AlfalfaGEDB | MsaG006645

M. sativa ssp. caerulea / MsaG006645

KEGG: -
GO: -
PFAM: PF00010.29

Nr:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG006645	XP_013462544.1	94.922	256	13	0	1	256	1	256	5.54e-178	499

Swissprot:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG006645	sp\|Q9LET0\|BH107_ARATH	40.116	172	92	5	62	228	40	205	7.70e-30	114

Trembl:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG006645	tr\|A0A072V5E0\|A0A072V5E0_MEDTR	94.922	256	13	0	1	256	1	256	2.64e-178	499

TFs/TRs:

Gene ID	Type	Classification
MsaG006645	TF	bHLH

Protein Kinases:

Gene ID	Type	Classification

Network:

Co-expression Network

Gene1	Gene2	correlation coefficient	p_value	FDR
MsaG000135	MsaG006645	0.823491	2.378346e-53	5.741934e-51
MsaG000419	MsaG006645	0.838072	6.565809e-57	2.413452e-54
MsaG000435	MsaG006645	0.849161	7.331502e-60	3.861458e-57
MsaG000613	MsaG006645	0.801886	1.222648e-48	1.725190e-46
MsaG003245	MsaG006645	0.814414	2.694510e-51	5.132450e-49
MsaG003422	MsaG006645	0.812748	6.239502e-51	1.139913e-48
MsaG003831	MsaG006645	0.806639	1.265235e-49	1.993439e-47
MsaG004092	MsaG006645	0.859789	6.364798e-63	4.909258e-60
MsaG004112	MsaG006645	0.822012	5.235644e-53	1.214569e-50
MsaG004718	MsaG006645	0.825395	8.518633e-54	2.166242e-51
MsaG004856	MsaG006645	0.802133	1.088259e-48	1.544148e-46
MsaG004887	MsaG006645	0.825654	7.400526e-54	1.895453e-51
MsaG005100	MsaG006645	0.805864	1.839047e-49	2.844844e-47
MsaG005568	MsaG006645	0.804539	3.473220e-49	5.209623e-47
MsaG006141	MsaG006645	0.848197	1.351814e-59	6.891200e-57
MsaG006645	MsaG006766	0.890414	2.217583e-73	6.679602e-70
MsaG006645	MsaG007036	0.814768	2.251621e-51	4.327210e-49
MsaG006645	MsaG007416	0.823431	2.455530e-53	5.918737e-51
MsaG006645	MsaG008298	0.808351	5.504504e-50	9.033504e-48
MsaG006645	MsaG008634	0.821207	8.020053e-53	1.821151e-50
MsaG006645	MsaG009067	0.819446	2.022743e-52	4.384157e-50
MsaG006645	MsaG010357	0.815885	1.274035e-51	2.518654e-49
MsaG006645	MsaG011484	0.802787	7.990642e-49	1.150913e-46
MsaG006645	MsaG011812	0.832257	1.895455e-55	5.855068e-53
MsaG006645	MsaG011917	0.808759	4.506868e-50	7.469759e-48
MsaG006645	MsaG011952	0.807521	8.246708e-50	1.326707e-47
MsaG006645	MsaG016421	0.808008	6.508278e-50	1.059340e-47
MsaG006645	MsaG016772	0.808292	5.663874e-50	9.282179e-48
MsaG006645	MsaG017303	0.838054	6.633119e-57	2.436875e-54
MsaG006645	MsaG017183	0.810918	1.555137e-50	2.715799e-48
MsaG006645	MsaG017483	0.805845	1.855936e-49	2.869686e-47
MsaG006645	MsaG018598	0.808976	4.051831e-50	6.750641e-48
MsaG006645	MsaG018960	0.811008	1.486944e-50	2.602442e-48
MsaG006645	MsaG019183	0.810316	2.095035e-50	3.605410e-48
MsaG006645	MsaG019307	0.808861	4.287451e-50	7.123543e-48
MsaG006645	MsaG019559	0.823552	2.301671e-53	5.566051e-51
MsaG006645	MsaG020834	0.814179	3.034073e-51	5.745222e-49
MsaG006645	MsaG020992	0.810508	1.905184e-50	3.294082e-48
MsaG006645	MsaG021294	0.800772	2.062256e-48	2.837355e-46
MsaG006645	MsaG021395	0.809963	2.494266e-50	4.255622e-48
MsaG006645	MsaG021650	0.817242	6.348533e-52	1.299524e-49
MsaG006645	MsaG021720	0.825816	6.777838e-54	1.743902e-51
MsaG006645	MsaG022325	0.803789	4.966184e-49	7.320581e-47
MsaG006645	MsaG022750	0.829802	7.539738e-55	2.169708e-52
MsaG006645	MsaG022993	0.820896	9.446919e-53	2.127581e-50
MsaG006645	MsaG023615	0.811124	1.403609e-50	2.463605e-48
MsaG006645	MsaG023796	0.808721	4.591693e-50	7.603565e-48
MsaG006645	MsaG023960	0.811168	1.373088e-50	2.412709e-48
MsaG006645	MsaG024958	0.833659	8.523706e-56	2.743461e-53
MsaG006645	MsaG026829	0.808830	4.353350e-50	7.227537e-48
MsaG006645	MsaG027557	0.830083	6.445644e-55	1.869897e-52
MsaG006645	MsaG027715	0.818351	3.577288e-52	7.534480e-50
MsaG006645	MsaG027950	0.805502	2.189132e-49	3.357700e-47
MsaG006645	MsaG028324	0.804928	2.882790e-49	4.363216e-47
MsaG006645	MsaG028661	0.815906	1.260787e-51	2.493763e-49
MsaG006645	MsaG028825	0.803979	4.537033e-49	6.717472e-47
MsaG006645	MsaG028844	0.800414	2.436790e-48	3.325726e-46
MsaG006645	MsaG029063	0.808220	5.866086e-50	9.596936e-48
MsaG006645	MsaG029307	0.807910	6.825460e-50	1.108385e-47
MsaG006645	MsaG029919	0.833098	1.174645e-55	3.718942e-53
MsaG006645	MsaG030038	0.812684	6.443970e-51	1.175389e-48
MsaG006645	MsaG031201	0.800927	1.917812e-48	2.647763e-46
MsaG006645	MsaG033818	0.811341	1.260073e-50	2.223506e-48
MsaG006645	MsaG039781	0.805174	2.562156e-49	3.900256e-47
MsaG006645	MsaG041985	0.806264	1.516637e-49	2.368505e-47
MsaG006645	MsaG044107	0.803533	5.610313e-49	8.221275e-47
MsaG006645	MsaG044516	0.849623	5.455896e-60	2.919642e-57
MsaG006645	MsaG045820	0.818590	3.159629e-52	6.696289e-50
MsaG006645	MsaG046028	0.802245	1.032425e-48	1.468677e-46
MsaG006645	MsaG046167	0.802841	7.787551e-49	1.123050e-46
MsaG006645	MsaG046780	0.804744	3.149652e-49	4.746758e-47
MsaG006645	MsaG009209	0.811897	9.550051e-51	1.708360e-48
MsaG006645	MsaG014391	0.807520	8.252909e-50	1.327660e-47
MsaG006645	MsaG014164	0.839580	2.685618e-57	1.034645e-54
MsaG006645	MsaG013859	0.802177	1.065842e-48	1.513882e-46
MsaG006645	MsaG013041	0.826699	4.188566e-54	1.104455e-51
MsaG006645	MsaG028071	0.805413	2.284910e-49	3.497398e-47
MsaG006645	MsaG032683	0.802051	1.131336e-48	1.602279e-46
MsaG006645	MsaG038591	0.801821	1.260170e-48	1.775506e-46
MsaG006645	MsaG037725	0.809545	3.064050e-50	5.175493e-48
MsaG006645	MsaG047025	0.856483	6.061294e-62	4.133069e-59

PPI

Gene1	Gene2	Type

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG006645	MtrunA17_Chr4g0045901	55.932	236	99	3	3	233	10	245	1.68e-71	220
MsaG006645	MtrunA17_Chr2g0283714	70.253	158	7	1	99	256	16	133	4.20e-70	211
MsaG006645	MtrunA17_Chr4g0041051	47.727	220	109	4	19	234	21	238	8.49e-54	174
MsaG006645	MtrunA17_Chr2g0325521	49.268	205	98	3	29	229	23	225	9.34e-53	171
MsaG006645	MtrunA17_Chr7g0255961	36.957	184	107	3	62	241	70	248	1.16e-30	114
MsaG006645	MtrunA17_Chr3g0113721	39.080	174	87	4	67	227	39	206	9.15e-29	108
MsaG006645	MtrunA17_Chr1g0198801	48.201	139	65	1	63	194	154	292	2.18e-28	110
MsaG006645	MtrunA17_Chr5g0412371	37.857	140	80	2	56	189	34	172	5.27e-23	93.2
MsaG006645	MtrunA17_Chr5g0427361	32.883	222	118	4	63	254	33	253	2.16e-17	79.0

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG006645	AT3G56770.1	40.116	172	92	5	62	228	40	205	7.83e-31	114
MsaG006645	AT2G40200.1	38.889	162	91	2	69	224	65	224	3.48e-30	113
MsaG006645	AT1G68810.1	43.605	172	91	4	56	223	164	333	1.93e-28	111
MsaG006645	AT2G41130.1	34.529	223	130	5	17	228	11	228	5.06e-27	105
MsaG006645	AT3G25710.1	44.118	136	73	2	56	189	122	256	1.68e-24	100
MsaG006645	AT4G38070.1	34.959	123	76	2	66	188	91	209	4.26e-17	78.6

Find 45 sgRNAs with CRISPR-Local

Find sgRNAs with CRISPR-GE

CRISPR-Local

CRISPR-Local
sgRNA_sequence	on_target_score	Position	Region
ATTGAACAATGTCAACTTAT+TGG	0.161618	2:-8008963	MsaT006645.1:CDS
CTTTACTAGCTGAGGTTATT+AGG	0.226217	2:-8009262	MsaT006645.1:CDS
ATCAACAAACTCATTGGTTT+TGG	0.255474	2:-8010922	MsaT006645.1:CDS
CTTAGATCAGTTAGAAGTTC+TGG	0.280659	2:+8009098	None:intergenic
AAGTCCCCTCCAATAATTAA+TGG	0.304566	2:-8010876	MsaT006645.1:CDS
TAGTAGCTCTGAAGAATCAT+AGG	0.328548	2:-8010821	MsaT006645.1:CDS
AATGCCACTTCATATAGATT+TGG	0.335342	2:-8010978	MsaT006645.1:CDS
AAGAGAAGAAACAGAATTAA+TGG	0.350077	2:-8010786	MsaT006645.1:CDS
TGATAAACTTCAACTACAAT+TGG	0.375139	2:-8009066	MsaT006645.1:CDS
CCAGTACAGAACTCAGTTCC+TGG	0.377817	2:+8008928	None:intergenic
AAAGTTGAACCATGTGAAAA+TGG	0.387199	2:-8009164	MsaT006645.1:CDS
AAGGGAAGAAATATCAACTT+TGG	0.396844	2:-8009042	MsaT006645.1:CDS
AAATATCAACTTTGGGAGAC+AGG	0.404598	2:-8009034	MsaT006645.1:CDS
TTCACTTCATCATCATCTGT+TGG	0.414183	2:+8009185	None:intergenic
GTTTGTATCAACAAACTCAT+TGG	0.426459	2:-8010928	MsaT006645.1:CDS
TTCTCTCCATTAATTATTGG+AGG	0.433494	2:+8010870	None:intergenic
AGGGAAGAAATATCAACTTT+GGG	0.445016	2:-8009041	MsaT006645.1:CDS
AACTTCAACTACAATTGGTA+AGG	0.473092	2:-8009061	MsaT006645.1:CDS
CCAGGAACTGAGTTCTGTAC+TGG	0.489161	2:-8008928	MsaT006645.1:CDS
ACTGAGTTCTGTACTGGAAA+GGG	0.489265	2:-8008922	MsaT006645.1:CDS
CTCTCCATTAATTATTGGAG+GGG	0.498785	2:+8010872	None:intergenic
TATTATACCTTTGGAGAGGA+GGG	0.509382	2:+8010735	None:intergenic
ATTATAGCTCTGATATTTCG+AGG	0.509996	2:-8011010	MsaT006645.1:CDS
CAAATGAGACTTCAAGAGGT+GGG	0.540083	2:-8010950	MsaT006645.1:CDS
TCTCTCCATTAATTATTGGA+GGG	0.544195	2:+8010871	None:intergenic
TTATTATACCTTTGGAGAGG+AGG	0.544800	2:+8010734	None:intergenic
AACTGAGTTCTGTACTGGAA+AGG	0.553572	2:-8008923	MsaT006645.1:CDS
AGTAGCTCTGAAGAATCATA+GGG	0.557776	2:-8010820	MsaT006645.1:CDS
CAAAGCAACTTTACTAGCTG+AGG	0.560860	2:-8009270	MsaT006645.1:CDS
AATGCAGATGAAGCAAGTAA+AGG	0.565648	2:-8009218	MsaT006645.1:CDS
ACTTGTTCCCTCCTCTCCAA+AGG	0.568287	2:-8010742	MsaT006645.1:intron
GGAAAGGGTTTCTACCTCGA+TGG	0.569167	2:-8008907	MsaT006645.1:CDS
AGCACCAAATCTATATGAAG+TGG	0.573695	2:+8010974	None:intergenic
AATATCAACTTTGGGAGACA+GGG	0.583527	2:-8009033	MsaT006645.1:CDS
TATTGGAAATAATGTTCACC+AGG	0.592874	2:-8008946	MsaT006645.1:CDS
TCAAATGAGACTTCAAGAGG+TGG	0.607431	2:-8010951	MsaT006645.1:CDS
AGATTATTATACCTTTGGAG+AGG	0.615783	2:+8010731	None:intergenic
ACTTCAACTACAATTGGTAA+GGG	0.620942	2:-8009060	MsaT006645.1:CDS
ATCAACAAGAGCAAAACTCA+TGG	0.629280	2:+8008820	None:intergenic
GTTGAACCATGTGAAAATGG+TGG	0.637388	2:-8009161	MsaT006645.1:CDS
TGCATCTGTTTGCAAAGACG+TGG	0.639661	2:+8008867	None:intergenic
GAGAGGAGGGAACAAGTGCA+CGG	0.657365	2:+8010748	None:intergenic
GCTTCAAATGAGACTTCAAG+AGG	0.660687	2:-8010954	MsaT006645.1:CDS
AGAATCATAGGGAAGCAGAG+AGG	0.725124	2:-8010809	MsaT006645.1:CDS
TCTTAACGAGTAATCCATCG+AGG	0.765808	2:+8008893	None:intergenic

CRISPR-GE

badsite warning	sgRNA_sequence	Strand	Position	Region	GC_content

Chromosome	Type	Strat	End	Strand	Name
Chr2	gene	8008821	8011036	8008821	ID=MsaG006645
Chr2	mRNA	8008821	8011036	8008821	ID=MsaT006645.1;Parent=MsaG006645
Chr2	exon	8008821	8009297	8008821	ID=MsaT006645.1.exon2;Parent=MsaT006645.1
Chr2	CDS	8008821	8009297	8008821	ID=cds.MsaT006645.1;Parent=MsaT006645.1
Chr2	exon	8010743	8011036	8010743	ID=MsaT006645.1.exon1;Parent=MsaT006645.1
Chr2	CDS	8010743	8011036	8010743	ID=cds.MsaT006645.1;Parent=MsaT006645.1

Gene Sequence

>MsaT006645.1

ATGGATTATAGCTCTGATATTTCGAGGATACTATTCAATGCCACTTCATATAGATTTGGTGCTTCAAATGAGACTTCAAGAGGTGGGTTTGTATCAACAAACTCATTGGTTTTGGATAGTGAGAAAGGAGAACTAGTGAAGTCCCCTCCAATAATTAATGGAGAGAAAAAGATTTGTGATGCTAACAAAACTTTAGTAGCTCTGAAGAATCATAGGGAAGCAGAGAGGAAGAGAAGAAACAGAATTAATGGTCATCTTGCTAAACTCCGTGCACTTGTTCCCTCCTCTCCAAAGATGGACAAAGCAACTTTACTAGCTGAGGTTATTAGGCAAGTGAAGCATTTGAAAAAAAATGCAGATGAAGCAAGTAAAGGTTATTCAATTCCAACAGATGATGATGAAGTGAAAGTTGAACCATGTGAAAATGGTGGATCATTTCTTTACAAAGCATCTATCAGCTGCGATTATCGACCAGAACTTCTAACTGATCTAAGACAAACTCTTGATAAACTTCAACTACAATTGGTAAGGGAAGAAATATCAACTTTGGGAGACAGGGTTAAGAATGAATTTGTCTACACATGTTGTAATGTAGACATTTATGATATTGAACAATGTCAACTTATTGGAAATAATGTTCACCAGGAACTGAGTTCTGTACTGGAAAGGGTTTCTACCTCGATGGATTACTCGTTAAGAGCACCACGTCTTTGCAAACAGATGCAGCAGACATCTACTTTGTCATGCAACCATGAGTTTTGCTCTTGTTGA

Protein sequence

>MsaT006645.1

MDYSSDISRILFNATSYRFGASNETSRGGFVSTNSLVLDSEKGELVKSPPIINGEKKICDANKTLVALKNHREAERKRRNRINGHLAKLRALVPSSPKMDKATLLAEVIRQVKHLKKNADEASKGYSIPTDDDEVKVEPCENGGSFLYKASISCDYRPELLTDLRQTLDKLQLQLVREEISTLGDRVKNEFVYTCCNVDIYDIEQCQLIGNNVHQELSSVLERVSTSMDYSLRAPRLCKQMQQTSTLSCNHEFCSC*