	593	329	575	7.07e-21	98.2
MsaG004967	MtrunA17_Chr7g0236881	32.083	240	100	6	353	551	549	766	7.22e-21	98.6
MsaG004967	MtrunA17_Chr7g0221191	28.400	250	105	4	363	545	296	538	9.22e-21	97.8
MsaG004967	MtrunA17_Chr8g0341221	35.948	153	60	2	429	545	30	180	9.45e-21	91.7
MsaG004967	MtrunA17_Chr8g0340091	29.741	232	106	5	353	545	463	676	1.05e-20	97.8
MsaG004967	MtrunA17_Chr8g0340871	28.146	302	112	8	426	624	565	864	1.09e-20	97.8
MsaG004967	MtrunA17_Chr8g0340951	34.706	170	73	2	412	545	18	185	1.20e-20	91.3
MsaG004967	MtrunA17_Chr2g0281971	36.364	154	59	1	431	545	41	194	1.26e-20	94.7
MsaG004967	MtrunA17_Chr2g0283111	38.312	154	58	1	429	545	601	754	1.71e-20	97.4
MsaG004967	MtrunA17_Chr5g0414561	27.459	244	95	4	426	587	333	576	1.76e-20	97.1
MsaG004967	MtrunA17_Chr6g0485761	25.197	381	172	7	429	702	285	659	1.76e-20	96.7
MsaG004967	MtrunA17_Chr8g0340051	34.194	155	64	1	429	545	19	173	2.15e-20	93.6
MsaG004967	MtrunA17_Chr8g0342071	36.000	175	71	2	412	545	421	595	2.91e-20	96.7
MsaG004967	MtrunA17_Chr3g0084691	31.019	216	103	3	363	545	465	667	3.24e-20	96.3
MsaG004967	MtrunA17_Chr8g0358781	26.556	241	97	3	429	589	335	575	3.47e-20	95.9
MsaG004967	MtrunA17_Chr2g0291501	36.943	157	62	1	426	545	626	782	5.31e-20	95.9
MsaG004967	MtrunA17_Chr8g0340081	34.839	155	63	1	429	545	497	651	5.85e-20	95.5
MsaG004967	MtrunA17_Chr1g0206211	34.591	159	66	1	425	545	14	172	6.36e-20	89.0
MsaG004967	MtrunA17_Chr1g0209361	28.175	252	93	4	422	588	325	573	6.77e-20	95.1
MsaG004967	MtrunA17_Chr8g0377951	34.682	173	71	2	432	562	562	734	7.26e-20	95.5
MsaG004967	MtrunA17_Chr4g0042361	36.420	162	62	2	425	545	523	684	1.05e-19	94.7
MsaG004967	MtrunA17_Chr2g0315151	23.934	422	220	12	257	615	505	888	1.08e-19	94.7
MsaG004967	MtrunA17_Chr5g0413511	35.751	193	82	3	395	545	10	202	1.12e-19	92.4
MsaG004967	MtrunA17_Chr8g0341101	25.706	354	137	9	361	613	564	892	1.15e-19	94.7
MsaG004967	MtrunA17_Chr8g0340111	30.045	223	104	4	361	545	441	649	1.17e-19	94.4
MsaG004967	MtrunA17_Chr7g0267441	37.419	155	55	2	432	544	589	743	1.25e-19	94.7
MsaG004967	MtrunA17_Chr7g0221711	36.943	157	59	1	429	545	612	768	1.46e-19	94.4
MsaG004967	MtrunA17_Chr4g0049561	27.190	331	141	10	351	595	271	587	1.85e-19	93.6
MsaG004967	MtrunA17_Chr7g0236231	28.879	232	106	3	362	545	443	663	1.97e-19	94.0
MsaG004967	MtrunA17_Chr4g0042341	36.420	162	62	2	425	545	507	668	2.11e-19	93.6
MsaG004967	MtrunA17_Chr2g0329401	25.205	365	154	11	365	613	440	801	2.28e-19	93.6
MsaG004967	MtrunA17_Chr1g0149791	39.623	106	62	2	651	755	39	143	2.47e-19	87.8
MsaG004967	MtrunA17_Chr7g0236531	35.220	159	65	1	425	545	25	183	2.53e-19	90.5
MsaG004967	MtrunA17_Chr3g0084661	35.897	156	61	1	429	545	23	178	2.59e-19	90.5
MsaG004967	MtrunA17_Chr5g0393981	29.864	221	105	3	363	545	333	541	2.68e-19	93.2
MsaG004967	MtrunA17_Chr1g0158231	29.148	223	112	2	362	545	57	272	3.03e-19	91.7
MsaG004967	MtrunA17_Chr1g0158201	27.491	291	161	4	352	602	330	610	3.19e-19	92.8
MsaG004967	MtrunA17_Chr3g0084411	29.730	222	105	3	362	545	436	644	3.42e-19	93.2
MsaG004967	MtrunA17_Chr8g0341011	31.604	212	90	5	402	564	539	744	3.97e-19	92.8
MsaG004967	MtrunA17_Chr6g0474871	32.075	159	70	1	425	545	552	710	4.00e-19	92.8
MsaG004967	MtrunA17_Chr8g0341081	27.740	292	122	9	412	623	30	312	4.07e-19	89.7
MsaG004967	MtrunA17_Chr2g0299301	28.800	250	122	3	352	545	956	1205	4.26e-19	93.2
MsaG004967	MtrunA17_Chr2g0321921	38.217	157	53	3	432	545	598	753	4.27e-19	92.8
MsaG004967	MtrunA17_Chr3g0109461	28.000	225	104	4	359	545	280	484	4.38e-19	92.4
MsaG004967	MtrunA17_Chr3g0084431	34.839	155	63	1	429	545	485	639	4.42e-19	92.8
MsaG004967	MtrunA17_Chr1g0158261	30.045	223	110	2	362	545	337	552	4.84e-19	92.4
MsaG004967	MtrunA17_Chr7g0236551	35.849	159	64	1	425	545	475	633	4.84e-19	92.4
MsaG004967	MtrunA17_Chr4g0055821	36.496	137	73	4	629	755	16	148	4.84e-19	86.7
MsaG004967	MtrunA17_Chr3g0137121	40.909	110	62	3	647	755	36	143	4.91e-19	86.7
MsaG004967	MtrunA17_Chr1g0161711	36.957	184	65	6	406	545	545	721	5.28e-19	92.4
MsaG004967	MtrunA17_Chr3g0125631	29.694	229	119	3	426	616	60	284	6.24e-19	89.7
MsaG004967	MtrunA17_Chr2g0314881	37.662	154	57	1	431	545	221	374	6.58e-19	91.3
MsaG004967	MtrunA17_Chr8g0340071	30.045	223	104	4	361	545	439	647	7.00e-19	92.0
MsaG004967	MtrunA17_Chr1g0203631	31.140	228	108	3	366	544	910	1137	7.60e-19	92.4
MsaG004967	MtrunA17_Chr1g0161701	38.182	165	56	5	425	545	564	726	8.00e-19	92.0
MsaG004967	MtrunA17_Chr1g0209431	25.073	343	143	7	374	608	275	611	8.36e-19	91.7
MsaG004967	MtrunA17_Chr2g0333181	31.527	203	97	2	429	592	30	229	8.37e-19	89.4
MsaG004967	MtrunA17_Chr3g0084491	34.839	155	63	1	429	545	497	651	8.76e-19	91.7
MsaG004967	MtrunA17_Chr7g0236561	36.129	155	61	1	429	545	496	650	9.47e-19	91.7
MsaG004967	MtrunA17_Chr6g0474901	32.075	159	70	1	425	545	553	711	9.53e-19	91.7
MsaG004967	MtrunA17_Chr1g0158171	26.855	283	154	4	361	602	67	337	1.08e-18	90.1
MsaG004967	MtrunA17_Chr5g0438071	36.364	154	59	1	431	545	652	805	1.14e-18	91.7
MsaG004967	MtrunA17_Chr6g0475201	32.895	152	64	1	432	545	568	719	1.36e-18	91.3
MsaG004967	MtrunA17_Chr8g0354441	33.758	157	66	1	427	545	339	495	1.41e-18	90.9
MsaG004967	MtrunA17_Chr8g0341251	27.451	306	139	9	412	636	24	327	1.48e-18	87.8
MsaG004967	MtrunA17_Chr5g0423061	26.235	324	141	9	352	588	231	543	1.61e-18	90.5
MsaG004967	MtrunA17_Chr3g0081031	33.758	157	66	1	427	545	341	497	1.87e-18	90.5
MsaG004967	MtrunA17_Chr6g0475111	32.704	159	69	1	425	545	574	732	1.91e-18	90.9
MsaG004967	MtrunA17_Chr1g0206291	34.591	159	67	1	424	545	339	497	2.03e-18	89.7
MsaG004967	MtrunA17_Chr1g0206231	35.220	159	65	1	425	545	333	491	2.08e-18	90.1
MsaG004967	MtrunA17_Chr7g0236571	35.484	155	62	1	429	545	330	484	2.21e-18	90.1
MsaG004967	MtrunA17_Chr3g0084681	33.742	163	70	1	421	545	447	609	2.24e-18	90.5
MsaG004967	MtrunA17_Chr3g0144481	35.065	154	63	1	429	545	79	232	2.42e-18	89.0
MsaG004967	MtrunA17_Chr4g0048631	30.120	249	124	6	345	545	431	677	2.44e-18	90.5
MsaG004967	MtrunA17_Chr5g0394011	29.915	234	118	5	354	545	267	496	2.57e-18	89.7
MsaG004967	MtrunA17_Chr7g0236341	34.637	179	72	2	405	545	492	663	2.70e-18	90.1
MsaG004967	MtrunA17_Chr2g0280771	37.419	155	59	1	429	545	473	627	2.83e-18	89.7
MsaG004967	MtrunA17_Chr7g0274651	29.362	235	108	6	351	545	297	513	3.09e-18	89.7
MsaG004967	MtrunA17_Chr3g0144551	28.571	203	103	2	429	592	124	323	3.37e-18	88.6
MsaG004967	MtrunA17_Chr4g0049581	26.190	252	104	4	426	595	338	589	3.40e-18	89.7
MsaG004967	MtrunA17_Chr1g0158211	27.719	285	147	4	362	602	79	348	3.40e-18	88.6
MsaG004967	MtrunA17_Chr4g0058561	28.378	222	102	2	361	545	298	499	3.60e-18	89.4
MsaG004967	MtrunA17_Chr7g0236651	35.220	159	65	1	425	545	472	630	4.18e-18	89.4
MsaG004967	MtrunA17_Chr1g0148501	31.364	220	103	4	366	545	363	574	4.19e-18	89.4
MsaG004967	MtrunA17_Chr7g0219631	56.338	71	31	0	429	499	52	122	4.46e-18	81.3
MsaG004967	MtrunA17_Chr7g0262521	26.948	308	114	8	429	631	336	637	4.51e-18	89.4
MsaG004967	MtrunA17_Chr6g0475091	28.241	216	97	4	369	545	530	726	4.52e-18	89.4
MsaG004967	MtrunA17_Chr1g0158251	26.786	280	156	3	362	602	346	615	4.57e-18	89.4
MsaG004967	MtrunA17_Chr3g0125451	26.733	303	115	7	417	615	399	698	4.70e-18	89.4
MsaG004967	MtrunA17_Chr7g0265391	27.755	245	107	5	349	545	267	489	4.88e-18	89.0
MsaG004967	MtrunA17_Chr7g0236161	34.194	155	64	1	429	545	461	615	4.98e-18	89.4
MsaG004967	MtrunA17_Chr3g0125491	30.357	224	103	4	413	592	31	245	5.12e-18	86.7
MsaG004967	MtrunA17_Chr8g0359691	27.437	277	140	4	355	592	599	853	5.16e-18	89.4
MsaG004967	MtrunA17_Chr7g0236691	35.484	155	62	1	429	545	491	645	5.22e-18	89.4
MsaG004967	MtrunA17_Chr8g0380681	31.197	234	103	4	361	545	241	465	5.23e-18	89.7
MsaG004967	MtrunA17_Chr8g0380681	31.928	166	64	1	429	545	969	1134	1.88e-13	74.7
MsaG004967	MtrunA17_Chr2g0323231	32.258	155	67	1	429	545	169	323	5.31e-18	88.2
MsaG004967	MtrunA17_Chr2g0277731	29.565	230	105	3	368	545	237	461	5.44e-18	89.0
MsaG004967	MtrunA17_Chr4g0055011	35.484	155	62	1	429	545	62	216	5.51e-18	87.0
MsaG004967	MtrunA17_Chr7g0236121	34.194	155	64	1	429	545	495	649	5.53e-18	89.0
MsaG004967	MtrunA17_Chr4g0034931	32.692	156	66	1	429	545	130	285	5.66e-18	87.8
MsaG004967	MtrunA17_Chr7g0236201	34.194	155	64	1	429	545	461	615	5.75e-18	89.0
MsaG004967	MtrunA17_Chr4g0025601	35.000	240	83	7	378	545	541	779	5.77e-18	89.4
MsaG004967	MtrunA17_Chr8g0359651	36.076	158	58	1	431	545	655	812	5.77e-18	89.4
MsaG004967	MtrunA17_Chr8g0359641	36.076	158	58	1	431	545	655	812	5.81e-18	89.4
MsaG004967	MtrunA17_Chr4g0049601	25.161	310	129	9	367	593	304	593	5.91e-18	89.0
MsaG004967	MtrunA17_Chr8g0347571	26.667	255	119	5	338	545	482	715	5.99e-18	89.0
MsaG004967	MtrunA17_Chr3g0109411	34.194	155	64	2	429	545	315	469	6.29e-18	88.6
MsaG004967	MtrunA17_Chr2g0280781	37.419	155	59	1	429	545	501	655	6.71e-18	89.0
MsaG004967	MtrunA17_Chr8g0348451	25.581	301	131	6	407	618	106	402	6.79e-18	87.8
MsaG004967	MtrunA17_Chr5g0428581	32.704	159	69	1	425	545	31	189	7.16e-18	86.7
MsaG004967	MtrunA17_Chr2g0312561	32.768	177	79	2	409	545	12	188	7.19e-18	86.7
MsaG004967	MtrunA17_Chr3g0114851	26.230	305	177	5	329	592	411	708	7.44e-18	89.0
MsaG004967	MtrunA17_Chr5g0433941	28.395	243	124	4	385	580	305	544	7.46e-18	88.6
MsaG004967	MtrunA17_Chr8g0360591	35.897	156	61	1	429	545	34	189	7.50e-18	86.7
MsaG004967	MtrunA17_Chr1g0205771	31.111	225	95	5	361	545	284	488	7.77e-18	88.2
MsaG004967	MtrunA17_Chr8g0366931	31.847	157	70	2	426	545	13	169	8.20e-18	85.9
MsaG004967	MtrunA17_Chr1g0162711	38.532	109	65	2	651	758	63	170	8.33e-18	84.0
MsaG004967	MtrunA17_Chr7g0236511	33.962	159	67	1	425	545	488	646	8.63e-18	88.6
MsaG004967	MtrunA17_Chr8g0361431	30.939	181	82	3	425	564	468	646	9.21e-18	88.6
MsaG004967	MtrunA17_Chr1g0148461	34.641	153	62	1	431	545	429	581	9.31e-18	88.2
MsaG004967	MtrunA17_Chr6g0474811	32.237	152	65	1	432	545	567	718	9.31e-18	88.6
MsaG004967	MtrunA17_Chr4g0049611	25.000	256	111	3	423	597	327	582	9.32e-18	88.2
MsaG004967	MtrunA17_Chr8g0354281	34.395	157	65	1	427	545	324	480	9.62e-18	88.2
MsaG004967	MtrunA17_Chr3g0079661	35.032	157	64	1	426	544	903	1059	1.02e-17	88.6
MsaG004967	MtrunA17_Chr4g0033571	25.418	299	112	6	426	613	500	798	1.03e-17	88.2
MsaG004967	MtrunA17_Chr6g0474861	30.818	159	72	1	425	545	273	431	1.03e-17	87.8
MsaG004967	MtrunA17_Chr2g0315081	26.331	338	175	7	255	545	489	799	1.05e-17	88.6
MsaG004967	MtrunA17_Chr2g0284101	29.218	243	114	6	341	544	220	443	1.05e-17	87.8
MsaG004967	MtrunA17_Chr1g0206361	32.704	159	69	1	425	545	330	488	1.07e-17	87.8
MsaG004967	MtrunA17_Chr1g0158291	33.987	153	62	1	431	544	45	197	1.08e-17	86.3
MsaG004967	MtrunA17_Chr5g0399541	35.616	146	85	5	618	756	7	150	1.09e-17	83.2
MsaG004967	MtrunA17_Chr3g0078551	23.679	473	269	16	151	564	247	686	1.12e-17	88.2
MsaG004967	MtrunA17_Chr6g0467601	26.667	315	136	6	360	588	79	384	1.17e-17	87.0
MsaG004967	MtrunA17_Chr2g0306871	37.963	108	65	2	651	757	48	154	1.19e-17	82.8
MsaG004967	MtrunA17_Chr1g0206261	32.530	166	75	1	417	545	68	233	1.20e-17	86.3
MsaG004967	MtrunA17_Chr1g0149381	25.101	247	100	5	423	587	488	731	1.31e-17	87.8
MsaG004967	MtrunA17_Chr8g0354351	32.335	167	75	1	427	555	322	488	1.32e-17	87.4
MsaG004967	MtrunA17_Chr1g0161721	37.576	165	57	5	425	545	566	728	1.37e-17	87.8
MsaG004967	MtrunA17_Chr2g0280831	36.129	155	61	1	429	545	86	240	1.40e-17	86.3
MsaG004967	MtrunA17_Chr2g0280751	30.833	240	99	6	361	545	444	671	1.48e-17	87.8
MsaG004967	MtrunA17_Chr2g0318191	32.370	173	70	4	425	553	3	172	1.51e-17	82.0
MsaG004967	MtrunA17_Chr2g0314611	26.452	310	119	8	424	627	470	776	1.55e-17	87.8
MsaG004967	MtrunA17_Chr2g0280801	35.484	155	62	1	429	545	518	672	1.62e-17	87.8
MsaG004967	MtrunA17_Chr3g0084421	34.356	163	69	1	421	545	445	607	1.63e-17	87.4
MsaG004967	MtrunA17_Chr6g0485721	34.416	154	64	1	429	545	88	241	1.65e-17	85.9
MsaG004967	MtrunA17_Chr5g0402071	30.128	156	70	1	429	545	157	312	1.66e-17	86.7
MsaG004967	MtrunA17_Chr8g0358911	33.133	166	69	2	421	544	25	190	1.76e-17	85.5
MsaG004967	MtrunA17_Chr2g0280701	33.553	152	63	1	432	545	494	645	1.78e-17	87.4
MsaG004967	MtrunA17_Chr7g0236641	34.839	155	63	1	429	545	516	670	1.79e-17	87.4
MsaG004967	MtrunA17_Chr2g0318831	29.075	227	108	4	360	545	433	647	1.91e-17	87.4
MsaG004967	MtrunA17_Chr5g0394001	28.829	222	109	3	362	545	264	474	2.04e-17	87.0
MsaG004967	MtrunA17_Chr5g0407721	27.313	227	106	4	364	545	298	510	2.04e-17	87.0
MsaG004967	MtrunA17_Chr4g0042401	35.099	151	61	1	432	545	498	648	2.05e-17	87.4
MsaG004967	MtrunA17_Chr7g0236471	33.962	159	67	1	425	545	327	485	2.07e-17	87.0
MsaG004967	MtrunA17_Chr1g0148511	34.416	154	62	1	431	545	415	568	2.12e-17	87.0
MsaG004967	MtrunA17_Chr2g0318171	25.559	313	124	8	424	630	466	775	2.25e-17	87.0
MsaG004967	MtrunA17_Chr5g0413071	27.333	300	149	11	306	545	161	451	2.66e-17	86.7
MsaG004967	MtrunA17_Chr8g0341131	39.259	135	60	4	429	545	10	140	2.96e-17	80.1
MsaG004967	MtrunA17_Chr3g0109431	31.579	190	83	4	398	545	288	472	3.11e-17	86.3
MsaG004967	MtrunA17_Chr7g0251121	32.000	175	75	3	412	545	339	510	3.29e-17	86.3
MsaG004967	MtrunA17_Chr3g0081011	33.758	157	66	1	427	545	328	484	3.59e-17	86.3
MsaG004967	MtrunA17_Chr1g0209391	25.163	306	123	7	368	588	246	530	3.63e-17	86.3
MsaG004967	MtrunA17_Chr1g0209381	26.073	303	136	7	371	589	261	559	3.97e-17	86.3
MsaG004967	MtrunA17_Chr2g0299041	27.119	236	126	4	356	545	23	258	4.06e-17	84.7
MsaG004967	MtrunA17_Chr4g0044691	28.794	257	113	7	354	556	243	483	4.50e-17	85.9
MsaG004967	MtrunA17_Chr3g0136421	25.773	291	104	6	429	608	72	361	4.60e-17	84.3
MsaG004967	MtrunA17_Chr4g0020081	32.599	227	100	6	364	545	438	656	4.79e-17	86.3
MsaG004967	MtrunA17_Chr3g0082941	33.758	157	66	1	427	545	162	318	5.33e-17	85.1
MsaG004967	MtrunA17_Chr1g0154311	32.075	159	70	1	425	545	338	496	5.36e-17	85.5
MsaG004967	MtrunA17_Chr2g0280681	30.417	240	104	6	348	545	428	646	5.37e-17	85.9
MsaG004967	MtrunA17_Chr3g0137191	31.410	156	69	1	427	544	54	209	5.58e-17	83.6
MsaG004967	MtrunA17_Chr7g0274661	33.121	157	68	2	426	545	360	516	5.64e-17	85.5
MsaG004967	MtrunA17_Chr1g0149711	32.051	156	68	1	427	544	77	232	5.72e-17	84.0
MsaG004967	MtrunA17_Chr5g0413171	29.126	206	105	2	425	592	74	276	6.88e-17	84.0
MsaG004967	MtrunA17_Chr8g0354331	32.484	157	68	1	427	545	89	245	6.98e-17	84.0
MsaG004967	MtrunA17_Chr6g0456231	35.404	161	66	3	422	544	285	445	7.15e-17	85.1
MsaG004967	MtrunA17_Chr8g0376061	28.136	295	119	7	379	588	280	566	8.00e-17	85.1
MsaG004967	MtrunA17_Chr3g0093161	26.437	261	132	4	345	564	418	659	8.55e-17	85.1
MsaG004967	MtrunA17_Chr5g0394021	32.948	173	76	3	412	545	295	466	9.28e-17	84.7
MsaG004967	MtrunA17_Chr4g0048581	35.484	155	62	1	429	545	522	676	9.49e-17	85.1
MsaG004967	MtrunA17_Chr7g0239261	33.544	158	67	2	426	545	326	483	9.94e-17	84.7
MsaG004967	MtrunA17_Chr8g0354421	30.412	194	87	2	400	545	315	508	1.01e-16	84.7
MsaG004967	MtrunA17_Chr2g0320111	31.138	167	70	2	424	545	76	242	1.16e-16	83.2
MsaG004967	MtrunA17_Chr4g0048801	28.947	228	109	6	361	545	446	663	1.26e-16	84.7
MsaG004967	MtrunA17_Chr8g0354431	33.121	157	67	1	427	545	331	487	1.28e-16	84.3
MsaG004967	MtrunA17_Chr8g0375511	26.908	249	134	3	344	544	738	986	1.33e-16	85.1
MsaG004967	MtrunA17_Chr2g0319101	31.977	172	77	3	425	558	100	269	1.39e-16	83.2
MsaG004967	MtrunA17_Chr5g0428111	29.557	203	100	3	421	582	483	683	1.54e-16	84.3
MsaG004967	MtrunA17_Chr1g0160921	34.194	155	64	1	429	545	42	196	1.61e-16	82.8
MsaG004967	MtrunA17_Chr4g0048731	34.839	155	63	1	429	545	37	191	1.64e-16	82.0
MsaG004967	MtrunA17_Chr1g0148491	34.416	154	62	1	431	545	329	482	1.65e-16	84.0
MsaG004967	MtrunA17_Chr6g0483931	24.675	385	173	9	362	637	292	668	1.83e-16	84.0
MsaG004967	MtrunA17_Chr8g0354271	33.121	157	67	1	427	545	324	480	1.90e-16	84.0
MsaG004967	MtrunA17_Chr8g0389251	27.007	274	105	4	410	588	362	635	2.15e-16	84.0
MsaG004967	MtrunA17_Chr1g0159611	29.057	265	127	6	326	545	139	387	2.34e-16	83.2
MsaG004967	MtrunA17_Chr4g0048791	34.194	155	64	1	429	545	523	677	2.42e-16	84.0
MsaG004967	MtrunA17_Chr8g0366971	32.484	157	69	2	426	545	63	219	2.57e-16	82.0
MsaG004967	MtrunA17_Chr5g0443121	28.358	201	102	2	431	592	175	372	2.58e-16	82.8
MsaG004967	MtrunA17_Chr1g0206551	32.258	155	67	1	429	545	26	180	2.93e-16	81.6
MsaG004967	MtrunA17_Chr3g0125441	26.183	317	122	8	417	624	434	747	2.94e-16	83.6
MsaG004967	MtrunA17_Chr2g0279661	26.733	303	110	7	431	624	423	722	3.06e-16	83.6
MsaG004967	MtrunA17_Chr3g0078521	30.808	198	93	4	409	564	486	681	3.21e-16	83.6
MsaG004967	MtrunA17_Chr1g0206391	32.075	159	70	1	425	545	27	185	3.23e-16	81.6
MsaG004967	MtrunA17_Chr1g0154351	31.875	160	71	1	424	545	344	503	3.80e-16	82.8
MsaG004967	MtrunA17_Chr7g0248904	28.390	236	124	6	350	545	276	506	3.83e-16	82.8
MsaG004967	MtrunA17_Chr3g0081001	33.121	157	67	1	427	545	332	488	4.21e-16	82.8
MsaG004967	MtrunA17_Chr8g0366981	28.638	213	112	3	426	601	289	498	4.45e-16	82.4
MsaG004967	MtrunA17_Chr4g0063261	38.679	106	63	2	651	755	51	155	4.47e-16	78.6
MsaG004967	MtrunA17_Chr1g0206331	32.704	159	69	1	425	545	322	480	4.56e-16	82.8
MsaG004967	MtrunA17_Chr8g0367071	27.869	244	94	3	426	587	342	585	4.57e-16	82.8
MsaG004967	MtrunA17_Chr4g0048661	33.548	155	65	1	429	545	28	182	5.30e-16	80.5
MsaG004967	MtrunA17_Chr7g0248881	29.091	220	109	5	368	545	285	499	5.32e-16	82.4
MsaG004967	MtrunA17_Chr8g0361251	33.333	162	67	2	425	545	490	651	5.43e-16	82.8
MsaG004967	MtrunA17_Chr8g0354311	49.367	79	38	1	427	505	27	103	5.59e-16	75.1
MsaG004967	MtrunA17_Chr6g0475131	32.237	152	65	1	432	545	3	154	5.94e-16	80.1
MsaG004967	MtrunA17_Chr2g0280711	29.958	237	119	5	353	545	442	675	6.19e-16	82.4
MsaG004967	MtrunA17_Chr7g0239311	30.198	202	100	3	426	589	328	526	6.29e-16	82.0
MsaG004967	MtrunA17_Chr7g0239221	32.911	158	68	2	426	545	332	489	7.26e-16	82.0
MsaG004967	MtrunA17_Chr8g0361281	33.548	155	65	1	429	545	504	658	8.92e-16	82.0
MsaG004967	MtrunA17_Chr7g0220741	34.940	166	70	3	417	544	282	447	9.15e-16	81.6
MsaG004967	MtrunA17_Chr7g0239211	32.911	158	68	2	426	545	330	487	9.88e-16	81.6
MsaG004967	MtrunA17_Chr4g0048741	30.045	223	104	4	361	545	469	677	1.03e-15	81.6
MsaG004967	MtrunA17_Chr1g0175451	32.317	164	67	3	426	545	315	478	1.08e-15	81.6
MsaG004967	MtrunA17_Chr8g0358031	28.112	249	127	5	342	545	383	624	1.21e-15	81.6
MsaG004967	MtrunA17_Chr7g0239361	31.902	163	72	2	422	545	340	502	1.37e-15	81.3
MsaG004967	MtrunA17_Chr1g0154321	32.704	159	69	1	425	545	355	513	1.42e-15	81.3
MsaG004967	MtrunA17_Chr3g0113601	30.357	168	69	2	426	545	461	628	1.47e-15	81.3
MsaG004967	MtrunA17_Chr3g0078541	32.941	170	73	3	434	564	525	692	1.55e-15	81.3
MsaG004967	MtrunA17_Chr7g0239181	32.278	158	69	2	426	545	338	495	1.57e-15	80.9
MsaG004967	MtrunA17_Chr6g0467631	23.773	387	168	9	360	637	281	649	1.69e-15	80.9
MsaG004967	MtrunA17_Chr0c03g0490031	34.194	155	66	2	426	544	288	442	1.76e-15	80.9
MsaG004967	MtrunA17_Chr4g0042351	31.818	154	67	1	430	545	445	598	2.34e-15	80.5
MsaG004967	MtrunA17_Chr1g0154681	35.780	109	68	2	651	758	64	171	2.64e-15	76.6
MsaG004967	MtrunA17_Chr2g0280791	33.548	155	65	1	429	545	512	666	2.65e-15	80.5
MsaG004967	MtrunA17_Chr4g0065561	23.932	351	198	9	288	592	309	636	3.11e-15	80.1
MsaG004967	MtrunA17_Chr2g0317071	32.484	157	67	1	427	544	782	938	3.70e-15	80.1
MsaG004967	MtrunA17_Chr3g0078531	32.044	181	79	4	426	564	511	689	3.81e-15	80.1
MsaG004967	MtrunA17_Chr5g0422921	30.460	174	81	2	429	564	489	660	4.83e-15	79.7
MsaG004967	MtrunA17_Chr3g0081061	45.570	79	41	1	427	505	26	102	5.48e-15	72.4
MsaG004967	MtrunA17_Chr8g0357651	27.925	265	139	7	324	545	360	615	5.56e-15	79.3
MsaG004967	MtrunA17_Chr4g0053601	31.333	150	87	6	126	264	1	145	5.75e-15	73.6
MsaG004967	MtrunA17_Chr7g0248491	29.487	156	71	1	429	545	151	306	5.83e-15	78.6
MsaG004967	MtrunA17_Chr1g0201611	29.661	236	103	7	372	545	14	248	6.29e-15	77.8
MsaG004967	MtrunA17_Chr1g0206401	30.818	159	72	1	425	545	337	495	6.90e-15	79.0
MsaG004967	MtrunA17_Chr4g0042441	33.333	153	63	2	432	545	493	645	6.95e-15	79.0
MsaG004967	MtrunA17_Chr6g0454621	28.962	183	90	2	400	545	797	976	7.75e-15	79.3
MsaG004967	MtrunA17_Chr5g0428101	23.797	374	203	9	250	582	349	681	7.78e-15	79.0
MsaG004967	MtrunA17_Chr3g0119041	31.447	159	71	1	425	545	327	485	7.97e-15	78.6
MsaG004967	MtrunA17_Chr6g0454661	28.962	183	90	2	400	545	796	975	9.18e-15	79.0
MsaG004967	MtrunA17_Chr4g0048681	26.230	244	140	4	336	545	187	424	9.28e-15	78.2
MsaG004967	MtrunA17_Chr7g0249841	29.018	224	114	5	361	545	229	446	1.28e-14	77.8
MsaG004967	MtrunA17_Chr8g0343131	34.437	151	62	2	431	545	104	253	1.37e-14	76.6
MsaG004967	MtrunA17_Chr8g0354401	50.000	68	34	0	427	494	44	111	1.47e-14	70.5
MsaG004967	MtrunA17_Chr2g0329871	28.218	202	101	4	387	545	16	216	1.99e-14	75.5
MsaG004967	MtrunA17_Chr8g0361261	33.548	155	65	1	429	545	528	682	2.30e-14	77.4
MsaG004967	MtrunA17_Chr8g0357961	25.620	242	126	4	348	545	398	629	2.32e-14	77.4
MsaG004967	MtrunA17_Chr4g0065521	32.258	155	67	1	429	545	28	182	2.33e-14	75.5
MsaG004967	MtrunA17_Chr8g0366991	33.582	134	76	4	366	498	380	501	2.35e-14	77.4
MsaG004967	MtrunA17_Chr1g0172951	31.646	158	70	2	426	545	330	487	2.41e-14	77.0
MsaG004967	MtrunA17_Chr2g0315021	36.842	133	64	3	431	545	71	201	2.42e-14	73.2
MsaG004967	MtrunA17_Chr8g0357691	28.692	237	119	5	353	545	393	623	2.45e-14	77.4
MsaG004967	MtrunA17_Chr0c01g0489481	34.615	156	61	3	429	545	321	474	2.63e-14	77.0
MsaG004967	MtrunA17_Chr8g0361301	33.548	155	65	1	429	545	497	651	2.80e-14	77.0
MsaG004967	MtrunA17_Chr8g0361441	31.613	155	68	1	429	545	497	651	2.82e-14	77.0
MsaG004967	MtrunA17_Chr3g0106191	29.630	216	95	7	364	545	373	565	3.56e-14	76.6
MsaG004967	MtrunA17_Chr8g0361141	32.099	162	69	2	425	545	500	661	5.68e-14	76.3
MsaG004967	MtrunA17_Chr6g0475001	44.595	74	41	0	425	498	559	632	9.53e-14	75.1
MsaG004967	MtrunA17_Chr2g0280691	32.258	155	67	1	429	545	517	671	1.31e-13	75.1
MsaG004967	MtrunA17_Chr6g0474831	44.595	74	41	0	425	498	14	87	2.00e-13	72.0
MsaG004967	MtrunA17_Chr7g0253951	23.605	233	128	3	361	543	385	617	2.58e-13	73.9
MsaG004967	MtrunA17_Chr7g0247831	30.065	153	70	2	429	545	528	679	4.53e-13	73.2
MsaG004967	MtrunA17_Chr1g0169841	32.258	155	65	3	429	544	803	956	4.72e-13	73.6
MsaG004967	MtrunA17_Chr3g0134321	28.846	156	74	3	424	545	391	543	6.28e-13	72.8
MsaG004967	MtrunA17_Chr4g0049551	26.613	248	101	3	426	592	348	595	7.41e-13	72.4
MsaG004967	MtrunA17_Chr4g0048641	32.692	156	89	3	404	545	450	603	9.42e-13	72.0
MsaG004967	MtrunA17_Chr7g0252301	26.496	234	111	6	353	544	783	997	1.03e-12	72.4
MsaG004967	MtrunA17_Chr2g0314871	28.627	255	145	11	254	498	494	721	1.04e-12	72.0
MsaG004967	MtrunA17_Chr8g0360201	27.404	208	108	3	379	545	346	551	1.29e-12	71.6
MsaG004967	MtrunA17_Chr7g0239201	44.000	75	41	1	426	499	30	104	1.47e-12	65.9
MsaG004967	MtrunA17_Chr7g0250491	27.149	221	101	4	365	544	731	932	2.32e-12	71.2
MsaG004967	MtrunA17_Chr2g0297901	37.600	125	61	4	431	555	20	127	2.44e-12	68.9
MsaG004967	MtrunA17_Chr7g0248141	53.846	52	23	1	242	293	1	51	2.79e-12	63.5
MsaG004967	MtrunA17_Chr7g0219751	40.404	99	22	1	483	544	3	101	4.06e-12	64.7
MsaG004967	MtrunA17_Chr8g0341061	32.432	148	90	5	412	553	589	732	6.05e-12	69.7
MsaG004967	MtrunA17_Chr3g0098791	43.421	76	43	0	423	498	487	562	1.33e-11	68.2
MsaG004967	MtrunA17_Chr3g0084621	43.421	76	43	0	423	498	488	563	3.04e-11	67.0
MsaG004967	MtrunA17_Chr6g0453571	49.296	71	34	1	435	505	337	405	3.33e-11	66.2

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG004967	AT5G24010.1	54.571	722	218	9	1	616	51	768	0.0	753
MsaG004967	AT2G21480.1	39.382	744	308	19	10	624	83	812	1.18e-149	462
MsaG004967	AT4G39110.1	40.193	724	293	17	32	628	106	816	2.63e-147	456
MsaG004967	AT3G46290.1	38.865	705	295	16	32	616	76	764	3.80e-145	449
MsaG004967	AT5G59700.1	38.836	739	313	18	8	627	54	772	4.24e-145	449
MsaG004967	AT5G54380.1	36.501	726	320	17	32	624	80	797	2.51e-130	411
MsaG004967	AT5G61350.1	37.188	761	317	21	13	626	70	816	1.31e-128	406
MsaG004967	AT2G23200.1	35.287	802	362	25	13	686	62	834	3.16e-119	381
MsaG004967	AT2G39360.1	32.058	758	368	20	17	648	59	795	3.65e-106	346
MsaG004967	AT1G30570.1	31.233	746	356	17	16	616	66	799	1.86e-103	339
MsaG004967	AT3G51550.1	32.747	739	332	22	33	616	88	816	2.50e-100	332
MsaG004967	AT5G28680.1	30.809	766	361	23	6	616	49	800	8.39e-93	311
MsaG004967	AT5G28680.2	30.809	766	361	23	6	616	49	800	8.39e-93	311
MsaG004967	AT3G04690.1	29.988	827	393	29	6	678	48	842	1.75e-89	302
MsaG004967	AT4G25680.1	61.947	226	69	5	624	837	10	230	7.73e-87	276
MsaG004967	AT4G25660.1	60.965	228	71	5	624	837	10	233	6.19e-86	274
MsaG004967	AT4G00300.1	38.228	429	224	13	1	405	49	460	2.23e-81	270
MsaG004967	AT5G39000.1	30.287	766	354	29	30	635	80	825	1.33e-70	250
MsaG004967	AT5G38990.1	30.840	762	354	28	30	630	78	827	4.08e-69	246
MsaG004967	AT5G39020.1	27.953	601	303	24	33	545	80	638	3.65e-45	175
MsaG004967	AT5G39030.2	28.952	601	306	26	30	545	70	634	6.53e-42	165
MsaG004967	AT5G39030.1	28.952	601	306	26	30	545	76	640	8.37e-42	164
MsaG004967	AT1G56145.3	23.965	459	216	9	268	618	430	863	2.84e-25	113
MsaG004967	AT1G56145.1	23.965	459	216	9	268	618	533	966	3.10e-25	113
MsaG004967	AT1G51870.1	25.231	432	208	12	308	635	407	827	1.04e-24	111
MsaG004967	AT1G51870.2	26.596	376	163	11	362	635	515	879	3.21e-24	109
MsaG004967	AT4G02010.1	31.224	237	114	5	361	555	308	537	8.89e-24	107
MsaG004967	AT1G68690.1	33.610	241	102	6	363	545	279	519	1.63e-23	107
MsaG004967	AT1G68690.3	33.610	241	102	6	363	545	279	519	1.63e-23	107
MsaG004967	AT1G68690.2	33.610	241	102	6	363	545	279	519	1.63e-23	107
MsaG004967	AT1G51860.2	27.072	362	155	9	362	622	370	723	2.12e-23	106
MsaG004967	AT1G68690.4	33.610	241	102	6	363	545	279	519	2.22e-23	106
MsaG004967	AT1G23540.2	31.111	270	99	6	361	545	247	514	3.40e-23	105
MsaG004967	AT1G51860.1	27.072	362	155	9	362	622	514	867	3.45e-23	106
MsaG004967	AT1G79620.2	33.028	218	106	3	365	544	565	780	5.96e-23	105
MsaG004967	AT1G79620.1	32.877	219	107	3	365	545	565	781	7.01e-23	105
MsaG004967	AT1G79620.5	32.877	219	107	3	365	545	591	807	7.04e-23	105
MsaG004967	AT1G23540.1	31.111	270	99	6	361	545	247	514	8.35e-23	104
MsaG004967	AT2G04300.2	27.852	298	112	7	426	622	571	866	1.02e-22	104
MsaG004967	AT2G04300.1	27.852	298	112	7	426	622	530	825	1.10e-22	104
MsaG004967	AT1G66150.1	29.703	303	140	7	361	594	484	782	2.87e-22	103
MsaG004967	AT1G56140.1	25.304	411	177	9	274	587	545	922	3.06e-22	103
MsaG004967	AT1G06840.1	37.912	182	73	3	404	545	587	768	4.82e-22	102
MsaG004967	AT3G23750.1	32.381	210	97	3	425	592	564	770	1.08e-21	101
MsaG004967	AT1G56120.1	30.131	229	101	2	354	545	647	853	1.83e-21	100
MsaG004967	AT3G53590.1	32.751	229	97	4	355	544	553	763	1.86e-21	100
MsaG004967	AT1G56120.3	30.131	229	101	2	354	545	481	687	1.88e-21	100
MsaG004967	AT2G48010.1	33.921	227	99	5	361	545	214	431	2.03e-21	100
MsaG004967	AT3G21340.1	26.510	298	116	7	426	622	581	876	2.06e-21	100
MsaG004967	AT2G37050.3	32.900	231	106	6	356	545	527	749	2.11e-21	100
MsaG004967	AT1G56120.2	30.131	229	101	2	354	545	629	835	2.27e-21	100
MsaG004967	AT1G10620.1	26.361	349	139	9	361	593	263	609	3.32e-21	99.8
MsaG004967	AT5G56890.1	37.419	155	58	1	430	545	714	868	3.40e-21	100
MsaG004967	AT1G49270.1	36.774	155	60	1	429	545	326	480	4.04e-21	99.4
MsaG004967	AT2G01820.1	37.654	162	59	2	425	544	571	732	4.27e-21	99.8
MsaG004967	AT2G37050.1	32.609	230	107	6	356	545	527	748	5.48e-21	99.4
MsaG004967	AT1G51850.2	25.946	370	164	10	353	621	501	861	5.91e-21	99.4
MsaG004967	AT1G51850.1	25.946	370	164	10	353	621	481	841	6.71e-21	99.0
MsaG004967	AT2G28970.1	28.736	261	101	6	415	592	455	713	1.20e-20	98.2
MsaG004967	AT2G28970.2	28.736	261	101	6	415	592	420	678	1.31e-20	97.8
MsaG004967	AT4G23230.1	30.594	219	99	3	365	545	278	481	1.46e-20	97.4
MsaG004967	AT2G25190.1	41.818	110	61	3	647	755	36	143	1.49e-20	92.0
MsaG004967	AT3G59420.1	27.303	304	112	7	429	625	502	803	1.54e-20	97.8
MsaG004967	AT3G24550.1	38.312	154	58	1	429	545	270	423	1.99e-20	97.1
MsaG004967	AT5G01950.2	35.065	154	63	1	429	545	531	684	2.13e-20	97.4
MsaG004967	AT3G24540.1	32.735	223	90	6	361	545	126	326	2.42e-20	95.9
MsaG004967	AT5G01950.6	35.065	154	63	1	429	545	616	769	2.58e-20	97.1
MsaG004967	AT5G01950.3	35.065	154	63	1	429	545	616	769	3.05e-20	97.1
MsaG004967	AT5G01950.1	35.065	154	63	1	429	545	616	769	3.05e-20	97.1
MsaG004967	AT5G01950.4	35.065	154	63	1	429	545	616	769	3.05e-20	97.1
MsaG004967	AT5G01950.8	35.065	154	63	1	429	545	616	769	3.05e-20	97.1
MsaG004967	AT1G52290.2	34.416	154	64	1	429	545	133	286	3.13e-20	94.4
MsaG004967	AT1G70460.1	38.312	154	58	1	429	545	343	496	3.70e-20	96.3
MsaG004967	AT1G80690.2	36.923	130	73	4	647	769	34	161	4.27e-20	90.5
MsaG004967	AT3G13380.1	26.359	368	158	7	368	622	780	1147	4.84e-20	96.7
MsaG004967	AT5G37450.4	38.172	186	62	4	429	561	418	603	4.91e-20	95.9
MsaG004967	AT1G55610.1	26.331	338	154	6	349	593	764	1099	5.18e-20	96.3
MsaG004967	AT1G55610.2	26.331	338	154	6	349	593	764	1099	5.18e-20	96.3
MsaG004967	AT1G53430.2	25.708	424	189	12	184	544	412	772	5.36e-20	96.3
MsaG004967	AT5G48740.1	25.543	368	143	9	361	621	548	891	5.49e-20	96.3
MsaG004967	AT1G25390.1	29.658	263	110	7	335	545	196	435	5.66e-20	95.5
MsaG004967	AT1G25390.2	29.658	263	110	7	335	545	196	435	5.66e-20	95.5
MsaG004967	AT1G52290.1	34.416	154	64	1	429	545	133	286	6.45e-20	94.7
MsaG004967	AT5G37450.1	38.172	186	62	4	429	561	597	782	6.63e-20	95.9
MsaG004967	AT1G53430.1	25.708	424	189	12	184	544	453	813	6.71e-20	95.9
MsaG004967	AT5G37450.2	38.172	186	62	4	429	561	645	830	6.93e-20	95.9
MsaG004967	AT5G37450.3	38.172	186	62	4	429	561	621	806	7.11e-20	95.9
MsaG004967	AT1G11340.2	28.311	219	118	2	365	545	510	727	7.36e-20	95.5
MsaG004967	AT4G39400.1	36.709	158	61	1	426	544	870	1027	8.77e-20	95.9
MsaG004967	AT1G80690.1	38.889	126	72	4	647	769	34	157	8.81e-20	89.7
MsaG004967	AT1G11340.3	28.311	219	118	2	365	545	510	727	9.06e-20	95.1
MsaG004967	AT1G11050.1	31.197	234	100	4	361	550	234	450	9.28e-20	94.7
MsaG004967	AT1G11340.1	28.311	219	118	2	365	545	442	659	1.00e-19	95.1
MsaG004967	AT1G11303.1	32.174	230	97	7	361	545	438	653	1.10e-19	95.1
MsaG004967	AT5G01950.7	34.177	158	62	1	429	544	616	773	1.16e-19	95.1
MsaG004967	AT4G32710.1	35.065	154	63	1	429	545	379	532	1.21e-19	94.7
MsaG004967	AT1G51805.1	26.796	362	158	9	361	621	505	860	1.34e-19	94.7
MsaG004967	AT1G51805.2	26.796	362	158	9	361	621	481	836	1.37e-19	94.7
MsaG004967	AT1G24650.1	34.973	183	73	3	409	545	513	695	1.39e-19	94.7
MsaG004967	AT1G26150.1	31.148	244	105	5	365	545	330	573	1.72e-19	94.4
MsaG004967	AT2G28990.2	27.964	329	142	9	386	633	530	844	1.73e-19	94.4
MsaG004967	AT2G28990.1	27.964	329	142	9	386	633	530	844	1.73e-19	94.4
MsaG004967	AT1G26150.2	31.148	244	105	5	365	545	330	573	1.75e-19	94.0
MsaG004967	AT4G32300.1	28.521	284	111	7	424	618	478	758	1.80e-19	94.4
MsaG004967	AT3G18810.1	36.364	154	61	1	429	545	327	480	1.91e-19	94.0
MsaG004967	AT4G23140.2	35.220	159	65	1	425	545	337	495	2.03e-19	94.0
MsaG004967	AT1G53440.1	25.408	429	223	12	254	618	497	892	2.13e-19	94.4
MsaG004967	AT4G23140.1	35.220	159	65	1	425	545	337	495	2.14e-19	94.0
MsaG004967	AT5G10530.1	29.911	224	103	4	361	545	270	478	2.15e-19	93.6
MsaG004967	AT5G38560.1	30.328	244	108	6	362	545	241	482	2.33e-19	93.6
MsaG004967	AT4G23160.1	35.220	159	65	1	425	545	345	503	2.38e-19	93.6
MsaG004967	AT5G16900.4	36.306	157	60	2	426	544	376	530	3.02e-19	93.2
MsaG004967	AT1G56130.3	23.415	410	186	8	274	587	347	724	3.83e-19	93.2
MsaG004967	AT5G16900.1	36.076	158	61	2	426	545	562	717	4.35e-19	93.2
MsaG004967	AT5G16900.3	36.076	158	61	2	426	545	562	717	4.35e-19	93.2
MsaG004967	AT1G56130.1	23.415	410	186	8	274	587	398	775	4.86e-19	93.2
MsaG004967	AT1G56130.2	23.415	410	186	8	274	587	546	923	5.18e-19	93.2
MsaG004967	AT1G51910.1	24.385	447	213	18	278	622	431	854	5.49e-19	92.8
MsaG004967	AT5G25170.1	40.000	110	63	3	647	755	37	144	6.50e-19	87.0
MsaG004967	AT1G51890.5	26.756	299	115	8	426	623	287	582	6.96e-19	92.0
MsaG004967	AT1G01540.1	24.910	277	120	4	357	545	23	299	7.04e-19	90.1
MsaG004967	AT1G51890.4	26.756	299	115	8	426	623	495	790	7.07e-19	92.4
MsaG004967	AT1G51890.1	26.756	299	115	8	426	623	559	854	7.74e-19	92.4
MsaG004967	AT4G38830.1	35.220	159	65	1	425	545	330	488	9.85e-19	91.7
MsaG004967	AT1G01540.2	24.910	277	120	4	357	545	23	299	1.06e-18	90.5
MsaG004967	AT4G11470.1	34.591	159	66	1	425	545	325	483	1.62e-18	90.9
MsaG004967	AT4G11470.2	34.591	159	66	1	425	545	330	488	1.69e-18	90.9
MsaG004967	AT4G04960.2	33.333	165	69	2	422	545	330	494	1.76e-18	90.5
MsaG004967	AT1G18390.2	26.702	382	177	11	355	648	259	625	1.81e-18	90.9
MsaG004967	AT1G67720.1	24.433	397	177	11	331	617	503	886	2.17e-18	90.9
MsaG004967	AT4G21230.1	34.839	155	63	1	429	545	323	477	2.21e-18	90.5
MsaG004967	AT1G07560.1	28.279	244	91	6	429	592	562	801	2.25e-18	90.9
MsaG004967	AT4G04960.1	33.333	165	69	2	422	545	330	494	2.35e-18	90.5
MsaG004967	AT1G21240.1	28.137	263	145	4	370	592	345	603	2.85e-18	90.5
MsaG004967	AT1G18390.1	26.410	390	184	11	347	648	245	619	3.01e-18	90.1
MsaG004967	AT4G34440.2	37.013	154	60	1	429	545	302	455	3.12e-18	90.1
MsaG004967	AT4G34440.1	37.013	154	60	1	429	545	302	455	3.12e-18	90.1
MsaG004967	AT4G23180.3	33.962	159	67	1	425	545	334	492	3.56e-18	89.4
MsaG004967	AT3G55550.1	31.731	208	100	3	426	594	333	537	4.53e-18	89.7
MsaG004967	AT4G23220.1	30.045	223	96	4	361	545	280	480	4.54e-18	89.4
MsaG004967	AT1G61420.5	35.526	152	60	1	432	545	339	490	4.55e-18	89.4
MsaG004967	AT1G61420.3	35.526	152	60	1	432	545	337	488	4.65e-18	89.4
MsaG004967	AT4G23180.2	33.962	159	67	1	425	545	334	492	4.70e-18	89.4
MsaG004967	AT1G61460.1	34.868	152	61	1	432	545	447	598	4.71e-18	89.7
MsaG004967	AT1G61420.1	35.526	152	60	1	432	545	487	638	5.04e-18	89.7
MsaG004967	AT1G61420.2	35.526	152	60	1	432	545	489	640	5.19e-18	89.7
MsaG004967	AT1G61420.4	35.526	152	60	1	432	545	489	640	5.19e-18	89.7
MsaG004967	AT4G23150.1	33.333	159	68	1	425	545	322	480	5.23e-18	89.4
MsaG004967	AT1G49100.1	25.839	298	118	6	426	622	570	865	5.44e-18	89.7
MsaG004967	AT4G27290.2	30.204	245	113	6	344	545	426	655	6.13e-18	89.4
MsaG004967	AT4G23180.1	33.962	159	67	1	425	545	334	492	6.79e-18	89.0
MsaG004967	AT5G59260.1	25.806	248	102	2	422	587	338	585	6.91e-18	89.0
MsaG004967	AT1G21230.1	29.348	276	135	9	361	592	337	596	6.96e-18	89.0
MsaG004967	AT4G11480.2	33.962	159	67	1	425	545	310	468	6.99e-18	88.2
MsaG004967	AT1G11300.1	31.304	230	99	7	361	545	438	653	7.03e-18	89.4
MsaG004967	AT4G11480.3	33.962	159	67	1	425	545	310	468	9.94e-18	88.6
MsaG004967	AT4G11480.4	33.962	159	67	1	425	545	307	465	9.97e-18	88.6
MsaG004967	AT1G21210.1	30.317	221	112	3	364	545	337	554	1.02e-17	88.6
MsaG004967	AT4G11900.8	28.774	212	102	3	372	545	412	612	1.10e-17	88.2
MsaG004967	AT1G47740.1	39.450	109	64	2	651	758	91	198	1.21e-17	84.7
MsaG004967	AT1G47740.2	39.450	109	64	2	651	758	91	198	1.21e-17	84.7
MsaG004967	AT1G47740.3	39.450	109	64	2	651	758	91	198	1.21e-17	84.7
MsaG004967	AT1G61480.1	30.594	219	112	3	432	612	489	705	1.23e-17	88.6
MsaG004967	AT4G11900.6	28.774	212	102	3	372	545	481	681	1.28e-17	88.2
MsaG004967	AT4G11900.4	28.774	212	102	3	372	545	481	681	1.28e-17	88.2
MsaG004967	AT5G35370.1	35.625	160	64	2	423	545	501	658	1.32e-17	88.6
MsaG004967	AT4G11900.1	28.774	212	102	3	372	545	481	681	1.34e-17	88.2
MsaG004967	AT1G65800.1	28.151	238	110	6	360	545	439	667	1.35e-17	88.2
MsaG004967	AT4G11900.7	28.774	212	102	3	372	545	481	681	1.36e-17	88.2
MsaG004967	AT4G11900.2	28.774	212	102	3	372	545	481	681	1.36e-17	88.2
MsaG004967	AT4G11900.3	28.774	212	102	3	372	545	481	681	1.36e-17	88.2
MsaG004967	AT4G11900.9	28.774	212	102	3	372	545	412	612	1.42e-17	88.2
MsaG004967	AT1G51890.3	33.544	158	64	3	426	545	559	713	1.48e-17	88.2
MsaG004967	AT2G18470.4	36.364	154	61	1	429	545	274	427	1.52e-17	87.4
MsaG004967	AT2G18470.1	36.364	154	61	1	429	545	274	427	1.57e-17	87.8
MsaG004967	AT2G18470.3	36.364	154	61	1	429	545	274	427	1.57e-17	87.8
MsaG004967	AT2G18470.2	36.364	154	61	1	429	545	274	427	1.57e-17	87.8
MsaG004967	AT4G23200.2	32.911	158	68	1	426	545	323	480	1.60e-17	87.0
MsaG004967	AT1G61430.11	36.184	152	59	1	432	545	459	610	2.09e-17	87.8
MsaG004967	AT1G61430.12	36.184	152	59	1	432	545	459	610	2.09e-17	87.8
MsaG004967	AT1G61430.13	36.184	152	59	1	432	545	459	610	2.09e-17	87.8
MsaG004967	AT1G53420.1	37.013	154	58	1	431	545	616	769	2.10e-17	87.8
MsaG004967	AT1G61400.1	36.184	152	59	1	432	545	493	644	2.12e-17	87.8
MsaG004967	AT4G31100.1	36.364	154	59	1	431	545	436	589	2.13e-17	87.8
MsaG004967	AT1G61430.9	36.184	152	59	1	432	545	482	633	2.13e-17	87.8
MsaG004967	AT4G23200.1	32.911	158	68	1	426	545	323	480	2.20e-17	87.4
MsaG004967	AT4G31110.1	36.364	154	59	1	431	545	445	598	2.22e-17	87.4
MsaG004967	AT4G11490.1	32.895	152	64	1	432	545	314	465	2.31e-17	87.0
MsaG004967	AT3G09010.2	32.692	156	66	1	429	545	36	191	2.34e-17	84.3
MsaG004967	AT1G61430.10	36.184	152	59	1	432	545	459	610	2.34e-17	87.4
MsaG004967	AT4G31110.2	36.364	154	59	1	431	545	423	576	2.36e-17	87.4
MsaG004967	AT1G61430.8	36.184	152	59	1	432	545	482	633	2.40e-17	87.4
MsaG004967	AT1G61430.7	36.184	152	59	1	432	545	482	633	2.40e-17	87.4
MsaG004967	AT1G11330.1	26.727	333	183	7	362	639	445	771	2.88e-17	87.4
MsaG004967	AT3G58690.1	30.909	165	71	2	424	545	71	235	2.94e-17	85.5
MsaG004967	AT1G16670.1	33.544	158	64	1	429	545	31	188	3.40e-17	85.1
MsaG004967	AT5G59270.3	23.827	277	128	4	403	597	316	591	3.41e-17	86.7
MsaG004967	AT3G19300.1	28.216	241	130	3	357	556	246	484	3.48e-17	86.7
MsaG004967	AT5G59270.1	23.827	277	128	4	403	597	313	588	3.66e-17	86.7
MsaG004967	AT4G00970.2	28.378	222	102	3	362	545	286	488	3.72e-17	86.3
MsaG004967	AT1G61390.2	28.247	308	155	8	285	545	208	496	3.89e-17	86.7
MsaG004967	AT5G59270.2	23.827	277	128	4	403	597	332	607	3.91e-17	86.7
MsaG004967	AT1G61390.1	28.247	308	155	8	285	545	376	664	4.24e-17	86.7
MsaG004967	AT4G27290.1	33.333	162	67	2	425	545	448	609	4.52e-17	86.7
MsaG004967	AT4G00970.1	28.378	222	102	3	362	545	286	488	4.89e-17	86.3
MsaG004967	AT1G11280.4	29.694	229	101	4	360	545	436	647	5.24e-17	86.3
MsaG004967	AT1G49730.4	27.742	310	147	11	362	604	256	555	5.79e-17	85.9
MsaG004967	AT1G11280.3	29.694	229	101	4	360	545	426	637	6.26e-17	86.3
MsaG004967	AT3G45860.1	33.962	159	67	1	425	545	337	495	6.74e-17	85.9
MsaG004967	AT1G61500.2	35.526	152	60	1	432	545	466	617	6.91e-17	85.9
MsaG004967	AT4G01330.1	25.676	296	125	6	344	545	13	307	7.28e-17	85.1
MsaG004967	AT1G61500.1	35.526	152	60	1	432	545	484	635	7.41e-17	85.9
MsaG004967	AT4G01330.2	25.676	296	125	6	344	545	13	307	7.78e-17	84.7
MsaG004967	AT3G09010.1	32.692	156	66	1	429	545	36	191	7.89e-17	84.0
MsaG004967	AT4G23290.2	27.586	203	104	2	386	545	305	507	8.63e-17	85.5
MsaG004967	AT4G11460.2	35.583	163	65	2	421	545	255	415	8.69e-17	85.5
MsaG004967	AT1G61500.3	35.526	152	60	1	432	545	489	640	9.00e-17	85.5
MsaG004967	AT4G01330.3	25.676	296	125	6	344	545	13	307	9.19e-17	84.3
MsaG004967	AT4G23290.1	27.586	203	104	2	386	545	262	464	9.37e-17	85.1
MsaG004967	AT5G65600.1	29.596	223	106	5	361	545	285	494	9.43e-17	85.5
MsaG004967	AT4G11480.1	32.335	167	67	1	425	545	307	473	9.45e-17	85.5
MsaG004967	AT4G23130.3	33.962	159	67	1	425	545	330	488	9.93e-17	85.1
MsaG004967	AT1G16130.1	29.185	233	113	4	356	545	337	560	1.04e-16	85.5
MsaG004967	AT4G11460.3	35.583	163	65	2	421	545	330	490	1.06e-16	85.1
MsaG004967	AT4G03230.5	33.742	163	67	3	424	545	600	762	1.07e-16	85.5
MsaG004967	AT1G19390.1	35.294	153	61	1	431	545	443	595	1.07e-16	85.5
MsaG004967	AT2G25220.6	32.895	152	64	1	432	545	139	290	1.13e-16	83.2
MsaG004967	AT1G61490.6	34.868	152	61	1	432	545	457	608	1.15e-16	85.1
MsaG004967	AT1G61490.7	34.868	152	61	1	432	545	457	608	1.15e-16	85.1
MsaG004967	AT4G03230.3	33.742	163	67	3	424	545	507	669	1.16e-16	85.5
MsaG004967	AT1G61490.3	34.868	152	61	1	432	545	333	484	1.17e-16	85.1
MsaG004967	AT4G03230.2	33.742	163	67	3	424	545	572	734	1.18e-16	85.5
MsaG004967	AT4G03230.6	33.742	163	67	3	424	545	572	734	1.18e-16	85.5
MsaG004967	AT1G61490.4	34.868	152	61	1	432	545	483	634	1.26e-16	85.1
MsaG004967	AT1G61490.1	34.868	152	61	1	432	545	483	634	1.26e-16	85.1
MsaG004967	AT1G61490.2	34.868	152	61	1	432	545	483	634	1.26e-16	85.1
MsaG004967	AT1G61490.5	34.868	152	61	1	432	545	483	634	1.26e-16	85.1
MsaG004967	AT4G23130.2	33.962	159	67	1	425	545	330	488	1.29e-16	84.7
MsaG004967	AT4G23130.1	33.962	159	67	1	425	545	326	484	1.30e-16	84.7
MsaG004967	AT4G03230.7	33.742	163	67	3	424	545	515	677	1.31e-16	85.1
MsaG004967	AT1G49730.1	30.000	240	113	7	362	556	286	515	1.33e-16	84.7
MsaG004967	AT4G03230.4	33.742	163	67	3	424	545	672	834	1.37e-16	85.1
MsaG004967	AT4G03230.1	33.742	163	67	3	424	545	672	834	1.37e-16	85.1
MsaG004967	AT4G23190.2	29.907	214	94	3	370	545	299	494	1.43e-16	84.3
MsaG004967	AT1G11300.2	33.540	161	66	2	426	545	478	638	1.47e-16	85.1
MsaG004967	AT4G04540.3	32.727	165	73	1	419	545	333	497	1.48e-16	84.3
MsaG004967	AT2G25220.4	33.113	151	63	1	432	544	90	240	1.49e-16	83.2
MsaG004967	AT4G04540.4	32.727	165	73	1	419	545	304	468	1.57e-16	84.7
MsaG004967	AT2G25220.3	33.113	151	63	1	432	544	139	289	1.63e-16	83.6
MsaG004967	AT1G15530.1	29.936	157	73	1	426	545	348	504	1.64e-16	84.7
MsaG004967	AT1G17910.1	35.294	153	61	1	431	545	446	598	1.65e-16	84.7
MsaG004967	AT2G25220.5	33.113	151	63	1	432	544	90	240	1.69e-16	82.8
MsaG004967	AT2G25220.1	33.113	151	63	1	432	544	139	289	1.70e-16	83.6
MsaG004967	AT2G25220.2	32.895	152	64	1	432	545	144	295	1.80e-16	83.2
MsaG004967	AT4G03230.8	33.742	163	67	3	424	545	514	676	1.91e-16	84.7
MsaG004967	AT4G23190.3	29.148	223	102	3	361	545	212	416	1.92e-16	84.0
MsaG004967	AT4G23190.4	29.148	223	102	3	361	545	212	416	1.92e-16	84.0
MsaG004967	AT1G11280.5	34.211	152	62	1	432	545	498	649	1.93e-16	84.3
MsaG004967	AT5G38210.2	31.064	235	107	7	361	545	284	513	1.96e-16	84.3
MsaG004967	AT1G70520.1	28.155	206	107	2	425	592	311	513	1.98e-16	84.3
MsaG004967	AT4G23190.1	29.907	214	94	3	370	545	299	494	2.01e-16	84.3
MsaG004967	AT4G04540.2	32.727	165	73	1	419	545	333	497	2.07e-16	84.0
MsaG004967	AT4G04540.1	32.727	165	73	1	419	545	333	497	2.09e-16	84.3
MsaG004967	AT5G38210.3	31.064	235	107	7	361	545	266	495	2.14e-16	84.3
MsaG004967	AT1G61400.2	34.375	160	59	1	432	545	493	652	2.15e-16	84.3
MsaG004967	AT1G11330.2	28.182	330	173	8	365	639	453	773	2.17e-16	84.3
MsaG004967	AT1G11280.2	34.211	152	62	1	432	545	498	649	2.20e-16	84.3
MsaG004967	AT4G05200.1	32.075	159	70	1	425	545	333	491	2.27e-16	84.0
MsaG004967	AT5G45780.1	30.702	228	94	5	361	545	239	445	2.28e-16	84.0
MsaG004967	AT3G26700.3	33.019	212	76	7	405	558	30	233	2.28e-16	82.4
MsaG004967	AT3G26700.2	33.019	212	76	7	405	558	30	233	2.28e-16	82.4
MsaG004967	AT3G26700.1	33.019	212	76	7	405	558	30	233	2.28e-16	82.4
MsaG004967	AT4G11460.1	34.940	166	65	2	421	545	330	493	2.34e-16	84.0
MsaG004967	AT1G11280.1	34.211	152	62	1	432	545	508	659	2.38e-16	84.3
MsaG004967	AT5G45780.2	30.702	228	94	5	361	545	196	402	2.49e-16	83.6
MsaG004967	AT4G05200.2	32.075	159	70	1	425	545	351	509	2.53e-16	84.0
MsaG004967	AT3G55950.1	33.333	165	62	2	429	545	486	650	2.67e-16	84.0
MsaG004967	AT2G01950.1	33.125	160	66	1	426	544	825	984	2.69e-16	84.3
MsaG004967	AT5G38210.1	31.064	235	107	7	361	545	272	501	2.70e-16	84.0
MsaG004967	AT4G23270.3	33.333	159	68	1	425	545	312	470	2.91e-16	83.6
MsaG004967	AT4G23270.2	33.333	159	68	1	425	545	312	470	3.03e-16	83.6
MsaG004967	AT4G23270.1	33.333	159	68	1	425	545	312	470	3.03e-16	83.6
MsaG004967	AT1G61370.2	34.211	152	62	1	432	545	343	494	3.15e-16	83.6
MsaG004967	AT4G04500.2	33.962	159	67	1	425	545	331	489	3.25e-16	83.2
MsaG004967	AT4G04500.3	33.962	159	67	1	425	545	331	489	3.25e-16	83.2
MsaG004967	AT3G26700.4	33.005	203	72	6	405	549	30	226	3.26e-16	81.3
MsaG004967	AT3G26700.5	33.005	203	72	6	405	549	30	226	3.26e-16	81.3
MsaG004967	AT1G61370.1	34.211	152	62	1	432	545	494	645	3.39e-16	84.0
MsaG004967	AT1G11330.3	30.180	222	108	4	365	545	453	668	3.51e-16	83.6
MsaG004967	AT2G19190.1	34.416	154	61	3	429	545	566	716	3.54e-16	84.0
MsaG004967	AT4G04500.1	33.962	159	67	1	425	545	331	489	4.11e-16	83.2
MsaG004967	AT1G61360.1	33.987	153	63	1	431	545	490	642	4.30e-16	83.6
MsaG004967	AT1G61360.2	33.987	153	63	1	431	545	409	561	4.35e-16	83.2
MsaG004967	AT1G61360.3	33.987	153	63	1	431	545	409	561	4.35e-16	83.2
MsaG004967	AT1G61360.4	33.987	153	63	1	431	545	409	561	4.35e-16	83.2
MsaG004967	AT1G61380.2	34.868	152	61	1	432	545	334	485	4.45e-16	83.2
MsaG004967	AT5G01560.1	31.056	161	70	2	426	545	350	510	4.53e-16	83.2
MsaG004967	AT1G61380.1	34.868	152	61	1	432	545	481	632	4.58e-16	83.2
MsaG004967	AT5G25170.2	38.710	93	56	1	664	755	8	100	4.62e-16	77.4
MsaG004967	AT1G69730.1	31.308	214	100	3	373	545	385	592	4.93e-16	83.2
MsaG004967	AT1G61440.1	34.211	152	62	1	432	545	471	622	4.97e-16	83.2
MsaG004967	AT1G61440.3	34.211	152	62	1	432	545	476	627	5.35e-16	83.2
MsaG004967	AT5G01550.1	31.481	162	69	2	426	545	366	527	5.35e-16	83.2
MsaG004967	AT4G21410.1	28.889	225	112	3	360	545	161	376	5.52e-16	82.4
MsaG004967	AT1G61610.2	26.582	237	114	5	358	545	444	669	5.62e-16	83.2
MsaG004967	AT4G21410.3	28.889	225	112	3	360	545	286	501	5.67e-16	82.8
MsaG004967	AT1G61610.1	26.582	237	114	5	358	545	444	669	6.02e-16	83.2
MsaG004967	AT1G21270.1	27.626	257	140	5	377	592	341	592	6.08e-16	82.8
MsaG004967	AT5G11020.4	27.111	225	119	4	361	544	26	246	6.46e-16	81.3
MsaG004967	AT5G11020.2	27.111	225	119	4	361	544	30	250	6.67e-16	81.3
MsaG004967	AT4G04570.3	27.477	222	106	3	363	545	123	328	6.83e-16	81.3
MsaG004967	AT4G23310.2	34.591	159	66	1	425	545	454	612	6.88e-16	82.8
MsaG004967	AT5G11020.1	27.111	225	119	4	361	544	64	284	7.19e-16	81.6
MsaG004967	AT5G11020.3	27.111	225	119	4	361	544	3	223	7.41e-16	80.9
MsaG004967	AT4G04570.2	27.477	222	106	3	363	545	287	492	7.45e-16	82.0
MsaG004967	AT4G23310.1	34.591	159	66	1	425	545	494	652	7.64e-16	82.8
MsaG004967	AT5G10290.1	32.195	205	89	5	419	580	271	468	7.98e-16	82.4
MsaG004967	AT5G10290.2	32.195	205	89	5	419	580	271	468	7.98e-16	82.4
MsaG004967	AT4G21410.2	28.889	225	112	3	360	545	286	501	8.96e-16	81.6
MsaG004967	AT4G00960.4	33.333	159	68	1	425	545	42	200	9.46e-16	79.0
MsaG004967	AT4G31980.1	37.500	112	67	3	646	755	33	143	9.60e-16	82.0
MsaG004967	AT1G66880.3	27.888	251	91	5	422	587	330	575	9.61e-16	82.0
MsaG004967	AT2G26330.1	33.117	154	65	1	429	544	638	791	9.93e-16	82.4
MsaG004967	AT1G61430.1	35.484	155	59	2	432	545	482	636	1.04e-15	82.4
MsaG004967	AT4G11530.1	32.704	159	69	1	425	545	338	496	1.07e-15	82.0
MsaG004967	AT1G65790.1	33.333	150	62	1	434	545	514	663	1.11e-15	82.0
MsaG004967	AT1G61430.5	35.484	155	59	2	432	545	482	636	1.11e-15	82.0
MsaG004967	AT4G04490.1	30.556	216	91	5	368	545	290	484	1.16e-15	81.6
MsaG004967	AT4G23240.2	32.075	159	70	1	425	545	14	172	1.30e-15	79.7
MsaG004967	AT4G21380.1	27.823	248	121	4	349	545	430	670	1.32e-15	82.0
MsaG004967	AT1G21250.1	28.276	290	153	8	346	592	320	597	1.41e-15	81.6
MsaG004967	AT4G00960.1	33.333	159	68	1	425	545	42	200	1.42e-15	80.1
MsaG004967	AT4G21400.2	33.540	161	65	2	425	545	335	493	1.43e-15	81.6
MsaG004967	AT4G21400.3	33.962	159	63	2	427	545	337	493	1.45e-15	80.9
MsaG004967	AT4G17486.1	33.099	142	90	3	615	755	15	152	1.56e-15	77.0
MsaG004967	AT4G21400.1	33.540	161	65	2	425	545	347	505	1.62e-15	81.3
MsaG004967	AT4G17486.2	32.639	144	92	3	615	757	15	154	1.85e-15	76.3
MsaG004967	AT4G21390.1	29.020	255	115	7	348	545	428	673	2.39e-15	81.3
MsaG004967	AT3G09780.1	25.240	313	169	8	353	603	434	743	2.87e-15	80.9
MsaG004967	AT4G21390.2	29.020	255	115	7	348	545	428	673	3.01e-15	80.5
MsaG004967	AT4G23240.1	32.075	159	70	1	425	545	321	479	3.21e-15	80.5
MsaG004967	AT5G59660.1	27.727	220	104	6	426	592	499	716	3.28e-15	80.5
MsaG004967	AT1G56145.2	27.059	255	150	6	268	513	533	760	3.33e-15	80.9
MsaG004967	AT5G59660.3	27.727	220	104	6	426	592	502	719	3.35e-15	80.5
MsaG004967	AT5G59660.2	25.830	271	126	7	426	623	477	745	3.37e-15	80.5
MsaG004967	AT4G23320.3	29.864	221	101	4	364	545	143	348	3.43e-15	80.1
MsaG004967	AT5G47310.1	35.849	106	66	2	651	755	50	154	3.55e-15	76.6
MsaG004967	AT4G23320.2	29.864	221	101	4	364	545	122	327	3.65e-15	79.7
MsaG004967	AT4G23320.1	29.864	221	101	4	364	545	122	327	3.65e-15	79.7
MsaG004967	AT5G16000.1	29.572	257	112	7	335	544	219	453	3.74e-15	80.1
MsaG004967	AT4G28670.1	26.201	229	126	4	405	592	297	523	3.95e-15	80.1
MsaG004967	AT4G27300.1	32.895	152	64	1	432	545	493	644	5.52e-15	79.7
MsaG004967	AT2G19130.1	34.337	166	61	4	429	549	485	647	7.09e-15	79.7
MsaG004967	AT1G16260.3	26.721	247	134	5	343	545	282	525	7.13e-15	79.3
MsaG004967	AT4G04510.1	33.529	170	72	2	417	545	314	483	7.20e-15	79.3
MsaG004967	AT4G04510.2	33.529	170	72	2	417	545	316	485	7.67e-15	79.3
MsaG004967	AT1G16260.1	32.680	153	65	1	431	545	382	534	1.03e-14	79.0
MsaG004967	AT1G16260.2	32.680	153	65	1	431	545	382	534	1.03e-14	79.0
MsaG004967	AT3G02130.1	31.646	158	73	2	423	545	858	1015	1.12e-14	79.3
MsaG004967	AT1G24030.5	32.075	159	66	4	429	545	52	210	1.14e-14	75.5
MsaG004967	AT3G02130.2	31.646	158	73	2	423	545	841	998	1.16e-14	79.0
MsaG004967	AT5G49780.3	30.357	224	108	4	361	545	562	776	1.36e-14	79.0
MsaG004967	AT1G24030.4	32.075	159	66	4	429	545	52	210	1.53e-14	75.5
MsaG004967	AT3G53840.1	26.531	245	93	3	431	588	346	590	1.88e-14	77.8
MsaG004967	AT1G11410.2	28.829	222	113	3	369	545	331	552	2.01e-14	77.8
MsaG004967	AT1G70450.1	34.395	157	61	3	429	545	39	193	2.10e-14	76.6
MsaG004967	AT1G11410.1	32.903	155	66	1	429	545	513	667	2.11e-14	78.2
MsaG004967	AT4G23210.2	32.075	159	68	2	425	545	346	502	2.23e-14	77.4
MsaG004967	AT4G23210.4	32.075	159	68	2	425	545	346	502	2.23e-14	77.4
MsaG004967	AT1G34300.1	26.721	247	120	7	337	545	404	627	2.24e-14	77.8
MsaG004967	AT1G11410.4	32.903	155	66	1	429	545	520	674	2.31e-14	77.8
MsaG004967	AT1G11410.3	32.903	155	66	1	429	545	489	643	2.32e-14	77.8
MsaG004967	AT4G23210.3	32.075	159	68	2	425	545	346	502	2.58e-14	77.4
MsaG004967	AT4G23210.5	32.075	159	68	2	425	545	346	502	2.62e-14	77.0
MsaG004967	AT4G23210.1	32.075	159	68	2	425	545	346	502	2.91e-14	77.4
MsaG004967	AT1G61550.1	34.211	152	62	1	432	545	482	633	3.17e-14	77.4
MsaG004967	AT4G23250.1	33.553	152	63	2	432	545	352	503	4.18e-14	77.0
MsaG004967	AT1G24030.2	32.075	159	66	4	429	545	52	210	4.25e-14	75.5
MsaG004967	AT2G45910.2	30.065	153	70	2	429	545	471	622	5.20e-14	76.6
MsaG004967	AT2G45910.1	30.065	153	70	2	429	545	471	622	5.20e-14	76.6
MsaG004967	AT1G24030.1	32.075	159	66	4	429	545	66	224	5.65e-14	75.1
MsaG004967	AT2G37050.4	33.889	180	100	8	356	526	527	696	6.37e-14	76.3
MsaG004967	AT5G01950.5	50.000	70	35	0	429	498	616	685	1.20e-13	75.5
MsaG004967	AT2G37050.2	33.520	179	101	8	356	526	527	695	1.53e-13	75.1
MsaG004967	AT1G24030.3	32.258	155	63	4	432	544	1	155	1.80e-13	72.8
MsaG004967	AT4G23160.3	47.297	74	39	0	425	498	925	998	2.66e-13	74.7
MsaG004967	AT4G23160.2	47.297	74	39	0	425	498	925	998	2.66e-13	74.7
MsaG004967	AT5G02800.1	29.936	157	70	2	429	545	63	219	3.68e-13	72.4
MsaG004967	AT3G46410.1	27.727	220	95	6	436	593	2	219	3.96e-13	71.2
MsaG004967	AT5G49780.1	36.364	154	61	1	429	545	524	677	4.02e-13	73.9
MsaG004967	AT1G79620.3	34.074	135	86	2	365	498	565	697	4.21e-13	73.6
MsaG004967	AT5G49780.2	36.364	154	61	1	429	545	645	798	4.21e-13	73.9
MsaG004967	AT5G49760.1	35.714	154	62	1	429	545	621	774	1.28e-12	72.4
MsaG004967	AT1G11350.1	33.540	161	66	2	426	545	496	656	1.47e-12	72.0
MsaG004967	AT4G11900.10	33.582	134	76	3	372	505	481	601	2.87e-12	70.9
MsaG004967	AT4G11900.5	33.582	134	76	3	372	505	481	601	2.87e-12	70.9
MsaG004967	AT5G49770.1	36.364	154	61	1	429	545	624	777	2.91e-12	71.2
MsaG004967	AT1G61430.4	48.193	83	40	2	432	513	459	539	3.02e-12	70.5
MsaG004967	AT1G61430.2	48.193	83	40	2	432	513	482	562	3.12e-12	70.5
MsaG004967	AT1G61430.6	48.193	83	40	2	432	513	482	562	3.12e-12	70.5
MsaG004967	AT1G61430.3	48.193	83	40	2	432	513	491	571	3.30e-12	70.5
MsaG004967	AT1G65800.2	31.250	160	85	6	360	505	439	587	3.76e-12	70.5
MsaG004967	AT5G16900.2	44.737	76	40	1	426	501	562	635	1.37e-11	68.6
MsaG004967	AT4G21400.8	44.444	90	47	2	425	513	208	295	3.35e-11	67.4
MsaG004967	AT4G21400.7	44.444	90	47	2	425	513	309	396	3.83e-11	67.4
MsaG004967	AT4G21380.2	29.050	179	99	5	349	511	430	596	3.94e-11	67.0
MsaG004967	AT4G21400.6	44.444	90	47	2	425	513	347	434	3.94e-11	67.0
MsaG004967	AT4G21400.4	44.444	90	47	2	425	513	347	434	3.94e-11	67.0
MsaG004967	AT4G21400.5	44.444	90	47	2	425	513	347	434	3.94e-11	67.0

Find 181 sgRNAs with CRISPR-Local

Find sgRNAs with CRISPR-GE

CRISPR-Local

CRISPR-Local
sgRNA_sequence	on_target_score	Position	Region
TTTGATAGAAATTTGATTAT+AGG	0.173898	1:-76192334	MsaT004967.1:CDS
GATTCCTGATGAGGATTATT+TGG	0.182217	1:-76193097	MsaT004967.1:CDS
TGCACGGGAGGAAGCATTTA+TGG	0.183775	1:-76192594	MsaT004967.1:CDS
AAATTTAGTGTCTTGGTTAA+TGG	0.186012	1:-76193426	MsaT004967.1:CDS
TCAAAACTTTGATCTTTAAA+TGG	0.206079	1:+76193462	None:intergenic
TAGCACTGCTATTACTTTCT+TGG	0.208506	1:+76191505	None:intergenic
ATATCCAAAACCTGATTTAA+AGG	0.213251	1:+76193305	None:intergenic
GTGGAACTGTGACAGGTTTA+TGG	0.224493	1:-76188778	MsaT004967.1:intron
TGATACAAAGTTTGTATATT+TGG	0.230812	1:+76193570	None:intergenic
CTGACCTGAGTAGTTCTATT+AGG	0.235850	1:-76192684	MsaT004967.1:CDS
CAATGGTTACATTGCATATA+AGG	0.237132	1:-76192815	MsaT004967.1:CDS
GTTATTTCAGTGTGGAATTC+TGG	0.243841	1:+76192217	None:intergenic
GGGTGATGTCTTGTGGAATT+TGG	0.254061	1:-76191544	MsaT004967.1:CDS
AAATCTTTCATCTCAGGTTT+TGG	0.259282	1:-76193190	MsaT004967.1:CDS
ACAAGGTTGGTTGGTCCTTC+TGG	0.278241	1:-76193228	MsaT004967.1:CDS
TCATGACAGGTTGGGTTAAC+AGG	0.284736	1:-76188406	MsaT004967.1:intron
ATTATAGGCTCTGGTGGATT+TGG	0.287528	1:-76192319	MsaT004967.1:CDS
AGTTATTTACCTGGAGGTTT+TGG	0.290709	1:+76188514	None:intergenic
TGTAGCCAAGGTTGCTGATT+TGG	0.294370	1:-76191920	MsaT004967.1:CDS
ACATCTGAACACGGTTCTTA+TGG	0.297408	1:-76192409	MsaT004967.1:CDS
CTCCAAAGGGTGTCATTAAA+AGG	0.299781	1:+76193126	None:intergenic
CACGGTTCTTATGGATATCT+TGG	0.309621	1:-76192400	MsaT004967.1:CDS
TCTTTAATCATCACATCATT+AGG	0.318003	1:+76193375	None:intergenic
AGACCCTTTAAATCAGGTTT+TGG	0.320873	1:-76193309	MsaT004967.1:CDS
AAATAATGTTAAAACTGATA+TGG	0.326521	1:-76188261	MsaT004967.1:CDS
CTGGAGTAGCACCTCCCTTC+TGG	0.338144	1:+76193025	None:intergenic
ATCTGCAAAATTTAGTGTCT+TGG	0.340195	1:-76193433	MsaT004967.1:CDS
TGACTGCTCAACAGATGAAT+AGG	0.346729	1:-76192978	MsaT004967.1:CDS
TTCCTGGAGTTCAAGCTGTT+TGG	0.362928	1:-76188217	MsaT004967.1:CDS
TATATTCCACGGCGCAGTTC+AGG	0.364950	1:-76189035	MsaT004967.1:intron
TTGTTTAGACCCTTTAAATC+AGG	0.373189	1:-76193315	MsaT004967.1:CDS
AAAACTCAAGTTTAGCTTCA+AGG	0.377207	1:-76192954	MsaT004967.1:CDS
GAGAAAATTTGAGCCTGGTT+TGG	0.380725	1:+76193635	None:intergenic
GGAGATGATGAATGGTCATT+TGG	0.382052	1:-76188757	MsaT004967.1:CDS
TACTTTGATGTGTATATCAA+TGG	0.382283	1:-76192832	MsaT004967.1:CDS
GCACCTCCCTTCTGGTAATC+AGG	0.384209	1:+76193033	None:intergenic
GGTGTACGGCATCAAGATTC+CGG	0.386004	1:-76188346	MsaT004967.1:CDS
AACCTTGCATTCTTCGTTGA+AGG	0.388158	1:+76188700	None:intergenic
GTATAGAAATCTTTCATCTC+AGG	0.394231	1:-76193196	MsaT004967.1:CDS
TCAAGGTAAATCAAATACTA+AGG	0.395554	1:-76188630	MsaT004967.1:CDS
TATCCAAAACCTGATTTAAA+GGG	0.403747	1:+76193306	None:intergenic
AGAAATGAAAACGAATCAAA+TGG	0.404853	1:+76193487	None:intergenic
GCACGGGAGGAAGCATTTAT+GGG	0.406589	1:-76192593	MsaT004967.1:CDS
GCTGATTGTATTTCAGCAAA+AGG	0.406768	1:+76192367	None:intergenic
GTTCGTCTTCTCCGAACAAT+TGG	0.407425	1:+76189111	None:intergenic
CCATCGACATCTTGTTTCAC+TGG	0.415396	1:-76192176	MsaT004967.1:intron
AAGCATTTATGGGAGTTGAT+AGG	0.415499	1:-76192583	MsaT004967.1:CDS
ATGACACCCTTTGGAGGACT+TGG	0.416848	1:-76193119	MsaT004967.1:CDS
TGGACGCCTTTGCGTATGTT+TGG	0.417185	1:-76192451	MsaT004967.1:CDS
TCCCCTAGAGGAGAATTTCC+TGG	0.420398	1:-76188233	MsaT004967.1:CDS
TAATCTATAACAAAATCTTC+AGG	0.433025	1:+76193255	None:intergenic
AAGATCTTCAAGAATGGTAT+TGG	0.438201	1:-76189067	MsaT004967.1:CDS
TATCTCTGCACCATTCAGTA+TGG	0.439112	1:+76192654	None:intergenic
GATGATTCCTTGAGCAAAAC+CGG	0.442505	1:+76191987	None:intergenic
TAATGTTGGTGATGTTACTA+TGG	0.442517	1:-76188378	MsaT004967.1:CDS
CGCCTTTGCGTATGTTTGGA+GGG	0.444246	1:-76192447	MsaT004967.1:CDS
AGAAATTTGATTATAGGCTC+TGG	0.450720	1:-76192328	MsaT004967.1:CDS
AAAACCAAATAATCCTCATC+AGG	0.453567	1:+76193093	None:intergenic
AAAGTTTGTATATTTGGAGA+TGG	0.454180	1:+76193576	None:intergenic
GGATTCTGTGAGGAGGGTAC+TGG	0.460671	1:-76188736	MsaT004967.1:CDS
GATGTTACTATGGAAGTGGC+TGG	0.462457	1:-76188368	MsaT004967.1:CDS
AAGTTTGTATATTTGGAGAT+GGG	0.469654	1:+76193577	None:intergenic
ACAGGTGAATTTAGCAGAAT+GGG	0.472078	1:-76191709	MsaT004967.1:CDS
CTGTTGATCCACAACTGACT+AGG	0.473629	1:-76191734	MsaT004967.1:CDS
CGTGTTCAGATGTTCTACTA+AGG	0.474625	1:+76192419	None:intergenic
AAGAGATCATAAGAATTTCC+AGG	0.475737	1:+76188589	None:intergenic
AACCAAACAGCTTGAACTCC+AGG	0.476155	1:+76188215	None:intergenic
ACCTGTTCCCTAGTCAGTTG+TGG	0.478452	1:+76191726	None:intergenic
TCCACAACTGACTAGGGAAC+AGG	0.479302	1:-76191727	MsaT004967.1:CDS
CTGATTGTATTTCAGCAAAA+GGG	0.480416	1:+76192368	None:intergenic
TATGGAAGTGGCTGGGTGTA+CGG	0.480453	1:-76188360	MsaT004967.1:CDS
AGGCTCTGGTGGATTTGGTA+TGG	0.480770	1:-76192314	MsaT004967.1:CDS
GACTGCTCAACAGATGAATA+GGG	0.480784	1:-76192977	MsaT004967.1:CDS
TATCGACAATCGCTTGCTCT+AGG	0.482166	1:-76188673	MsaT004967.1:CDS
ATTCCACACTCTTGCATCAC+CGG	0.483273	1:-76192770	MsaT004967.1:CDS
TTCAAGAATGGTATTGGTCT+CGG	0.484383	1:-76189061	MsaT004967.1:CDS
CTCCAGGAAATTCTCCTCTA+GGG	0.488719	1:+76188231	None:intergenic
GAAGAGAGAAAATTTGAGCC+TGG	0.492886	1:+76193630	None:intergenic
GGAAGGCCTTGTCTTGAACC+TGG	0.492992	1:+76192238	None:intergenic
CTAGGACTTGACCAATTGTT+CGG	0.493001	1:-76189122	MsaT004967.1:intron
ACTCCAGGAAATTCTCCTCT+AGG	0.493885	1:+76188230	None:intergenic
TATAGATTATGGAACAAGGT+TGG	0.494129	1:-76193241	MsaT004967.1:CDS
AACAGGTGAATTTAGCAGAA+TGG	0.495033	1:-76191710	MsaT004967.1:CDS
TTCTACTTGCTACCAGATGC+AGG	0.496628	1:-76192513	MsaT004967.1:CDS
TGATTTGGTCTATCGAGATC+AGG	0.498783	1:-76191905	MsaT004967.1:intron
ATGGTGTTTCACATTTGATT+CGG	0.500535	1:-76192897	MsaT004967.1:CDS
ACGCCTTTGCGTATGTTTGG+AGG	0.500784	1:-76192448	MsaT004967.1:CDS
GAGTTGATAGGTTCAATTGT+TGG	0.502310	1:-76192571	MsaT004967.1:CDS
AGGATTAATGCCATACTGAA+TGG	0.510147	1:-76192664	MsaT004967.1:CDS
GAAATGAAAACGAATCAAAT+GGG	0.515576	1:+76193488	None:intergenic
CTTCAAGGTTTAACATAACG+TGG	0.523416	1:-76192939	MsaT004967.1:CDS
CAGCGGCTTGAGATATGCAT+TGG	0.524255	1:-76192039	MsaT004967.1:CDS
GATTATGGAACAAGGTTGGT+TGG	0.525039	1:-76193237	MsaT004967.1:CDS
GAAAGTTCAGTGGAAAGTGT+TGG	0.529098	1:-76192475	MsaT004967.1:CDS
GGCAATTGAGTGGCTGCAGA+AGG	0.529840	1:-76191688	MsaT004967.1:CDS
GTTAACAGGTTTGCTAATGT+TGG	0.531078	1:-76188392	MsaT004967.1:CDS
ATCGACAATCGCTTGCTCTA+GGG	0.533428	1:-76188672	MsaT004967.1:CDS
CAAGGTAAATCAAATACTAA+GGG	0.533890	1:-76188629	MsaT004967.1:CDS
ATCAACAAGATCTTCAAGAA+TGG	0.533925	1:-76189073	MsaT004967.1:CDS
CTAGGTGTGCCAAAACCTCC+AGG	0.538335	1:-76188523	MsaT004967.1:intron
GTCAGTTGTGGATCAACAGC+AGG	0.538883	1:+76191738	None:intergenic
AATTTGATTATAGGCTCTGG+TGG	0.539664	1:-76192325	MsaT004967.1:CDS
GTCCTTCAACGAAGAATGCA+AGG	0.544301	1:-76188702	MsaT004967.1:CDS
TCTTGCATCACCGGTCTATG+TGG	0.544955	1:-76192761	MsaT004967.1:CDS
ACTTCTAGTAGTTCAGAAGC+TGG	0.554058	1:-76188158	MsaT004967.1:CDS
CAACCATGGGTGATGTCTTG+TGG	0.555245	1:-76191551	MsaT004967.1:CDS
ATTGTTGACCCTCATCGTGT+TGG	0.555415	1:-76191651	MsaT004967.1:CDS
AGTGTTATTCAAATAAGTGT+TGG	0.555794	1:-76192712	MsaT004967.1:CDS
TGTTGATCCACAACTGACTA+GGG	0.556248	1:-76191733	MsaT004967.1:CDS
GTGGCTGCAGAAGGGAATGC+TGG	0.557464	1:-76191679	MsaT004967.1:CDS
ACTGTTCATAGGATTAATGT+AGG	0.557708	1:-76193165	MsaT004967.1:CDS
TTAATCATCACATCATTAGG+TGG	0.559025	1:+76193378	None:intergenic
TATCTTCCTCGATCAATCTG+TGG	0.559182	1:+76191944	None:intergenic
ATATGCATTGGTTCAGCTAG+AGG	0.563938	1:-76192027	MsaT004967.1:CDS
GAGCTTAGTAAAGAGTGGCC+TGG	0.565825	1:-76188607	MsaT004967.1:CDS
ATAGACCAAATCAGCAACCT+TGG	0.567006	1:+76191915	None:intergenic
GAGGACTTGGATTCCTGATG+AGG	0.569778	1:-76193106	MsaT004967.1:CDS
CAGGAATCCAAGTCCTCCAA+AGG	0.571395	1:+76193112	None:intergenic
ATCTTCCTCGATCAATCTGT+GGG	0.571729	1:+76191945	None:intergenic
TTGATAGGTTCAATTGTTGG+AGG	0.573776	1:-76192568	MsaT004967.1:CDS
GTTGGTTGGTCCTTCTGGTG+TGG	0.577571	1:-76193223	MsaT004967.1:CDS
GCAACAAAATCCACATAGAC+CGG	0.577948	1:+76192751	None:intergenic
GATGATACTAATATTGTGCA+CGG	0.579981	1:-76192610	MsaT004967.1:CDS
TTGTTATAGATTATGGAACA+AGG	0.582050	1:-76193245	MsaT004967.1:CDS
CGAGGAAGATAATGTAGCCA+AGG	0.586461	1:-76191932	MsaT004967.1:CDS
GCTGTCAAGAGAGGTATGCC+AGG	0.587978	1:-76192256	MsaT004967.1:CDS
CTTCTAGTAGTTCAGAAGCT+GGG	0.589202	1:-76188157	MsaT004967.1:CDS
TCATTTGGATTCTGTGAGGA+GGG	0.591158	1:-76188742	MsaT004967.1:CDS
CCCAGTGGTAATGAAAACTC+TGG	0.591596	1:+76193542	None:intergenic
CTATACTCTTCCACACCAGA+AGG	0.592078	1:+76193213	None:intergenic
TAATCCTAATAGAACTACTC+AGG	0.593550	1:+76192680	None:intergenic
GTCATTTGGATTCTGTGAGG+AGG	0.593907	1:-76188743	MsaT004967.1:CDS
TTTCAGTGTGGAATTCTGGA+AGG	0.594312	1:+76192221	None:intergenic
TAGCAGAATGGGCAATTGAG+TGG	0.594323	1:-76191698	MsaT004967.1:CDS
ATAGAACTACTCAGGTCAGA+AGG	0.595186	1:+76192688	None:intergenic
GAAACACCATCACGAGCCAC+AGG	0.596253	1:+76192910	None:intergenic
AGGAATCCAAGTCCTCCAAA+GGG	0.596317	1:+76193113	None:intergenic
ATGTTACTATGGAAGTGGCT+GGG	0.597824	1:-76188367	MsaT004967.1:CDS
ATGAGTGATTCAACCAAACC+AGG	0.600924	1:-76193648	MsaT004967.1:CDS
CACAAGACATCACCCATGGT+TGG	0.604064	1:+76191552	None:intergenic
GTTCAGTGGAAAGTGTTGGA+TGG	0.604344	1:-76192471	MsaT004967.1:CDS
GTAAAAGTTGCTGTCAAGAG+AGG	0.607427	1:-76192265	MsaT004967.1:CDS
GTGTTCAGATGTTCTACTAA+GGG	0.607520	1:+76192420	None:intergenic
ATAAAATGGTTATTTCAGTG+TGG	0.607930	1:+76192209	None:intergenic
TGGTGATGTTACTATGGAAG+TGG	0.610187	1:-76188372	MsaT004967.1:CDS
TTAATATCTCCAACACGATG+AGG	0.614823	1:+76191642	None:intergenic
TAAGGGAGCTTAGTAAAGAG+TGG	0.616978	1:-76188612	MsaT004967.1:CDS
CATACACCTGATTACCAGAA+GGG	0.619680	1:-76193039	MsaT004967.1:CDS
CTCCCTCCAAACATACGCAA+AGG	0.622379	1:+76192445	None:intergenic
AGGTTTATGGAGATGATGAA+TGG	0.625379	1:-76188765	MsaT004967.1:CDS
CTTAGTAGAACATCTGAACA+CGG	0.625605	1:-76192418	MsaT004967.1:CDS
AAAATCAAAAGAAAGTTCAG+TGG	0.626235	1:-76192485	MsaT004967.1:CDS
TAATATCTCCAACACGATGA+GGG	0.626315	1:+76191643	None:intergenic
ATGATACTAATATTGTGCAC+GGG	0.627055	1:-76192609	MsaT004967.1:CDS
AGACCGGTGATGCAAGAGTG+TGG	0.630249	1:+76192767	None:intergenic
TCCAGGAAATTCTCCTCTAG+GGG	0.630535	1:+76188232	None:intergenic
GTTCATAGGATTAATGTAGG+AGG	0.632476	1:-76193162	MsaT004967.1:CDS
TCTGAACTACTAGAAGTAGA+CGG	0.636819	1:+76188164	None:intergenic
TGGTGCAGAGATAATGAAGA+TGG	0.637496	1:-76192644	MsaT004967.1:CDS
GCAATTGAGTGGCTGCAGAA+GGG	0.638901	1:-76191687	MsaT004967.1:CDS
TCATACACCTGATTACCAGA+AGG	0.645055	1:-76193040	MsaT004967.1:CDS
TGTGGGTCGATTTAATGTCG+CGG	0.648529	1:+76191962	None:intergenic
GGATTTGGTATGGTCTACAA+AGG	0.648796	1:-76192304	MsaT004967.1:CDS
GGTCTCGGTGGTATATTCCA+CGG	0.655105	1:-76189046	MsaT004967.1:CDS
TGGTGTTGATAGACCAACCA+TGG	0.655628	1:-76191565	MsaT004967.1:intron
ATACTAATATTGTGCACGGG+AGG	0.656319	1:-76192606	MsaT004967.1:CDS
GATATGGATGATTCCCCTAG+AGG	0.666091	1:-76188245	MsaT004967.1:CDS
TTAAGACCTGAACTGCGCCG+TGG	0.669341	1:+76189029	None:intergenic
AAGAATGGTATTGGTCTCGG+TGG	0.669670	1:-76189058	MsaT004967.1:CDS
ATCGACCCACAGATTGATCG+AGG	0.671557	1:-76191950	MsaT004967.1:CDS
GGTATGCCAGGTTCAAGACA+AGG	0.672286	1:-76192244	MsaT004967.1:CDS
ATTCCACAAGACATCACCCA+TGG	0.687941	1:+76191548	None:intergenic
CCAGTGAAACAAGATGTCGA+TGG	0.706214	1:+76192176	None:intergenic
GGTCTGCACTATCTTCACAC+CGG	0.708594	1:-76192006	MsaT004967.1:CDS
ACACCTGATTACCAGAAGGG+AGG	0.709630	1:-76193036	MsaT004967.1:CDS
GTTGAACTTGTATCTCCCAG+TGG	0.710601	1:+76193527	None:intergenic
GGGTCGATTTAATGTCGCGG+TGG	0.717873	1:+76191965	None:intergenic
GGTGTTGATAGACCAACCAT+GGG	0.730597	1:-76191564	MsaT004967.1:intron
GTGTTGGAGATATTAAACCA+AGG	0.747885	1:-76191635	MsaT004967.1:intron
GATCTTGTTGATGTGAACAA+CGG	0.765683	1:+76189084	None:intergenic
ATGGTCATTTGGATTCTGTG+AGG	0.775924	1:-76188746	MsaT004967.1:CDS

CRISPR-GE

badsite warning	sgRNA_sequence	Strand	Position	Region	GC_content

Chromosome	Type	Strat	End	Strand	Name
Chr1	gene	76188127	76193670	76188127	ID=MsaG004967
Chr1	mRNA	76188127	76193670	76188127	ID=MsaT004967.1;Parent=MsaG004967
Chr1	exon	76188127	76188419	76188127	ID=MsaT004967.1.exon7;Parent=MsaT004967.1
Chr1	CDS	76188127	76188419	76188127	ID=cds.MsaT004967.1;Parent=MsaT004967.1
Chr1	exon	76188524	76188785	76188524	ID=MsaT004967.1.exon6;Parent=MsaT004967.1
Chr1	CDS	76188524	76188785	76188524	ID=cds.MsaT004967.1;Parent=MsaT004967.1
Chr1	exon	76189036	76189140	76189036	ID=MsaT004967.1.exon5;Parent=MsaT004967.1
Chr1	CDS	76189036	76189140	76189036	ID=cds.MsaT004967.1;Parent=MsaT004967.1
Chr1	exon	76191497	76191575	76191497	ID=MsaT004967.1.exon4;Parent=MsaT004967.1
Chr1	CDS	76191497	76191575	76191497	ID=cds.MsaT004967.1;Parent=MsaT004967.1
Chr1	exon	76191636	76191775	76191636	ID=MsaT004967.1.exon3;Parent=MsaT004967.1
Chr1	CDS	76191636	76191775	76191636	ID=cds.MsaT004967.1;Parent=MsaT004967.1
Chr1	exon	76191906	76192061	76191906	ID=MsaT004967.1.exon2;Parent=MsaT004967.1
Chr1	CDS	76191906	76192061	76191906	ID=cds.MsaT004967.1;Parent=MsaT004967.1
Chr1	exon	76192177	76193670	76192177	ID=MsaT004967.1.exon1;Parent=MsaT004967.1
Chr1	CDS	76192177	76193670	76192177	ID=cds.MsaT004967.1;Parent=MsaT004967.1

Gene Sequence

>MsaT004967.1

ATGAGTGATTCAACCAAACCAGGCTCAAATTTTCTCTCTTCTGATGATTCCATTTCTCTCACAAACAAAAACCCATCTCCAAATATACAAACTTTGTATCACACAGCCAGAGTTTTCATTACCACTGGGAGATACAAGTTCAACATGAAGAAAAATGGTACCCATTTGATTCGTTTTCATTTCTTTCCATTTAAAGATCAAAGTTTTGACTTGAAATCTGCAAAATTTAGTGTCTTGGTTAATGGAATTTCAATTCTAAGTCAATTTAAGCCACCTAATGATGTGATGATTAAAGAGTTTATTTTGAAGATTGAATCAAATTTGCTTGAAATTTTGTTTAGACCCTTTAAATCAGGTTTTGGATATGTAAATGCTGTGGAAGTGTTTACTGCTCCTGAAGATTTTGTTATAGATTATGGAACAAGGTTGGTTGGTCCTTCTGGTGTGGAAGAGTATAGAAATCTTTCATCTCAGGTTTTGGAAACTGTTCATAGGATTAATGTAGGAGGTATGAAAATAACTCCTTTTAATGACACCCTTTGGAGGACTTGGATTCCTGATGAGGATTATTTGGTTTTTAAGGAAGCAGCTAAACATGCAGTAAGCACTCATACACCTGATTACCAGAAGGGAGGTGCTACTCCAGAGATTGCACCTGAAAATGTTTACATGACTGCTCAACAGATGAATAGGGAAAACTCAAGTTTAGCTTCAAGGTTTAACATAACGTGGAATTTTCCTGTGGCTCGTGATGGTGTTTCACATTTGATTCGGTTGCATTTCTGTGATATTGTTAGTACTTCTCTCAATTTGCTTTACTTTGATGTGTATATCAATGGTTACATTGCATATAAGGATCTTGATTTGTCAGCACTTACATTCCACACTCTTGCATCACCGGTCTATGTGGATTTTGTTGCTAATTCAGACGACTCAAGTGTTATTCAAATAAGTGTTGGTCCTTCTGACCTGAGTAGTTCTATTAGGATTAATGCCATACTGAATGGTGCAGAGATAATGAAGATGGTCAACGATGTCGATGATACTAATATTGTGCACGGGAGGAAGCATTTATGGGAGTTGATAGGTTCAATTGTTGGAGGAATCGTCATCGCAATTTTTGTTGTGACTATTTTTCTACTTGCTACCAGATGCAGGAAGAAAAAATCAAAAGAAAGTTCAGTGGAAAGTGTTGGATGGACGCCTTTGCGTATGTTTGGAGGGAGTTCCCTTAGTAGAACATCTGAACACGGTTCTTATGGATATCTTGGAATGAAGATCCCTTTTGCTGAAATACAATCAGCAACAAACAATTTTGATAGAAATTTGATTATAGGCTCTGGTGGATTTGGTATGGTCTACAAAGGAGTACTCAGAGACAATGTAAAAGTTGCTGTCAAGAGAGGTATGCCAGGTTCAAGACAAGGCCTTCCAGAATTCCACACTGAAATAACCATTTTATCAAAAATTCGCCATCGACATCTTGTTTCACTGCAGCGGCTTGAGATATGCATTGGTTCAGCTAGAGGTCTGCACTATCTTCACACCGGTTTTGCTCAAGGAATCATCCACCGCGACATTAAATCGACCCACAGATTGATCGAGGAAGATAATGTAGCCAAGGTTGCTGATTTGGTCTATCGAGATCAGGTTCTTTGTGGCAGACCTGCTGTTGATCCACAACTGACTAGGGAACAGGTGAATTTAGCAGAATGGGCAATTGAGTGGCTGCAGAAGGGAATGCTGGATCATATTGTTGACCCTCATCGTGTTGGAGATATTAAACCAAGACCAACCATGGGTGATGTCTTGTGGAATTTGGAATATGCACTTCAGCTCCAAGAAAGTAATAGCAGTGCTAGTGAAGCAGACTTGACCAATTGTTCGGAGAAGACGAACAACACCGTTGTTCACATCAACAAGATCTTCAAGAATGGTATTGGTCTCGGTGGTATATTCCACGGCGCAGTTCAGGTTTATGGAGATGATGAATGGTCATTTGGATTCTGTGAGGAGGGTACTGGAGTTTTTAGTTGTCCTTCAACGAAGAATGCAAGGTTTACATATCGACAATCGCTTGCTCTAGGGAAAACAAACTACAATATTTTCAAGGTAAATCAAATACTAAGGGAGCTTAGTAAAGAGTGGCCTGGAAATTCTTATGATCTCTTCTCCAAAAACTGCAATCACTTCTGTGATGAATTTTGTGCAAGACTAGGTGTGCCAAAACCTCCAGGTTGGGTTAACAGGTTTGCTAATGTTGGTGATGTTACTATGGAAGTGGCTGGGTGTACGGCATCAAGATTCCGGCAAGCGAAAACAGAGATTGTATCAGCAAGCAAATCAGCATGTCGATTCCTTTTTTGTGTTACAAATAATGTTAAAACTGATATGGATGATTCCCCTAGAGGAGAATTTCCTGGAGTTCAAGCTGTTTGGTTGAAAAAGCCTATCACCAATGGTGTAAAACCGTCTACTTCTAGTAGTTCAGAAGCTGGGACTTCAAGTGAAGTTGAGCCTCAACAATAA

Protein sequence

>MsaT004967.1

MSDSTKPGSNFLSSDDSISLTNKNPSPNIQTLYHTARVFITTGRYKFNMKKNGTHLIRFHFFPFKDQSFDLKSAKFSVLVNGISILSQFKPPNDVMIKEFILKIESNLLEILFRPFKSGFGYVNAVEVFTAPEDFVIDYGTRLVGPSGVEEYRNLSSQVLETVHRINVGGMKITPFNDTLWRTWIPDEDYLVFKEAAKHAVSTHTPDYQKGGATPEIAPENVYMTAQQMNRENSSLASRFNITWNFPVARDGVSHLIRLHFCDIVSTSLNLLYFDVYINGYIAYKDLDLSALTFHTLASPVYVDFVANSDDSSVIQISVGPSDLSSSIRINAILNGAEIMKMVNDVDDTNIVHGRKHLWELIGSIVGGIVIAIFVVTIFLLATRCRKKKSKESSVESVGWTPLRMFGGSSLSRTSEHGSYGYLGMKIPFAEIQSATNNFDRNLIIGSGGFGMVYKGVLRDNVKVAVKRGMPGSRQGLPEFHTEITILSKIRHRHLVSLQRLEICIGSARGLHYLHTGFAQGIIHRDIKSTHRLIEEDNVAKVADLVYRDQVLCGRPAVDPQLTREQVNLAEWAIEWLQKGMLDHIVDPHRVGDIKPRPTMGDVLWNLEYALQLQESNSSASEADLTNCSEKTNNTVVHINKIFKNGIGLGGIFHGAVQVYGDDEWSFGFCEEGTGVFSCPSTKNARFTYRQSLALGKTNYNIFKVNQILRELSKEWPGNSYDLFSKNCNHFCDEFCARLGVPKPPGWVNRFANVGDVTMEVAGCTASRFRQAKTEIVSASKSACRFLFCVTNNVKTDMDDSPRGEFPGVQAVWLKKPITNGVKPSTSSSSEAGTSSEVEPQQ*