AlfalfaGEDB | MsaG006743

M. sativa ssp. caerulea / MsaG006743

KEGG: -
GO: GO:0003674 GO:0003824 GO:0004672 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0007154 GO:0007165 GO:0008150 GO:0008152 GO:0009987 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0023052 GO:0035556 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044464 GO:0050789 GO:0050794 GO:0050896 GO:0051716 GO:0065007 GO:0071704 GO:0140096 GO:1901564
PFAM: PF12796.10

Nr:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG006743	XP_013462623.1	98.249	457	8	0	1	457	1	457	0.0	936

Swissprot:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG006743	sp\|F4IS56\|ILK1_ARATH	47.319	429	212	4	8	422	43	471	2.81e-131	390

Trembl:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG006743	tr\|A0A072VEQ0\|A0A072VEQ0_MEDTR	98.249	457	8	0	1	457	1	457	0.0	936

TFs/TRs:

Gene ID	Type	Classification

Protein Kinases:

Gene ID	Type	Classification

Network:

Co-expression Network

Gene1	Gene2	correlation coefficient	p_value	FDR
MsaG000005	MsaG006743	0.842904	3.622884e-58	1.550881e-55
MsaG000081	MsaG006743	0.880357	1.240223e-69	2.276052e-66
MsaG000234	MsaG006743	0.898878	7.882255e-77	3.775949e-73
MsaG000364	MsaG006743	0.903014	1.252650e-78	7.661356e-75
MsaG000379	MsaG006743	0.910833	2.921263e-82	2.915322e-78
MsaG000479	MsaG006743	0.815010	1.990380e-51	3.848651e-49
MsaG000520	MsaG006743	0.936153	7.797195e-97	5.284427e-92
MsaG000583	MsaG006743	0.802730	8.209070e-49	1.180837e-46
MsaG000999	MsaG006743	0.823074	2.973350e-53	7.097997e-51
MsaG001246	MsaG006743	0.847095	2.709573e-59	1.331024e-56
MsaG001281	MsaG006743	0.844078	1.765746e-58	7.849405e-56
MsaG001283	MsaG006743	0.874616	1.214442e-67	1.717540e-64
MsaG001828	MsaG006743	0.866701	4.725327e-65	4.781156e-62
MsaG001875	MsaG006743	0.882684	1.807753e-70	3.702619e-67
MsaG001936	MsaG006743	0.815656	1.431996e-51	2.814607e-49
MsaG002061	MsaG006743	0.816133	1.122628e-51	2.233382e-49
MsaG002065	MsaG006743	0.818091	4.094303e-52	8.565785e-50
MsaG002209	MsaG006743	0.848890	8.709967e-60	4.545503e-57
MsaG002405	MsaG006743	0.886913	4.902835e-72	1.234422e-68
MsaG002484	MsaG006743	0.872291	7.295321e-67	9.321714e-64
MsaG002530	MsaG006743	0.807718	7.495038e-50	1.211483e-47
MsaG002717	MsaG006743	0.858182	1.917523e-62	1.392033e-59
MsaG002731	MsaG006743	0.925361	5.385560e-90	1.520304e-85
MsaG002975	MsaG006743	0.810729	1.707696e-50	2.968517e-48
MsaG003089	MsaG006743	0.889657	4.370357e-73	1.265456e-69
MsaG003155	MsaG006743	0.811774	1.015770e-50	1.811514e-48
MsaG003252	MsaG006743	0.893315	1.572110e-74	5.525006e-71
MsaG003292	MsaG006743	0.884301	4.627493e-71	1.024553e-67
MsaG003299	MsaG006743	0.832688	1.483761e-55	4.641093e-53
MsaG003305	MsaG006743	0.838802	4.265211e-57	1.603820e-54
MsaG003460	MsaG006743	0.836700	1.468429e-56	5.176394e-54
MsaG003435	MsaG006743	0.806080	1.657210e-49	2.576664e-47
MsaG003510	MsaG006743	0.814210	2.987198e-51	5.660888e-49
MsaG003743	MsaG006743	0.901199	7.885432e-78	4.329019e-74
MsaG003740	MsaG006743	0.830386	5.439158e-55	1.591664e-52
MsaG003750	MsaG006743	0.901161	8.198528e-78	4.490598e-74
MsaG003769	MsaG006743	0.934841	6.094212e-96	3.695162e-91
MsaG003986	MsaG006743	0.865983	7.965893e-65	7.827650e-62
MsaG004004	MsaG006743	0.943510	3.197312e-102	4.132718e-97
MsaG003896	MsaG006743	0.875025	8.828042e-68	1.270843e-64
MsaG003930	MsaG006743	0.814022	3.285896e-51	6.197437e-49
MsaG003934	MsaG006743	0.883257	1.117505e-70	2.352538e-67
MsaG003938	MsaG006743	0.947249	3.037216e-105	5.426918e-100
MsaG003976	MsaG006743	0.804647	3.297821e-49	4.958910e-47
MsaG004111	MsaG006743	0.801720	1.321702e-48	1.857884e-46
MsaG004227	MsaG006743	0.947135	3.780841e-105	6.679448e-100
MsaG004186	MsaG006743	0.878032	8.160468e-69	1.345013e-65
MsaG004199	MsaG006743	0.857785	2.512230e-62	1.797229e-59
MsaG004306	MsaG006743	0.878361	6.265454e-69	1.048391e-65
MsaG004367	MsaG006743	0.890159	2.788494e-73	8.286250e-70
MsaG004418	MsaG006743	0.875066	8.554401e-68	1.233699e-64
MsaG004465	MsaG006743	0.899005	6.954619e-77	3.357158e-73
MsaG004466	MsaG006743	0.800316	2.551720e-48	3.474718e-46
MsaG004510	MsaG006743	0.817532	5.466507e-52	1.127303e-49
MsaG004686	MsaG006743	0.849943	4.446982e-60	2.405478e-57
MsaG004782	MsaG006743	0.842020	6.200068e-58	2.580053e-55
MsaG004805	MsaG006743	0.801645	1.369378e-48	1.921619e-46
MsaG005023	MsaG006743	0.862855	7.476231e-64	6.487764e-61
MsaG005282	MsaG006743	0.816499	9.302902e-52	1.868123e-49
MsaG005288	MsaG006743	0.823222	2.747052e-53	6.583903e-51
MsaG005348	MsaG006743	0.869681	5.240243e-66	5.992236e-63
MsaG005351	MsaG006743	0.899741	3.372191e-77	1.699174e-73
MsaG005403	MsaG006743	0.876445	2.890951e-68	4.434330e-65
MsaG005455	MsaG006743	0.822500	4.038255e-53	9.491647e-51
MsaG005524	MsaG006743	0.818189	3.890494e-52	8.160178e-50
MsaG005559	MsaG006743	0.857056	4.118446e-62	2.867259e-59
MsaG005574	MsaG006743	0.823541	2.315182e-53	5.597168e-51
MsaG005598	MsaG006743	0.855191	1.439486e-61	9.363732e-59
MsaG005664	MsaG006743	0.832006	2.184079e-55	6.698300e-53
MsaG006027	MsaG006743	0.821061	8.660112e-53	1.958966e-50
MsaG005928	MsaG006743	0.852499	8.503203e-61	5.026336e-58
MsaG005942	MsaG006743	0.809448	3.213835e-50	5.415917e-48
MsaG005961	MsaG006743	0.813632	4.000280e-51	7.471575e-49
MsaG006053	MsaG006743	0.821937	5.448427e-53	1.261384e-50
MsaG006293	MsaG006743	0.816267	1.047743e-51	2.091581e-49
MsaG006357	MsaG006743	0.907216	1.534932e-80	1.213050e-76
MsaG006425	MsaG006743	0.924318	2.172469e-89	5.645906e-85
MsaG006526	MsaG006743	0.889485	5.093657e-73	1.461612e-69
MsaG006586	MsaG006743	0.901334	6.891397e-78	3.813204e-74
MsaG006549	MsaG006743	0.869064	8.300714e-66	9.250469e-63
MsaG006552	MsaG006743	0.848474	1.134185e-59	5.835152e-57
MsaG006640	MsaG006743	0.826400	4.931978e-54	1.289694e-51
MsaG006701	MsaG006743	0.846676	3.522403e-59	1.706208e-56
MsaG006743	MsaG006813	0.848539	1.088381e-59	5.612058e-57
MsaG006743	MsaG006909	0.803827	4.877159e-49	7.195666e-47
MsaG006743	MsaG006910	0.936120	8.222032e-97	5.553133e-92
MsaG006743	MsaG006937	0.848706	9.790587e-60	5.077255e-57
MsaG006743	MsaG007015	0.862528	9.415710e-64	8.067221e-61
MsaG006743	MsaG007094	0.812074	8.743852e-51	1.570873e-48
MsaG006743	MsaG007317	0.874345	1.499995e-67	2.096331e-64
MsaG006743	MsaG007525	0.802521	9.062964e-49	1.297478e-46
MsaG006743	MsaG007585	0.855048	1.583860e-61	1.024971e-58
MsaG006743	MsaG007686	0.874376	1.464181e-67	2.049098e-64
MsaG006743	MsaG007663	0.823581	2.265766e-53	5.483723e-51
MsaG006743	MsaG007665	0.926567	1.045831e-90	3.240469e-86
MsaG006743	MsaG007753	0.871277	1.578226e-66	1.930641e-63
MsaG006743	MsaG007759	0.938382	2.140255e-98	1.743689e-93
MsaG006743	MsaG008019	0.834056	6.787989e-56	2.210417e-53
MsaG006743	MsaG008080	0.820055	1.470561e-52	3.239061e-50
MsaG006743	MsaG008148	0.851090	2.125147e-60	1.195868e-57
MsaG006743	MsaG008168	0.907517	1.110235e-80	8.950456e-77
MsaG006743	MsaG008345	0.803441	5.860218e-49	8.569156e-47
MsaG006743	MsaG008998	0.816974	7.289464e-52	1.481809e-49
MsaG006743	MsaG009172	0.885896	1.183249e-71	2.832368e-68
MsaG006743	MsaG009256	0.851434	1.700987e-60	9.686283e-58
MsaG006743	MsaG009372	0.919734	7.936928e-87	1.465781e-82
MsaG006743	MsaG009495	0.810439	1.971219e-50	3.402656e-48
MsaG006743	MsaG009891	0.826043	5.991046e-54	1.551248e-51
MsaG006743	MsaG009864	0.849482	5.971297e-60	3.179942e-57
MsaG006743	MsaG009880	0.889780	3.914558e-73	1.140613e-69
MsaG006743	MsaG010004	0.810438	1.972466e-50	3.404703e-48
MsaG006743	MsaG010377	0.824091	1.723633e-53	4.229603e-51
MsaG006743	MsaG010418	0.915607	1.200695e-84	1.651148e-80
MsaG006743	MsaG010445	0.831320	3.219360e-55	9.676453e-53
MsaG006743	MsaG010631	0.882871	1.545620e-70	3.194634e-67
MsaG006743	MsaG010597	0.805331	2.376802e-49	3.631155e-47
MsaG006743	MsaG010617	0.802000	1.158625e-48	1.639025e-46
MsaG006743	MsaG010621	0.937648	7.102656e-98	5.461054e-93
MsaG006743	MsaG010622	0.882277	2.538799e-70	5.097684e-67
MsaG006743	MsaG010702	0.813981	3.353412e-51	6.318552e-49
MsaG006743	MsaG010703	0.859054	1.055678e-62	7.918727e-60
MsaG006743	MsaG010796	0.803772	5.008206e-49	7.379541e-47
MsaG006743	MsaG010994	0.856169	7.483993e-62	5.044693e-59
MsaG006743	MsaG011133	0.915380	1.569721e-84	2.124077e-80
MsaG006743	MsaG011230	0.821598	6.520270e-53	1.495988e-50
MsaG006743	MsaG011428	0.801831	1.254560e-48	1.767994e-46
MsaG006743	MsaG011587	0.903387	8.545473e-79	5.343441e-75
MsaG006743	MsaG011601	0.841031	1.126487e-57	4.542565e-55
MsaG006743	MsaG011657	0.897912	2.018996e-76	9.154362e-73
MsaG006743	MsaG011650	0.808113	6.181362e-50	1.008678e-47
MsaG006743	MsaG011702	0.840860	1.248548e-57	5.007345e-55
MsaG006743	MsaG011749	0.912383	5.079425e-83	5.609093e-79
MsaG006743	MsaG011918	0.859556	7.474641e-63	5.713959e-60
MsaG006743	MsaG012301	0.855901	8.955456e-62	5.977240e-59
MsaG006743	MsaG012438	0.907091	1.755189e-80	1.375598e-76
MsaG006743	MsaG012440	0.859942	5.727989e-63	4.443449e-60
MsaG006743	MsaG012443	0.897593	2.750466e-76	1.225310e-72
MsaG006743	MsaG012458	0.874535	1.293615e-67	1.823069e-64
MsaG006743	MsaG012461	0.903579	7.018157e-79	4.439138e-75
MsaG006743	MsaG012521	0.874052	1.883219e-67	2.597973e-64
MsaG006743	MsaG012595	0.801329	1.587985e-48	2.212506e-46
MsaG006743	MsaG012657	0.836557	1.596910e-56	5.604790e-54
MsaG006743	MsaG012747	0.900419	1.720636e-77	9.025226e-74
MsaG006743	MsaG012774	0.890536	1.986388e-73	6.021016e-70
MsaG006743	MsaG012765	0.822914	3.238418e-53	7.697271e-51
MsaG006743	MsaG012982	0.887784	2.292040e-72	6.028863e-69
MsaG006743	MsaG013177	0.846403	4.178936e-59	2.005876e-56
MsaG006743	MsaG013426	0.857134	3.907190e-62	2.728076e-59
MsaG006743	MsaG013708	0.897046	4.660141e-76	2.011447e-72
MsaG006743	MsaG013895	0.924516	1.668278e-89	4.404458e-85
MsaG006743	MsaG014043	0.840498	1.551168e-57	6.150862e-55
MsaG006743	MsaG014300	0.841659	7.712849e-58	3.172729e-55
MsaG006743	MsaG014560	0.893061	1.988270e-74	6.894710e-71
MsaG006743	MsaG014726	0.854767	1.909313e-61	1.223216e-58
MsaG006743	MsaG014841	0.841237	9.951142e-58	4.039120e-55
MsaG006743	MsaG014945	0.877881	9.213058e-69	1.508058e-65
MsaG006743	MsaG015088	0.884178	5.136933e-71	1.130598e-67
MsaG006743	MsaG015096	0.887116	4.110432e-72	1.045117e-68
MsaG006743	MsaG015113	0.826230	5.409021e-54	1.407779e-51
MsaG006743	MsaG015291	0.822190	4.761880e-53	1.109936e-50
MsaG006743	MsaG015329	0.898156	1.593134e-76	7.322215e-73
MsaG006743	MsaG015347	0.866795	4.412603e-65	4.481750e-62
MsaG006743	MsaG015349	0.820841	9.728856e-53	2.187722e-50
MsaG006743	MsaG015353	0.834448	5.421282e-56	1.786228e-53
MsaG006743	MsaG015358	0.897641	2.625995e-76	1.172928e-72
MsaG006743	MsaG015397	0.844977	1.014436e-58	4.645531e-56
MsaG006743	MsaG015701	0.810413	1.996296e-50	3.443768e-48
MsaG006743	MsaG015939	0.822793	3.454002e-53	8.183271e-51
MsaG006743	MsaG016387	0.905396	1.059007e-79	7.474669e-76
MsaG006743	MsaG016390	0.802943	7.422878e-49	1.072988e-46
MsaG006743	MsaG016460	0.869330	6.807010e-66	7.669828e-63
MsaG006743	MsaG016474	0.843784	2.114882e-58	9.312271e-56
MsaG006743	MsaG016498	0.804352	3.797251e-49	5.671189e-47
MsaG006743	MsaG016682	0.850283	3.573812e-60	1.955604e-57
MsaG006743	MsaG016688	0.879316	2.896473e-69	5.065604e-66
MsaG006743	MsaG016707	0.817352	5.999083e-52	1.231421e-49
MsaG006743	MsaG016827	0.898199	1.529131e-76	7.045358e-73
MsaG006743	MsaG016906	0.888001	1.894184e-72	5.038109e-69
MsaG006743	MsaG016972	0.917842	8.182654e-86	1.318773e-81
MsaG006743	MsaG017085	0.938172	3.021041e-98	2.419277e-93
MsaG006743	MsaG017107	0.918111	5.891321e-86	9.680346e-82
MsaG006743	MsaG017147	0.837974	6.955297e-57	2.548938e-54
MsaG006743	MsaG017181	0.843575	2.404696e-58	1.051770e-55
MsaG006743	MsaG017261	0.833652	8.559921e-56	2.754471e-53
MsaG006743	MsaG017380	0.905139	1.386743e-79	9.638403e-76
MsaG006743	MsaG017418	0.900221	2.095109e-77	1.086098e-73
MsaG006743	MsaG017571	0.875344	6.879160e-68	1.004298e-64
MsaG006743	MsaG017658	0.812978	5.558050e-51	1.021267e-48
MsaG006743	MsaG017671	0.811659	1.075330e-50	1.912377e-48
MsaG006743	MsaG017710	0.806643	1.262840e-49	1.989834e-47
MsaG006743	MsaG017724	0.843055	3.303327e-58	1.420941e-55
MsaG006743	MsaG017802	0.894864	3.707726e-75	1.417415e-71
MsaG006743	MsaG017905	0.814292	2.865167e-51	5.440976e-49
MsaG006743	MsaG017958	0.800954	1.893223e-48	2.615448e-46
MsaG006743	MsaG018062	0.856840	4.762889e-62	3.290334e-59
MsaG006743	MsaG018063	0.868725	1.067586e-65	1.173127e-62
MsaG006743	MsaG018097	0.928157	1.156644e-91	4.078507e-87
MsaG006743	MsaG018234	0.879494	2.506753e-69	4.420484e-66
MsaG006743	MsaG018226	0.823367	2.541918e-53	6.116465e-51
MsaG006743	MsaG018305	0.911697	1.106120e-82	1.167635e-78
MsaG006743	MsaG018340	0.843498	2.520083e-58	1.099596e-55
MsaG006743	MsaG018384	0.848082	1.454160e-59	7.384647e-57
MsaG006743	MsaG018468	0.813119	5.177920e-51	9.547784e-49
MsaG006743	MsaG018427	0.884853	2.891478e-71	6.574845e-68
MsaG006743	MsaG018504	0.865982	7.973690e-65	7.834832e-62
MsaG006743	MsaG018642	0.840883	1.231545e-57	4.942701e-55
MsaG006743	MsaG018726	0.928854	4.330373e-92	1.608223e-87
MsaG006743	MsaG018806	0.910722	3.308958e-82	3.279354e-78
MsaG006743	MsaG018847	0.882053	3.059892e-70	6.079976e-67
MsaG006743	MsaG018860	0.843393	2.688163e-58	1.168901e-55
MsaG006743	MsaG018863	0.884216	4.974710e-71	1.096896e-67
MsaG006743	MsaG018919	0.896464	8.140612e-76	3.400309e-72
MsaG006743	MsaG018920	0.883559	8.671388e-71	1.852559e-67
MsaG006743	MsaG018922	0.884000	5.974698e-71	1.303715e-67
MsaG006743	MsaG019031	0.924037	3.151327e-89	8.009758e-85
MsaG006743	MsaG019034	0.839931	2.178847e-57	8.487263e-55
MsaG006743	MsaG019019	0.803343	6.139213e-49	8.956769e-47
MsaG006743	MsaG019214	0.939727	2.290321e-99	2.090896e-94
MsaG006743	MsaG019268	0.805918	1.792172e-49	2.775814e-47
MsaG006743	MsaG019290	0.813880	3.529965e-51	6.634429e-49
MsaG006743	MsaG019292	0.836201	1.965417e-56	6.824755e-54
MsaG006743	MsaG019300	0.841996	6.291917e-58	2.616271e-55
MsaG006743	MsaG019318	0.813378	4.545551e-51	8.436186e-49
MsaG006743	MsaG019453	0.873657	2.555941e-67	3.465359e-64
MsaG006743	MsaG019456	0.912450	4.703706e-83	5.214872e-79
MsaG006743	MsaG019501	0.852685	7.531948e-61	4.481585e-58
MsaG006743	MsaG019492	0.869266	7.142229e-66	8.025962e-63
MsaG006743	MsaG019621	0.868162	1.618530e-65	1.738031e-62
MsaG006743	MsaG019623	0.866930	3.997623e-65	4.083173e-62
MsaG006743	MsaG019629	0.897272	3.750043e-76	1.640305e-72
MsaG006743	MsaG019740	0.815221	1.788170e-51	3.476086e-49
MsaG006743	MsaG019937	0.806453	1.384228e-49	2.171418e-47
MsaG006743	MsaG019939	0.812070	8.760610e-51	1.573735e-48
MsaG006743	MsaG019945	0.824453	1.417837e-53	3.513792e-51
MsaG006743	MsaG020016	0.853737	3.774738e-61	2.331136e-58
MsaG006743	MsaG020017	0.857058	4.113115e-62	2.863731e-59
MsaG006743	MsaG020075	0.826490	4.695282e-54	1.230916e-51
MsaG006743	MsaG020135	0.877254	1.520883e-68	2.419284e-65
MsaG006743	MsaG020148	0.802441	9.408568e-49	1.344512e-46
MsaG006743	MsaG020312	0.928091	1.267167e-91	4.442232e-87
MsaG006743	MsaG020365	0.918144	5.658514e-86	9.317599e-82
MsaG006743	MsaG020370	0.889445	5.277448e-73	1.511257e-69
MsaG006743	MsaG020405	0.816354	1.002089e-51	2.004878e-49
MsaG006743	MsaG020529	0.805238	2.484853e-49	3.788116e-47
MsaG006743	MsaG020558	0.874747	1.096636e-67	1.559693e-64
MsaG006743	MsaG020561	0.803398	5.981185e-49	8.737370e-47
MsaG006743	MsaG020578	0.927740	2.069695e-91	7.056639e-87
MsaG006743	MsaG020567	0.832534	1.619234e-55	5.042367e-53
MsaG006743	MsaG020593	0.811348	1.255462e-50	2.215764e-48
MsaG006743	MsaG020670	0.936047	9.223690e-97	6.185648e-92
MsaG006743	MsaG020667	0.852296	9.710741e-61	5.700275e-58
MsaG006743	MsaG020679	0.837461	9.404105e-57	3.392727e-54
MsaG006743	MsaG020725	0.831018	3.815599e-55	1.136925e-52
MsaG006743	MsaG020780	0.854928	1.714788e-61	1.104951e-58
MsaG006743	MsaG021001	0.872641	5.584812e-67	7.243853e-64
MsaG006743	MsaG021077	0.890133	2.854780e-73	8.471613e-70
MsaG006743	MsaG021079	0.892815	2.493077e-74	8.531773e-71
MsaG006743	MsaG021083	0.806585	1.298510e-49	2.043287e-47
MsaG006743	MsaG021095	0.802335	9.893079e-49	1.410324e-46
MsaG006743	MsaG022009	0.837464	9.387554e-57	3.387055e-54
MsaG006743	MsaG022192	0.807766	7.319943e-50	1.184549e-47
MsaG006743	MsaG022216	0.826292	5.229545e-54	1.363411e-51
MsaG006743	MsaG022472	0.813031	5.413701e-51	9.960652e-49
MsaG006743	MsaG022478	0.856842	4.756734e-62	3.286318e-59
MsaG006743	MsaG022584	0.821832	5.759290e-53	1.329632e-50
MsaG006743	MsaG022820	0.818587	3.165320e-52	6.707800e-50
MsaG006743	MsaG022824	0.839951	2.151803e-57	8.387514e-55
MsaG006743	MsaG023177	0.837249	1.065336e-56	3.818195e-54
MsaG006743	MsaG023265	0.894461	5.408864e-75	2.023325e-71
MsaG006743	MsaG023269	0.879095	3.465422e-69	5.999084e-66
MsaG006743	MsaG023336	0.810931	1.544548e-50	2.698230e-48
MsaG006743	MsaG023399	0.811953	9.287376e-51	1.663690e-48
MsaG006743	MsaG023378	0.801972	1.173730e-48	1.659379e-46
MsaG006743	MsaG023442	0.893926	8.912050e-75	3.238192e-71
MsaG006743	MsaG023666	0.801662	1.358321e-48	1.906838e-46
MsaG006743	MsaG023817	0.917699	9.747187e-86	1.555759e-81
MsaG006743	MsaG023907	0.878111	7.662158e-69	1.267609e-65
MsaG006743	MsaG023897	0.909197	1.788637e-81	1.605229e-77
MsaG006743	MsaG023993	0.918566	3.372861e-86	5.731340e-82
MsaG006743	MsaG024058	0.833010	1.235092e-55	3.899889e-53
MsaG006743	MsaG024118	0.825490	8.093683e-54	2.063602e-51
MsaG006743	MsaG024122	0.833454	9.582813e-56	3.065820e-53
MsaG006743	MsaG024143	0.854133	2.905416e-61	1.819865e-58
MsaG006743	MsaG024136	0.876377	3.049689e-68	4.663759e-65
MsaG006743	MsaG024150	0.893465	1.368076e-74	4.848658e-71
MsaG006743	MsaG024152	0.903205	1.030298e-78	6.373333e-75
MsaG006743	MsaG024159	0.826607	4.404090e-54	1.158285e-51
MsaG006743	MsaG024169	0.843607	2.357473e-58	1.032182e-55
MsaG006743	MsaG024360	0.867733	2.220320e-65	2.342797e-62
MsaG006743	MsaG024586	0.832577	1.580163e-55	4.926764e-53
MsaG006743	MsaG024652	0.932832	1.309332e-94	6.741746e-90
MsaG006743	MsaG025081	0.889466	5.179134e-73	1.484576e-69
MsaG006743	MsaG025160	0.916900	2.560584e-85	3.861261e-81
MsaG006743	MsaG025262	0.892311	3.960639e-74	1.318992e-70
MsaG006743	MsaG025404	0.837018	1.219192e-56	4.339192e-54
MsaG006743	MsaG025451	0.877693	1.071370e-68	1.738593e-65
MsaG006743	MsaG025618	0.894993	3.282049e-75	1.263658e-71
MsaG006743	MsaG025779	0.911422	1.508390e-82	1.563282e-78
MsaG006743	MsaG025797	0.831599	2.750216e-55	8.334659e-53
MsaG006743	MsaG026362	0.821966	5.364187e-53	1.242866e-50
MsaG006743	MsaG026770	0.832834	1.365085e-55	4.288203e-53
MsaG006743	MsaG026848	0.916540	3.947667e-85	5.796828e-81
MsaG006743	MsaG026926	0.925592	3.945413e-90	1.132640e-85
MsaG006743	MsaG026966	0.932216	3.291906e-94	1.608560e-89
MsaG006743	MsaG027028	0.839114	3.543661e-57	1.345507e-54
MsaG006743	MsaG026996	0.830386	5.440011e-55	1.591906e-52
MsaG006743	MsaG027001	0.822252	4.608236e-53	1.075920e-50
MsaG006743	MsaG027002	0.833514	9.263494e-56	2.968803e-53
MsaG006743	MsaG027033	0.812554	6.875921e-51	1.250173e-48
MsaG006743	MsaG027046	0.825183	9.558694e-54	2.416611e-51
MsaG006743	MsaG027054	0.896495	7.903189e-76	3.307001e-72
MsaG006743	MsaG027285	0.832301	1.848386e-55	5.717032e-53
MsaG006743	MsaG027309	0.861877	1.489019e-63	1.243724e-60
MsaG006743	MsaG027329	0.813943	3.419372e-51	6.436757e-49
MsaG006743	MsaG027367	0.818052	4.176534e-52	8.729153e-50
MsaG006743	MsaG027424	0.857697	2.667037e-62	1.901611e-59
MsaG006743	MsaG027773	0.831903	2.316032e-55	7.081685e-53
MsaG006743	MsaG027816	0.819217	2.279519e-52	4.911209e-50
MsaG006743	MsaG027830	0.854238	2.710571e-61	1.704284e-58
MsaG006743	MsaG027970	0.872021	8.967923e-67	1.132565e-63
MsaG006743	MsaG027999	0.900570	1.479553e-77	7.828232e-74
MsaG006743	MsaG028236	0.829036	1.155147e-54	3.252118e-52
MsaG006743	MsaG028309	0.811188	1.359469e-50	2.389930e-48
MsaG006743	MsaG028342	0.858963	1.123953e-62	8.401362e-60
MsaG006743	MsaG028348	0.860875	2.998217e-63	2.410159e-60
MsaG006743	MsaG028353	0.858304	1.764465e-62	1.286879e-59
MsaG006743	MsaG028553	0.873333	3.281277e-67	4.385990e-64
MsaG006743	MsaG028607	0.906435	3.532393e-80	2.656802e-76
MsaG006743	MsaG028657	0.816567	8.985561e-52	1.807521e-49
MsaG006743	MsaG028787	0.841363	9.221905e-58	3.757941e-55
MsaG006743	MsaG028801	0.876646	2.465832e-68	3.816436e-65
MsaG006743	MsaG028813	0.806843	1.146396e-49	1.814792e-47
MsaG006743	MsaG028830	0.868494	1.266914e-65	1.379221e-62
MsaG006743	MsaG028850	0.805173	2.564150e-49	3.903135e-47
MsaG006743	MsaG028950	0.886950	4.747341e-72	1.197326e-68
MsaG006743	MsaG028985	0.914070	7.290082e-84	9.034504e-80
MsaG006743	MsaG029236	0.928730	5.161088e-92	1.900293e-87
MsaG006743	MsaG029314	0.853269	5.136900e-61	3.120085e-58
MsaG006743	MsaG029332	0.827836	2.243129e-54	6.106198e-52
MsaG006743	MsaG029352	0.805708	1.982392e-49	3.055403e-47
MsaG006743	MsaG029443	0.857041	4.159544e-62	2.894227e-59
MsaG006743	MsaG029650	0.821400	7.242272e-53	1.652921e-50
MsaG006743	MsaG029700	0.853259	5.170018e-61	3.139109e-58
MsaG006743	MsaG029819	0.820830	9.781702e-53	2.199023e-50
MsaG006743	MsaG029813	0.907873	7.564587e-81	6.232295e-77
MsaG006743	MsaG029875	0.800040	2.902075e-48	3.927290e-46
MsaG006743	MsaG029916	0.826729	4.120466e-54	1.087405e-51
MsaG006743	MsaG030015	0.813511	4.252662e-51	7.918987e-49
MsaG006743	MsaG030080	0.882283	2.525475e-70	5.072704e-67
MsaG006743	MsaG030113	0.816105	1.138526e-51	2.263366e-49
MsaG006743	MsaG030364	0.806982	1.071809e-49	1.702308e-47
MsaG006743	MsaG030518	0.843378	2.712250e-58	1.178866e-55
MsaG006743	MsaG030788	0.844759	1.160311e-58	5.275095e-56
MsaG006743	MsaG030993	0.840964	1.173022e-57	4.719938e-55
MsaG006743	MsaG031143	0.818772	2.874087e-52	6.120114e-50
MsaG006743	MsaG031491	0.919818	7.149032e-87	1.329205e-82
MsaG006743	MsaG031593	0.833633	8.652054e-56	2.782571e-53
MsaG006743	MsaG031586	0.826046	5.979623e-54	1.548451e-51
MsaG006743	MsaG031750	0.814541	2.526358e-51	4.827392e-49
MsaG006743	MsaG032378	0.878891	4.085914e-69	7.007664e-66
MsaG006743	MsaG033125	0.809011	3.983196e-50	6.641924e-48
MsaG006743	MsaG033702	0.847806	1.731240e-59	8.711061e-57
MsaG006743	MsaG033966	0.901705	4.741542e-78	2.681601e-74
MsaG006743	MsaG034350	0.818389	3.507359e-52	7.394552e-50
MsaG006743	MsaG034342	0.864356	2.570670e-64	2.367123e-61
MsaG006743	MsaG034529	0.842876	3.685488e-58	1.576250e-55
MsaG006743	MsaG034740	0.848117	1.422201e-59	7.230573e-57
MsaG006743	MsaG034790	0.884347	4.450088e-71	9.873709e-68
MsaG006743	MsaG034930	0.803949	4.602610e-49	6.809907e-47
MsaG006743	MsaG034949	0.918820	2.468772e-86	4.270218e-82
MsaG006743	MsaG034956	0.835590	2.802792e-56	9.555480e-54
MsaG006743	MsaG034999	0.888119	1.708224e-72	4.569603e-69
MsaG006743	MsaG035147	0.839250	3.267776e-57	1.245993e-54
MsaG006743	MsaG035269	0.901979	3.594873e-78	2.066079e-74
MsaG006743	MsaG035300	0.835270	3.373637e-56	1.139156e-53
MsaG006743	MsaG035275	0.899889	2.912789e-77	1.480440e-73
MsaG006743	MsaG035323	0.935883	1.195762e-96	7.918253e-92
MsaG006743	MsaG035395	0.876021	4.040264e-68	6.081057e-65
MsaG006743	MsaG035406	0.826557	4.524553e-54	1.188328e-51
MsaG006743	MsaG035514	0.864298	2.680451e-64	2.462616e-61
MsaG006743	MsaG035523	0.868456	1.302738e-65	1.416055e-62
MsaG006743	MsaG035554	0.847401	2.235433e-59	1.109514e-56
MsaG006743	MsaG035557	0.837462	9.397053e-57	3.390330e-54
MsaG006743	MsaG035558	0.889644	4.420488e-73	1.279026e-69
MsaG006743	MsaG035579	0.801413	1.526717e-48	2.131191e-46
MsaG006743	MsaG035580	0.850992	2.263408e-60	1.269411e-57
MsaG006743	MsaG035581	0.841945	6.486853e-58	2.692956e-55
MsaG006743	MsaG035582	0.802313	9.996367e-49	1.424328e-46
MsaG006743	MsaG035561	0.801586	1.407724e-48	1.972749e-46
MsaG006743	MsaG035563	0.802407	9.564439e-49	1.365706e-46
MsaG006743	MsaG035567	0.845284	8.384347e-59	3.877725e-56
MsaG006743	MsaG035568	0.835022	3.893992e-56	1.305228e-53
MsaG006743	MsaG035569	0.829312	9.906752e-55	2.811047e-52
MsaG006743	MsaG035571	0.803324	6.193910e-49	9.032673e-47
MsaG006743	MsaG035572	0.890236	2.601620e-73	7.761151e-70
MsaG006743	MsaG036060	0.880227	1.379086e-69	2.515167e-66
MsaG006743	MsaG036111	0.931744	6.627621e-94	3.109762e-89
MsaG006743	MsaG036130	0.943884	1.629844e-102	2.170437e-97
MsaG006743	MsaG036131	0.942533	1.823135e-101	2.154727e-96
MsaG006743	MsaG036128	0.858770	1.282578e-62	9.518443e-60
MsaG006743	MsaG036294	0.880724	9.176011e-70	1.713362e-66
MsaG006743	MsaG036511	0.809050	3.907770e-50	6.522309e-48
MsaG006743	MsaG036529	0.862593	8.997203e-64	7.728295e-61
MsaG006743	MsaG036679	0.831350	3.164390e-55	9.519724e-53
MsaG006743	MsaG036699	0.901071	8.971450e-78	4.889124e-74
MsaG006743	MsaG036701	0.879575	2.348384e-69	4.156664e-66
MsaG006743	MsaG036704	0.841421	8.906438e-58	3.636138e-55
MsaG006743	MsaG037763	0.878121	7.601481e-69	1.258136e-65
MsaG006743	MsaG037805	0.868877	9.534203e-66	1.054256e-62
MsaG006743	MsaG038022	0.886071	1.017283e-71	2.456298e-68
MsaG006743	MsaG038546	0.844646	1.244476e-58	5.636589e-56
MsaG006743	MsaG039280	0.819420	2.049949e-52	4.440203e-50
MsaG006743	MsaG039325	0.840567	1.488748e-57	5.916079e-55
MsaG006743	MsaG039591	0.920752	2.208076e-87	4.395481e-83
MsaG006743	MsaG040482	0.802398	9.603457e-49	1.371022e-46
MsaG006743	MsaG040755	0.910533	4.082592e-82	3.994640e-78
MsaG006743	MsaG041006	0.809073	3.863732e-50	6.452336e-48
MsaG006743	MsaG041015	0.934823	6.266445e-96	3.793973e-91
MsaG006743	MsaG041016	0.833953	7.204621e-56	2.338831e-53
MsaG006743	MsaG041017	0.949345	4.902271e-107	1.045228e-101
MsaG006743	MsaG041018	0.899550	4.071229e-77	2.028261e-73
MsaG006743	MsaG041019	0.930653	3.276718e-93	1.406755e-88
MsaG006743	MsaG041044	0.926806	7.543382e-91	2.388305e-86
MsaG006743	MsaG041045	0.873494	2.898148e-67	3.901101e-64
MsaG006743	MsaG041117	0.839193	3.381349e-57	1.286965e-54
MsaG006743	MsaG041171	0.848513	1.107131e-59	5.703477e-57
MsaG006743	MsaG041172	0.914465	4.598782e-84	5.857214e-80
MsaG006743	MsaG041230	0.919379	1.234892e-86	2.220952e-82
MsaG006743	MsaG041392	0.937724	6.276249e-98	4.854240e-93
MsaG006743	MsaG041807	0.813251	4.846326e-51	8.965698e-49
MsaG006743	MsaG042225	0.923912	3.719872e-89	9.371965e-85
MsaG006743	MsaG042323	0.916264	5.496091e-85	7.914951e-81
MsaG006743	MsaG042543	0.803541	5.588605e-49	8.191004e-47
MsaG006743	MsaG042972	0.857520	3.007300e-62	2.130105e-59
MsaG006743	MsaG042981	0.840115	1.952018e-57	7.647572e-55
MsaG006743	MsaG043113	0.881613	4.408302e-70	8.580657e-67
MsaG006743	MsaG043330	0.835227	3.457229e-56	1.165905e-53
MsaG006743	MsaG043344	0.901159	8.210097e-78	4.496621e-74
MsaG006743	MsaG043828	0.880600	1.015871e-69	1.885834e-66
MsaG006743	MsaG043967	0.858207	1.884408e-62	1.369324e-59
MsaG006743	MsaG044025	0.800298	2.572562e-48	3.501681e-46
MsaG006743	MsaG044277	0.809830	2.662504e-50	4.528343e-48
MsaG006743	MsaG044317	0.801235	1.660115e-48	2.307957e-46
MsaG006743	MsaG044324	0.890798	1.568334e-73	4.818776e-70
MsaG006743	MsaG044331	0.834681	4.740577e-56	1.572912e-53
MsaG006743	MsaG044473	0.836250	1.909192e-56	6.639669e-54
MsaG006743	MsaG044793	0.813945	3.415076e-51	6.429076e-49
MsaG006743	MsaG044851	0.808474	5.182093e-50	8.529966e-48
MsaG006743	MsaG044867	0.831849	2.387647e-55	7.289174e-53
MsaG006743	MsaG045111	0.835325	3.268033e-56	1.105360e-53
MsaG006743	MsaG045116	0.896573	7.332831e-76	3.081738e-72
MsaG006743	MsaG045254	0.893673	1.127741e-74	4.042073e-71
MsaG006743	MsaG045309	0.883172	1.200511e-70	2.517215e-67
MsaG006743	MsaG045261	0.866898	4.093486e-65	4.175480e-62
MsaG006743	MsaG045283	0.923033	1.178305e-88	2.779569e-84
MsaG006743	MsaG045320	0.818598	3.147209e-52	6.671323e-50
MsaG006743	MsaG045359	0.830689	4.588871e-55	1.354455e-52
MsaG006743	MsaG045515	0.857019	4.221041e-62	2.934662e-59
MsaG006743	MsaG045550	0.936867	2.499613e-97	1.796056e-92
MsaG006743	MsaG045551	0.934086	1.952365e-95	1.114121e-90
MsaG006743	MsaG045589	0.917245	1.690410e-85	2.611090e-81
MsaG006743	MsaG045753	0.831708	2.585496e-55	7.861106e-53
MsaG006743	MsaG045766	0.897617	2.686688e-76	1.198457e-72
MsaG006743	MsaG045776	0.807163	9.813343e-50	1.565327e-47
MsaG006743	MsaG045806	0.868827	9.897119e-66	1.092164e-62
MsaG006743	MsaG045861	0.824011	1.799362e-53	4.405957e-51
MsaG006743	MsaG045883	0.864576	2.195866e-64	2.039715e-61
MsaG006743	MsaG046056	0.811254	1.315734e-50	2.316762e-48
MsaG006743	MsaG046223	0.829029	1.159508e-54	3.263765e-52
MsaG006743	MsaG046156	0.858883	1.187199e-62	8.847688e-60
MsaG006743	MsaG046177	0.854288	2.622650e-61	1.652015e-58
MsaG006743	MsaG046263	0.841144	1.052695e-57	4.260166e-55
MsaG006743	MsaG046276	0.914046	7.493130e-84	9.271836e-80
MsaG006743	MsaG046380	0.857334	3.411943e-62	2.400193e-59
MsaG006743	MsaG046526	0.888583	1.134643e-72	3.108002e-69
MsaG006743	MsaG046532	0.861575	1.839301e-63	1.518484e-60
MsaG006743	MsaG046480	0.860187	4.835923e-63	3.787193e-60
MsaG006743	MsaG046492	0.801684	1.344523e-48	1.888406e-46
MsaG006743	MsaG046602	0.852863	6.702686e-61	4.013282e-58
MsaG006743	MsaG046766	0.848227	1.326672e-59	6.769618e-57
MsaG006743	MsaG046732	0.833762	8.037518e-56	2.594712e-53
MsaG006743	MsaG046804	0.891240	1.051457e-73	3.306639e-70
MsaG006743	MsaG046948	0.801660	1.359291e-48	1.908125e-46
MsaG006743	MsaG046955	0.886431	7.450984e-72	1.831302e-68
MsaG006743	MsaG047020	0.859596	7.273412e-63	5.568921e-60
MsaG006743	MsaG047132	0.803579	5.487496e-49	8.049741e-47
MsaG006743	MsaG002505	0.941955	5.032975e-101	5.642037e-96
MsaG006743	MsaG002246	0.815461	1.582199e-51	3.094413e-49
MsaG006743	MsaG001553	0.802167	1.070782e-48	1.520556e-46
MsaG006743	MsaG001996	0.810762	1.679471e-50	2.921876e-48
MsaG006743	MsaG001256	0.891837	6.112086e-74	1.984032e-70
MsaG006743	MsaG003316	0.859387	8.398620e-63	6.379966e-60
MsaG006743	MsaG001632	0.833055	1.203592e-55	3.805564e-53
MsaG006743	MsaG002683	0.841418	8.922655e-58	3.642358e-55
MsaG006743	MsaG001709	0.800093	2.831280e-48	3.836021e-46
MsaG006743	MsaG001311	0.814046	3.245279e-51	6.124550e-49
MsaG006743	MsaG004869	0.896767	6.089551e-76	2.587218e-72
MsaG006743	MsaG002499	0.868344	1.414856e-65	1.530848e-62
MsaG006743	MsaG001683	0.903315	9.202722e-79	5.730643e-75
MsaG006743	MsaG002306	0.871864	1.010811e-66	1.268065e-63
MsaG006743	MsaG003328	0.864628	2.115398e-64	1.969154e-61
MsaG006743	MsaG002115	0.889216	6.472203e-73	1.831138e-69
MsaG006743	MsaG002708	0.801434	1.511857e-48	2.111435e-46
MsaG006743	MsaG002776	0.846513	3.900377e-59	1.879029e-56
MsaG006743	MsaG002551	0.910125	6.426942e-82	6.113973e-78
MsaG006743	MsaG001614	0.827849	2.227386e-54	6.065403e-52
MsaG006743	MsaG007925	0.801100	1.768217e-48	2.450816e-46
MsaG006743	MsaG006538	0.892443	3.509994e-74	1.177130e-70
MsaG006743	MsaG009932	0.878804	4.386158e-69	7.492256e-66
MsaG006743	MsaG011523	0.893137	1.853714e-74	6.453001e-71
MsaG006743	MsaG014171	0.921467	8.892609e-88	1.867114e-83
MsaG006743	MsaG013507	0.927813	1.869124e-91	6.410811e-87
MsaG006743	MsaG013383	0.876388	3.025026e-68	4.628066e-65
MsaG006743	MsaG012862	0.829209	1.049354e-54	2.968598e-52
MsaG006743	MsaG013255	0.930814	2.592106e-93	1.125719e-88
MsaG006743	MsaG011720	0.816378	9.901674e-52	1.982199e-49
MsaG006743	MsaG021527	0.810496	1.916366e-50	3.312466e-48
MsaG006743	MsaG018721	0.805377	2.325214e-49	3.556123e-47
MsaG006743	MsaG019459	0.888181	1.616653e-72	4.338389e-69
MsaG006743	MsaG019026	0.903673	6.370160e-79	4.052871e-75
MsaG006743	MsaG019513	0.874609	1.221262e-67	1.726659e-64
MsaG006743	MsaG019334	0.801640	1.372259e-48	1.925460e-46
MsaG006743	MsaG022732	0.887644	2.591123e-72	6.768082e-69
MsaG006743	MsaG020251	0.835828	2.440914e-56	8.381379e-54
MsaG006743	MsaG019999	0.819674	1.795564e-52	3.914915e-50
MsaG006743	MsaG027071	0.853407	4.689589e-61	2.862604e-58
MsaG006743	MsaG026791	0.833037	1.215813e-55	3.842215e-53
MsaG006743	MsaG026416	0.845370	7.950245e-59	3.687812e-56
MsaG006743	MsaG025840	0.926369	1.371196e-90	4.184052e-86
MsaG006743	MsaG026810	0.916799	2.894093e-85	4.332587e-81
MsaG006743	MsaG028085	0.829984	6.811394e-55	1.970374e-52
MsaG006743	MsaG029509	0.814907	2.097429e-51	4.045050e-49
MsaG006743	MsaG026617	0.874462	1.369218e-67	1.923416e-64
MsaG006743	MsaG027701	0.806970	1.077973e-49	1.711601e-47
MsaG006743	MsaG027837	0.803468	5.786656e-49	8.466762e-47
MsaG006743	MsaG026155	0.855592	1.101753e-61	7.272303e-59
MsaG006743	MsaG027119	0.864203	2.867814e-64	2.624751e-61
MsaG006743	MsaG027196	0.880905	7.904388e-70	1.488510e-66
MsaG006743	MsaG026351	0.834879	4.227606e-56	1.411012e-53
MsaG006743	MsaG034393	0.838137	6.317947e-57	2.326973e-54
MsaG006743	MsaG032143	0.940506	6.128389e-100	5.966252e-95
MsaG006743	MsaG034035	0.843330	2.792175e-58	1.211762e-55
MsaG006743	MsaG030927	0.856261	7.037119e-62	4.759578e-59
MsaG006743	MsaG031458	0.871174	1.706048e-66	2.077713e-63
MsaG006743	MsaG033591	0.859876	5.994766e-63	4.638794e-60
MsaG006743	MsaG033091	0.859050	1.058458e-62	7.938472e-60
MsaG006743	MsaG034413	0.827339	2.949373e-54	7.917096e-52
MsaG006743	MsaG031111	0.906774	2.463002e-80	1.891257e-76
MsaG006743	MsaG031373	0.840101	1.967738e-57	7.705919e-55
MsaG006743	MsaG031339	0.837802	7.698894e-57	2.806448e-54
MsaG006743	MsaG032077	0.811644	1.083703e-50	1.926498e-48
MsaG006743	MsaG032719	0.920660	2.480429e-87	4.903834e-83
MsaG006743	MsaG030868	0.905740	7.373774e-80	5.314392e-76
MsaG006743	MsaG034266	0.889270	6.170636e-73	1.750695e-69
MsaG006743	MsaG031897	0.880133	1.489915e-69	2.705139e-66
MsaG006743	MsaG031245	0.848848	8.947519e-60	4.662548e-57
MsaG006743	MsaG030261	0.843202	3.020731e-58	1.305477e-55
MsaG006743	MsaG032934	0.860968	2.810846e-63	2.267284e-60
MsaG006743	MsaG036258	0.840567	1.488523e-57	5.915209e-55
MsaG006743	MsaG039769	0.822605	3.819419e-53	9.002673e-51
MsaG006743	MsaG040050	0.869161	7.720689e-66	8.638229e-63
MsaG006743	MsaG037635	0.827434	2.799120e-54	7.533817e-52
MsaG006743	MsaG037255	0.926282	1.544771e-90	4.678385e-86
MsaG006743	MsaG037000	0.943167	5.911021e-102	7.396249e-97
MsaG006743	MsaG036465	0.816548	9.072476e-52	1.824100e-49
MsaG006743	MsaG037256	0.853286	5.079025e-61	3.086803e-58
MsaG006743	MsaG039370	0.833896	7.443306e-56	2.412248e-53
MsaG006743	MsaG037437	0.809920	2.547924e-50	4.342696e-48
MsaG006743	MsaG037075	0.860003	5.492324e-63	4.270658e-60
MsaG006743	MsaG037837	0.826020	6.067635e-54	1.570026e-51
MsaG006743	MsaG037532	0.934787	6.628286e-96	4.001063e-91
MsaG006743	MsaG036656	0.929967	8.847098e-93	3.591529e-88
MsaG006743	MsaG038148	0.833588	8.878291e-56	2.851554e-53
MsaG006743	MsaG042389	0.823033	3.039283e-53	7.247252e-51
MsaG006743	MsaG041203	0.810365	2.044782e-50	3.523211e-48
MsaG006743	MsaG043579	0.884608	3.565342e-71	8.009584e-68
MsaG006743	MsaG042526	0.810622	1.800376e-50	3.121552e-48
MsaG006743	MsaG043567	0.802458	9.332837e-49	1.334205e-46
MsaG006743	MsaG043311	0.806631	1.269942e-49	2.000505e-47
MsaG006743	MsaG044409	0.838643	4.685830e-57	1.753242e-54
MsaG006743	MsaG047167	0.829241	1.030623e-54	2.918258e-52

PPI

Gene1	Gene2	Type

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG006743	MtrunA17_Chr2g0284901	98.249	457	8	0	1	457	1	457	0.0	936
MsaG006743	MtrunA17_Chr5g0443471	64.644	478	133	5	1	453	1	467	0.0	608
MsaG006743	MtrunA17_Chr8g0380551	47.332	431	215	4	4	422	69	499	1.24e-131	389
MsaG006743	MtrunA17_Chr4g0042731	44.472	398	202	7	42	423	22	416	3.65e-108	326
MsaG006743	MtrunA17_Chr5g0406251	35.495	293	165	9	146	429	288	565	5.25e-49	176
MsaG006743	MtrunA17_Chr1g0211611	35.395	291	142	9	146	416	294	558	3.65e-48	174
MsaG006743	MtrunA17_Chr3g0143531	35.000	260	153	7	160	417	38	283	8.12e-44	155
MsaG006743	MtrunA17_Chr5g0427651	34.416	308	193	6	108	411	601	903	1.16e-43	164
MsaG006743	MtrunA17_Chr1g0171451	37.956	274	156	7	142	411	408	671	1.54e-43	162
MsaG006743	MtrunA17_Chr4g0075541	35.714	252	138	7	169	409	104	342	7.97e-43	155
MsaG006743	MtrunA17_Chr2g0294351	37.638	271	158	8	145	411	458	721	8.98e-43	160
MsaG006743	MtrunA17_Chr4g0068411	38.550	262	148	8	145	401	452	705	2.55e-42	159
MsaG006743	MtrunA17_Chr4g0059121	33.955	268	137	9	169	417	75	321	4.86e-42	152
MsaG006743	MtrunA17_Chr1g0202101	34.601	263	159	7	145	404	275	527	4.91e-42	156
MsaG006743	MtrunA17_Chr3g0132791	37.452	259	144	7	164	414	665	913	9.15e-42	158
MsaG006743	MtrunA17_Chr8g0392871	35.357	280	166	9	142	415	728	998	8.99e-41	155
MsaG006743	MtrunA17_Chr1g0151541	31.776	321	194	10	102	418	626	925	1.97e-40	154
MsaG006743	MtrunA17_Chr3g0117811	31.949	313	176	11	132	416	39	342	7.63e-40	147
MsaG006743	MtrunA17_Chr6g0482711	35.000	280	167	9	142	415	649	919	1.02e-39	152
MsaG006743	MtrunA17_Chr6g0450871	32.792	308	168	11	138	416	57	354	2.15e-39	145
MsaG006743	MtrunA17_Chr1g0179331	37.698	252	147	6	164	411	567	812	2.99e-39	151
MsaG006743	MtrunA17_Chr4g0047191	34.016	244	118	8	193	417	90	309	4.28e-39	144
MsaG006743	MtrunA17_Chr5g0397931	33.840	263	159	9	160	415	428	682	5.75e-39	149
MsaG006743	MtrunA17_Chr4g0047211	34.836	244	116	9	193	417	85	304	5.80e-39	144
MsaG006743	MtrunA17_Chr3g0090261	32.500	280	160	10	145	410	74	338	7.54e-39	144
MsaG006743	MtrunA17_Chr1g0191171	35.968	253	148	8	164	411	701	944	1.64e-38	149
MsaG006743	MtrunA17_Chr3g0117731	32.075	265	142	8	169	415	74	318	9.36e-38	140
MsaG006743	MtrunA17_Chr4g0047201	34.836	244	116	9	193	417	246	465	5.13e-37	142
MsaG006743	MtrunA17_Chr2g0282321	35.294	238	119	7	195	417	209	426	6.05e-37	141
MsaG006743	MtrunA17_Chr4g0059181	30.794	315	181	11	130	416	66	371	6.54e-36	137
MsaG006743	MtrunA17_Chr1g0205071	30.473	338	191	13	109	416	38	361	1.09e-34	133
MsaG006743	MtrunA17_Chr5g0403721	32.107	299	174	10	171	453	4	289	3.82e-34	131
MsaG006743	MtrunA17_Chr5g0394681	30.904	343	187	15	109	416	42	369	9.21e-34	130
MsaG006743	MtrunA17_Chr1g0157231	37.234	188	106	6	170	352	160	340	1.86e-33	129
MsaG006743	MtrunA17_Chr7g0244621	34.387	253	143	9	176	414	69	312	6.72e-33	127
MsaG006743	MtrunA17_Chr3g0136131	33.219	292	164	11	146	415	80	362	1.88e-32	126
MsaG006743	MtrunA17_Chr6g0449241	33.333	258	150	8	171	415	45	293	1.70e-31	124
MsaG006743	MtrunA17_Chr3g0116981	29.114	316	199	10	144	445	17	321	1.19e-30	121
MsaG006743	MtrunA17_Chr4g0041201	31.522	276	164	10	145	411	539	798	3.79e-30	124
MsaG006743	MtrunA17_Chr6g0483731	29.032	341	202	11	117	421	19	355	1.89e-29	118
MsaG006743	MtrunA17_Chr8g0369231	31.092	238	148	5	195	416	317	554	2.04e-29	121
MsaG006743	MtrunA17_Chr4g0018651	28.295	258	164	4	173	411	717	972	2.04e-29	122
MsaG006743	MtrunA17_Chr2g0293071	30.196	255	157	4	173	411	83	332	2.29e-29	118
MsaG006743	MtrunA17_Chr2g0324931	29.032	279	176	8	168	425	702	979	8.00e-29	120
MsaG006743	MtrunA17_Chr8g0369211	30.142	282	174	7	151	416	633	907	8.64e-29	120
MsaG006743	MtrunA17_Chr2g0293081	30.588	255	156	4	173	411	420	669	1.22e-28	119
MsaG006743	MtrunA17_Chr1g0154331	28.859	298	184	8	137	410	19	312	1.55e-28	115
MsaG006743	MtrunA17_Chr2g0321921	35.648	216	129	5	154	360	604	818	1.85e-28	119
MsaG006743	MtrunA17_Chr6g0461841	32.168	286	160	13	162	425	977	1250	1.91e-28	119
MsaG006743	MtrunA17_Chr1g0206331	30.370	270	162	9	160	411	349	610	1.97e-28	118
MsaG006743	MtrunA17_Chr2g0283111	30.619	307	194	8	125	416	586	888	2.08e-28	119
MsaG006743	MtrunA17_Chr1g0161701	38.021	192	113	3	173	359	600	790	2.18e-28	119
MsaG006743	MtrunA17_Chr4g0008561	28.030	264	168	7	154	405	18	271	2.90e-28	118
MsaG006743	MtrunA17_Chr4g0018701	30.798	263	155	6	173	410	737	997	4.00e-28	118
MsaG006743	MtrunA17_Chr3g0140861	31.439	264	158	5	168	408	671	934	4.80e-28	117
MsaG006743	MtrunA17_Chr7g0248904	29.804	255	160	5	173	411	384	635	4.85e-28	117
MsaG006743	MtrunA17_Chr2g0325851	30.033	303	168	13	121	408	532	805	4.88e-28	117
MsaG006743	MtrunA17_Chr7g0267441	34.884	215	130	4	154	359	595	808	5.19e-28	117
MsaG006743	MtrunA17_Chr7g0248881	29.412	255	161	4	173	411	377	628	5.56e-28	117
MsaG006743	MtrunA17_Chr8g0348661	34.896	192	115	3	174	359	509	696	6.86e-28	117
MsaG006743	MtrunA17_Chr4g0048661	34.146	205	120	5	154	348	37	236	7.21e-28	113
MsaG006743	MtrunA17_Chr3g0108361	29.897	291	176	8	147	415	614	898	8.65e-28	117
MsaG006743	MtrunA17_Chr3g0096351	30.325	277	159	6	170	422	200	466	9.23e-28	115
MsaG006743	MtrunA17_Chr6g0484231	35.450	189	117	3	173	359	73	258	1.15e-27	113
MsaG006743	MtrunA17_Chr2g0302631	30.827	266	148	6	170	410	203	457	1.19e-27	115
MsaG006743	MtrunA17_Chr3g0109431	29.740	269	163	7	160	410	341	601	1.24e-27	116
MsaG006743	MtrunA17_Chr1g0148461	31.390	223	141	4	145	359	427	645	1.52e-27	116
MsaG006743	MtrunA17_Chr5g0394001	30.216	278	169	9	155	410	330	604	1.53e-27	115
MsaG006743	MtrunA17_Chr2g0310781	33.455	275	147	13	160	411	850	1111	1.64e-27	116
MsaG006743	MtrunA17_Chr2g0333691	28.685	251	154	7	175	408	149	391	1.91e-27	113
MsaG006743	MtrunA17_Chr3g0121971	32.567	261	145	7	173	408	607	861	1.95e-27	115
MsaG006743	MtrunA17_Chr4g0025601	34.884	215	130	4	154	359	630	843	2.36e-27	115
MsaG006743	MtrunA17_Chr7g0271451	30.827	266	148	6	170	410	214	468	2.40e-27	114
MsaG006743	MtrunA17_Chr4g0048731	36.413	184	110	4	169	348	65	245	2.50e-27	112
MsaG006743	MtrunA17_Chr7g0262141	30.385	260	150	7	174	408	733	986	2.60e-27	115
MsaG006743	MtrunA17_Chr3g0108351	29.293	297	188	7	134	411	599	892	2.74e-27	115
MsaG006743	MtrunA17_Chr8g0345801	31.280	211	123	7	154	352	14	214	2.96e-27	110
MsaG006743	MtrunA17_Chr2g0319101	30.651	261	164	5	173	422	134	388	3.02e-27	113
MsaG006743	MtrunA17_Chr3g0078551	34.146	205	121	5	154	348	523	723	3.37e-27	115
MsaG006743	MtrunA17_Chr4g0069251	29.771	262	156	5	170	410	198	452	4.16e-27	113
MsaG006743	MtrunA17_Chr5g0399591	32.192	292	155	9	151	411	505	784	4.30e-27	114
MsaG006743	MtrunA17_Chr5g0428581	29.433	282	166	8	154	410	44	317	4.85e-27	111
MsaG006743	MtrunA17_Chr4g0013131	30.709	254	157	8	161	405	18	261	4.94e-27	113
MsaG006743	MtrunA17_Chr3g0078541	34.146	205	121	5	154	348	529	729	5.14e-27	114
MsaG006743	MtrunA17_Chr8g0376131	32.411	253	151	7	173	408	74	323	5.18e-27	112
MsaG006743	MtrunA17_Chr8g0388891	30.545	275	151	11	145	410	125	368	5.49e-27	112
MsaG006743	MtrunA17_Chr4g0023221	30.189	265	153	6	173	415	753	1007	5.87e-27	114
MsaG006743	MtrunA17_Chr3g0078521	33.659	205	122	5	154	348	518	718	6.23e-27	114
MsaG006743	MtrunA17_Chr6g0454661	29.457	258	160	6	172	411	853	1106	6.62e-27	114
MsaG006743	MtrunA17_Chr5g0406841	29.242	277	168	8	173	428	178	447	6.65e-27	112
MsaG006743	MtrunA17_Chr5g0399561	33.591	259	138	8	176	411	540	787	6.88e-27	114
MsaG006743	MtrunA17_Chr4g0034931	30.418	263	147	6	173	410	162	413	7.53e-27	112
MsaG006743	MtrunA17_Chr1g0158291	32.407	216	131	5	154	359	52	262	8.80e-27	111
MsaG006743	MtrunA17_Chr5g0432871	29.530	298	188	5	133	411	594	888	8.88e-27	114
MsaG006743	MtrunA17_Chr2g0323301	33.333	255	146	7	176	411	520	769	9.10e-27	114
MsaG006743	MtrunA17_Chr1g0158261	26.730	318	202	7	121	411	368	681	9.96e-27	113
MsaG006743	MtrunA17_Chr5g0437741	30.620	258	152	8	173	411	517	766	1.04e-26	113
MsaG006743	MtrunA17_Chr3g0125441	29.078	282	177	7	176	441	481	755	1.11e-26	113
MsaG006743	MtrunA17_Chr3g0078531	35.417	192	114	4	161	348	541	726	1.22e-26	113
MsaG006743	MtrunA17_Chr3g0125491	28.685	251	161	4	176	411	82	329	1.36e-26	110
MsaG006743	MtrunA17_Chr5g0434141	32.584	267	143	8	173	411	614	871	1.43e-26	113
MsaG006743	MtrunA17_Chr1g0148501	31.197	234	147	6	134	359	411	638	1.72e-26	112
MsaG006743	MtrunA17_Chr1g0205931	27.523	218	148	4	192	405	102	313	1.95e-26	112
MsaG006743	MtrunA17_Chr2g0311551	29.932	294	168	9	141	411	731	1009	2.09e-26	112
MsaG006743	MtrunA17_Chr6g0486961	30.712	267	145	7	174	408	698	956	2.18e-26	112
MsaG006743	MtrunA17_Chr6g0487031	32.275	189	112	2	176	348	717	905	2.32e-26	112
MsaG006743	MtrunA17_Chr8g0348631	28.571	322	206	8	147	457	127	435	2.36e-26	110
MsaG006743	MtrunA17_Chr2g0310761	32.500	280	159	13	160	419	944	1213	2.45e-26	112
MsaG006743	MtrunA17_Chr4g0048791	36.022	186	110	4	167	348	551	731	2.46e-26	112
MsaG006743	MtrunA17_Chr8g0377951	30.282	284	163	8	154	408	568	845	2.54e-26	112
MsaG006743	MtrunA17_Chr1g0183231	31.128	257	150	7	174	408	725	976	2.86e-26	112
MsaG006743	MtrunA17_Chr8g0357691	34.975	203	121	4	154	348	478	677	3.10e-26	112
MsaG006743	MtrunA17_Chr3g0119241	26.879	346	206	10	125	436	286	618	3.34e-26	111
MsaG006743	MtrunA17_Chr1g0158211	29.249	253	161	6	121	359	110	358	3.44e-26	110
MsaG006743	MtrunA17_Chr8g0340911	35.028	177	110	3	174	348	590	763	3.51e-26	112
MsaG006743	MtrunA17_Chr3g0144551	30.196	255	158	5	173	410	156	407	3.67e-26	110
MsaG006743	MtrunA17_Chr8g0357611	32.714	269	151	12	160	408	1375	1633	3.85e-26	112
MsaG006743	MtrunA17_Chr3g0125431	28.014	282	180	7	176	441	451	725	4.56e-26	111
MsaG006743	MtrunA17_Chr6g0454621	28.794	257	163	6	172	411	854	1107	4.75e-26	112
MsaG006743	MtrunA17_Chr8g0340881	29.482	251	159	5	174	409	594	841	4.76e-26	111
MsaG006743	MtrunA17_Chr1g0154321	29.720	286	160	8	154	410	368	641	5.03e-26	111
MsaG006743	MtrunA17_Chr4g0048741	36.111	180	108	3	173	348	555	731	5.15e-26	111
MsaG006743	MtrunA17_Chr2g0305141	30.375	293	164	13	151	418	1079	1356	5.49e-26	112
MsaG006743	MtrunA17_Chr1g0206231	32.342	269	156	10	160	410	360	620	5.90e-26	111
MsaG006743	MtrunA17_Chr1g0206261	28.881	277	174	7	154	410	89	362	6.47e-26	109
MsaG006743	MtrunA17_Chr1g0158231	29.249	253	161	6	121	359	88	336	6.66e-26	109
MsaG006743	MtrunA17_Chr2g0304111	30.916	262	155	7	173	413	46	302	6.85e-26	109
MsaG006743	MtrunA17_Chr1g0161711	35.938	192	117	3	173	359	595	785	7.03e-26	111
MsaG006743	MtrunA17_Chr8g0341101	32.683	205	126	4	153	348	613	814	7.96e-26	111
MsaG006743	MtrunA17_Chr8g0357711	35.556	180	109	3	173	348	500	676	8.68e-26	110
MsaG006743	MtrunA17_Chr7g0236121	36.111	180	108	4	173	348	527	703	9.10e-26	110
MsaG006743	MtrunA17_Chr8g0343131	33.175	211	123	7	155	353	112	316	9.17e-26	108
MsaG006743	MtrunA17_Chr7g0236201	36.111	180	108	4	173	348	493	669	9.43e-26	110
MsaG006743	MtrunA17_Chr5g0443121	30.620	258	159	5	170	410	202	456	9.63e-26	109
MsaG006743	MtrunA17_Chr3g0103791	33.491	212	127	5	155	356	128	335	1.05e-25	108
MsaG006743	MtrunA17_Chr2g0311541	29.592	294	169	9	141	411	494	772	1.17e-25	110
MsaG006743	MtrunA17_Chr8g0357761	35.556	180	109	3	173	348	503	679	1.21e-25	110
MsaG006743	MtrunA17_Chr8g0341111	27.888	251	163	5	174	409	503	750	1.23e-25	110
MsaG006743	MtrunA17_Chr2g0282831	35.354	198	115	4	168	352	675	872	1.57e-25	110
MsaG006743	MtrunA17_Chr1g0206461	28.975	283	178	7	154	416	333	612	1.64e-25	109
MsaG006743	MtrunA17_Chr5g0394011	28.179	291	181	8	154	420	351	637	1.73e-25	109
MsaG006743	MtrunA17_Chr6g0453671	31.336	217	136	6	189	404	61	265	1.76e-25	107
MsaG006743	MtrunA17_Chr2g0323341	32.955	264	152	7	169	413	427	684	1.86e-25	109
MsaG006743	MtrunA17_Chr8g0340721	34.536	194	114	3	162	348	367	554	1.87e-25	109
MsaG006743	MtrunA17_Chr5g0428571	33.333	204	123	5	154	348	298	497	1.92e-25	108
MsaG006743	MtrunA17_Chr8g0338501	37.143	175	106	2	174	346	576	748	1.93e-25	109
MsaG006743	MtrunA17_Chr6g0487571	30.594	219	128	5	153	350	567	782	2.04e-25	109
MsaG006743	MtrunA17_Chr1g0158171	28.947	266	167	7	112	359	86	347	2.06e-25	108
MsaG006743	MtrunA17_Chr4g0046511	29.963	267	154	7	173	411	708	969	2.44e-25	109
MsaG006743	MtrunA17_Chr4g0023111	28.477	302	188	10	138	415	696	993	2.49e-25	109
MsaG006743	MtrunA17_Chr3g0109461	28.731	268	168	6	160	410	353	614	2.57e-25	109
MsaG006743	MtrunA17_Chr1g0165891	30.159	252	153	5	173	404	419	667	2.59e-25	109
MsaG006743	MtrunA17_Chr1g0206551	33.005	203	125	4	154	348	35	234	2.70e-25	106
MsaG006743	MtrunA17_Chr7g0216551	28.682	258	164	5	173	413	155	409	3.25e-25	107
MsaG006743	MtrunA17_Chr2g0311511	30.142	282	168	10	153	411	443	718	3.30e-25	108
MsaG006743	MtrunA17_Chr5g0443531	29.344	259	162	5	173	413	699	954	3.55e-25	109
MsaG006743	MtrunA17_Chr4g0055011	31.863	204	126	5	154	348	71	270	3.63e-25	106
MsaG006743	MtrunA17_Chr1g0161721	36.264	182	109	4	173	348	602	782	3.64e-25	108
MsaG006743	MtrunA17_Chr1g0158201	26.909	275	181	5	188	445	445	716	3.80e-25	108
MsaG006743	MtrunA17_Chr1g0154351	28.058	278	175	7	154	410	358	631	3.80e-25	108
MsaG006743	MtrunA17_Chr7g0272841	27.778	288	181	9	168	436	86	365	3.84e-25	108
MsaG006743	MtrunA17_Chr5g0411631	31.250	272	160	7	161	409	602	869	3.86e-25	108
MsaG006743	MtrunA17_Chr5g0413071	29.749	279	154	8	164	411	321	588	4.03e-25	108
MsaG006743	MtrunA17_Chr5g0428031	28.571	273	166	8	141	404	4	256	4.10e-25	107
MsaG006743	MtrunA17_Chr1g0189871	27.559	254	165	4	176	410	825	1078	4.40e-25	108
MsaG006743	MtrunA17_Chr7g0236561	28.723	282	169	7	154	410	505	779	4.42e-25	108
MsaG006743	MtrunA17_Chr7g0248491	34.574	188	116	3	173	356	183	367	4.43e-25	107
MsaG006743	MtrunA17_Chr8g0357831	35.556	180	109	3	173	348	215	391	4.50e-25	107
MsaG006743	MtrunA17_Chr6g0456231	27.891	294	192	5	135	410	284	575	4.60e-25	108
MsaG006743	MtrunA17_Chr3g0129721	28.625	269	173	8	147	404	17	277	4.82e-25	104
MsaG006743	MtrunA17_Chr5g0394021	34.826	201	122	4	154	348	323	520	5.01e-25	108
MsaG006743	MtrunA17_Chr4g0064511	30.116	259	157	6	132	382	199	441	5.02e-25	107
MsaG006743	MtrunA17_Chr8g0354331	29.268	287	159	8	155	410	101	374	5.21e-25	106
MsaG006743	MtrunA17_Chr5g0429431	31.304	230	147	5	147	367	121	348	5.22e-25	107
MsaG006743	MtrunA17_Chr8g0338471	31.474	251	153	5	176	409	547	795	5.26e-25	108
MsaG006743	MtrunA17_Chr1g0206361	29.268	287	179	9	155	420	344	627	5.48e-25	108
MsaG006743	MtrunA17_Chr4g0063251	31.892	185	113	3	173	348	125	305	6.17e-25	106
MsaG006743	MtrunA17_Chr6g0453681	30.901	233	151	5	173	404	42	265	6.79e-25	107
MsaG006743	MtrunA17_Chr1g0206391	30.732	205	127	6	154	348	40	239	6.84e-25	105
MsaG006743	MtrunA17_Chr8g0357651	30.279	251	155	5	175	408	495	742	6.88e-25	108
MsaG006743	MtrunA17_Chr1g0191631	31.132	212	133	4	155	356	150	358	7.25e-25	106
MsaG006743	MtrunA17_Chr8g0352381	35.714	182	108	4	173	350	553	729	7.48e-25	108
MsaG006743	MtrunA17_Chr8g0357631	35.000	180	110	3	173	348	491	667	8.63e-25	107
MsaG006743	MtrunA17_Chr5g0409041	29.070	258	163	5	168	410	323	575	9.03e-25	107
MsaG006743	MtrunA17_Chr2g0314611	29.811	265	148	8	173	411	507	759	9.20e-25	107
MsaG006743	MtrunA17_Chr3g0140871	27.820	266	149	5	171	409	711	960	9.39e-25	107
MsaG006743	MtrunA17_Chr1g0154311	29.329	283	165	8	154	410	351	624	9.84e-25	107
MsaG006743	MtrunA17_Chr2g0289131	28.339	307	187	8	130	411	293	591	9.97e-25	107
MsaG006743	MtrunA17_Chr2g0291501	27.341	267	168	7	169	416	657	916	1.07e-24	107
MsaG006743	MtrunA17_Chr1g0158251	29.134	254	162	6	121	360	377	626	1.09e-24	107
MsaG006743	MtrunA17_Chr1g0172951	29.084	251	158	5	175	409	368	614	1.12e-24	107
MsaG006743	MtrunA17_Chr1g0209391	29.141	326	190	11	155	455	300	609	1.17e-24	107
MsaG006743	MtrunA17_Chr3g0125471	29.134	254	162	5	176	414	386	636	1.21e-24	107
MsaG006743	MtrunA17_Chr8g0392271	28.521	284	173	8	154	411	577	856	1.25e-24	107
MsaG006743	MtrunA17_Chr8g0348841	28.395	243	140	6	147	357	419	659	1.26e-24	107
MsaG006743	MtrunA17_Chr0c03g0490031	33.498	203	121	4	154	348	300	496	1.40e-24	107
MsaG006743	MtrunA17_Chr1g0149381	27.305	282	165	7	158	411	505	774	1.44e-24	107
MsaG006743	MtrunA17_Chr5g0426941	33.990	203	123	5	154	348	339	538	1.46e-24	107
MsaG006743	MtrunA17_Chr5g0428521	33.880	183	114	4	170	348	20	199	1.49e-24	101
MsaG006743	MtrunA17_Chr4g0048801	32.222	180	115	3	173	348	541	717	1.57e-24	107
MsaG006743	MtrunA17_Chr6g0478111	31.579	190	114	2	175	348	737	926	1.60e-24	107
MsaG006743	MtrunA17_Chr1g0196631	29.603	277	164	10	162	419	910	1174	1.60e-24	107
MsaG006743	MtrunA17_Chr5g0423061	28.521	284	171	6	154	411	311	588	1.75e-24	106
MsaG006743	MtrunA17_Chr6g0468751	30.472	233	152	5	173	404	42	265	1.88e-24	105
MsaG006743	MtrunA17_Chr5g0398441	30.916	262	156	6	173	411	626	885	1.89e-24	107
MsaG006743	MtrunA17_Chr2g0280701	34.807	181	111	3	172	348	522	699	2.02e-24	106
MsaG006743	MtrunA17_Chr2g0311521	29.455	275	163	8	160	411	749	1015	2.12e-24	107
MsaG006743	MtrunA17_Chr8g0379091	31.439	264	160	10	164	418	35	286	2.18e-24	105
MsaG006743	MtrunA17_Chr3g0137741	29.771	262	151	7	173	411	514	765	2.20e-24	106
MsaG006743	MtrunA17_Chr6g0474901	34.197	193	116	5	160	348	580	765	2.25e-24	106
MsaG006743	MtrunA17_Chr5g0432491	29.787	235	156	5	173	405	46	273	2.37e-24	105
MsaG006743	MtrunA17_Chr4g0020081	31.414	191	124	3	173	359	534	721	2.52e-24	106
MsaG006743	MtrunA17_Chr7g0239211	28.685	251	159	5	175	409	368	614	2.57e-24	106
MsaG006743	MtrunA17_Chr6g0467701	29.183	257	151	7	176	410	59	306	2.64e-24	103
MsaG006743	MtrunA17_Chr8g0358141	28.906	256	155	6	115	348	27	277	2.88e-24	104
MsaG006743	MtrunA17_Chr5g0400681	29.344	259	165	6	169	411	710	966	2.91e-24	106
MsaG006743	MtrunA17_Chr5g0419441	29.286	280	177	9	160	433	244	508	2.96e-24	106
MsaG006743	MtrunA17_Chr7g0244521	30.588	255	156	9	161	405	18	261	3.28e-24	104
MsaG006743	MtrunA17_Chr5g0427001	36.517	178	103	4	154	322	68	244	3.34e-24	101
MsaG006743	MtrunA17_Chr8g0341151	33.708	178	112	3	174	348	583	757	3.50e-24	106
MsaG006743	MtrunA17_Chr5g0423891	28.958	259	165	6	173	415	185	440	3.55e-24	104
MsaG006743	MtrunA17_Chr4g0054521	28.958	259	166	6	169	411	707	963	3.57e-24	106
MsaG006743	MtrunA17_Chr2g0306811	31.551	187	113	4	173	348	125	307	3.66e-24	104
MsaG006743	MtrunA17_Chr3g0125451	27.481	262	168	6	176	421	446	701	3.72e-24	105
MsaG006743	MtrunA17_Chr8g0340891	34.463	177	111	3	174	348	588	761	3.73e-24	105
MsaG006743	MtrunA17_Chr4g0048681	34.066	182	113	3	169	348	303	479	3.85e-24	105
MsaG006743	MtrunA17_Chr8g0348451	28.517	263	152	7	173	410	166	417	4.02e-24	104
MsaG006743	MtrunA17_Chr5g0439801	25.743	303	178	10	155	420	267	559	4.15e-24	105
MsaG006743	MtrunA17_Chr7g0236641	33.146	178	112	3	175	348	550	724	4.24e-24	105
MsaG006743	MtrunA17_Chr1g0165901	30.159	252	153	5	173	404	987	1235	4.32e-24	105
MsaG006743	MtrunA17_Chr6g0483931	27.915	283	173	7	154	411	368	644	4.67e-24	105
MsaG006743	MtrunA17_Chr6g0474861	33.679	193	117	5	160	348	300	485	4.75e-24	105
MsaG006743	MtrunA17_Chr3g0107011	29.437	231	153	6	176	404	40	262	4.80e-24	104
MsaG006743	MtrunA17_Chr2g0330591	28.854	253	157	5	174	409	597	843	4.82e-24	105
MsaG006743	MtrunA17_Chr1g0148491	29.730	222	143	4	147	359	329	546	4.89e-24	105
MsaG006743	MtrunA17_Chr1g0206401	32.195	205	124	6	154	348	350	549	5.07e-24	105
MsaG006743	MtrunA17_Chr3g0133541	29.693	293	170	12	133	406	289	564	5.08e-24	105
MsaG006743	MtrunA17_Chr8g0361161	35.326	184	110	4	170	348	64	243	5.09e-24	102
MsaG006743	MtrunA17_Chr1g0160721	34.444	180	107	4	173	345	373	548	5.10e-24	105
MsaG006743	MtrunA17_Chr1g0190411	29.880	251	156	6	176	408	735	983	5.16e-24	105
MsaG006743	MtrunA17_Chr8g0340931	32.768	177	114	3	174	348	590	763	5.19e-24	105
MsaG006743	MtrunA17_Chr1g0165211	28.897	263	150	5	173	408	919	1171	5.21e-24	105
MsaG006743	MtrunA17_Chr4g0023071	35.632	174	107	3	176	348	521	690	5.33e-24	105
MsaG006743	MtrunA17_Chr5g0420161	26.897	290	183	7	147	411	267	552	5.51e-24	104
MsaG006743	MtrunA17_Chr7g0265391	28.205	273	168	6	160	411	359	624	5.71e-24	105
MsaG006743	MtrunA17_Chr7g0252301	30.222	225	136	4	141	348	831	1051	5.82e-24	105
MsaG006743	MtrunA17_Chr8g0380661	33.649	211	129	7	198	404	48	251	5.88e-24	102
MsaG006743	MtrunA17_Chr8g0374031	35.260	173	106	4	176	346	362	530	5.90e-24	105
MsaG006743	MtrunA17_Chr2g0317001	28.571	259	166	9	155	405	15	262	5.94e-24	105
MsaG006743	MtrunA17_Chr7g0251121	29.225	284	168	9	154	411	366	642	6.05e-24	105
MsaG006743	MtrunA17_Chr3g0081001	30.268	261	150	9	173	410	366	617	6.12e-24	105
MsaG006743	MtrunA17_Chr4g0061081	33.333	183	116	3	173	353	549	727	6.41e-24	105
MsaG006743	MtrunA17_Chr4g0061201	28.889	270	166	6	161	411	822	1084	6.42e-24	105
MsaG006743	MtrunA17_Chr2g0279661	27.863	262	167	6	176	421	456	711	6.83e-24	105
MsaG006743	MtrunA17_Chr7g0236341	33.333	180	113	3	173	348	541	717	6.86e-24	105
MsaG006743	MtrunA17_Chr7g0251051	32.804	189	114	4	169	348	331	515	7.12e-24	104
MsaG006743	MtrunA17_Chr8g0373501	33.824	204	126	3	155	352	337	537	7.43e-24	104
MsaG006743	MtrunA17_Chr6g0467641	29.183	257	151	7	176	410	218	465	7.57e-24	103
MsaG006743	MtrunA17_Chr1g0205771	31.606	193	121	4	160	348	357	542	7.61e-24	104
MsaG006743	MtrunA17_Chr6g0475111	32.642	193	119	4	160	348	601	786	7.75e-24	105
MsaG006743	MtrunA17_Chr7g0251071	33.333	189	113	4	169	348	371	555	8.16e-24	104
MsaG006743	MtrunA17_Chr3g0081031	32.195	205	124	6	154	348	352	551	8.46e-24	104
MsaG006743	MtrunA17_Chr6g0484071	31.250	288	168	10	154	415	56	339	8.66e-24	102
MsaG006743	MtrunA17_Chr5g0403891	32.524	206	130	3	155	354	256	458	8.77e-24	104
MsaG006743	MtrunA17_Chr8g0347571	32.178	202	126	4	155	348	571	769	8.94e-24	104
MsaG006743	MtrunA17_Chr7g0238671	28.295	258	162	8	173	411	105	358	9.12e-24	102
MsaG006743	MtrunA17_Chr1g0206561	33.005	203	125	5	154	348	329	528	9.35e-24	104
MsaG006743	MtrunA17_Chr5g0424581	30.380	237	151	7	173	405	147	373	9.45e-24	102
MsaG006743	MtrunA17_Chr2g0318301	30.916	262	144	8	173	409	524	773	9.50e-24	104
MsaG006743	MtrunA17_Chr3g0111431	28.571	273	165	10	174	420	205	473	9.50e-24	103
MsaG006743	MtrunA17_Chr5g0420181	30.698	215	136	5	154	359	498	708	9.64e-24	104
MsaG006743	MtrunA17_Chr3g0123141	33.498	203	125	3	158	353	611	810	1.02e-23	104
MsaG006743	MtrunA17_Chr2g0318171	29.057	265	150	7	173	411	503	755	1.06e-23	104
MsaG006743	MtrunA17_Chr8g0338531	37.288	177	105	3	174	346	478	652	1.08e-23	104
MsaG006743	MtrunA17_Chr3g0109411	30.370	270	160	8	160	410	338	598	1.08e-23	104
MsaG006743	MtrunA17_Chr4g0063701	29.856	278	157	8	160	411	533	798	1.10e-23	104
MsaG006743	MtrunA17_Chr4g0073471	34.078	179	116	2	170	348	314	490	1.12e-23	104
MsaG006743	MtrunA17_Chr8g0353621	31.056	161	104	3	195	355	55	208	1.14e-23	100
MsaG006743	MtrunA17_Chr4g0049601	28.111	217	145	4	154	363	358	570	1.16e-23	104
MsaG006743	MtrunA17_Chr7g0239171	28.000	250	162	5	175	409	359	605	1.20e-23	103
MsaG006743	MtrunA17_Chr4g0017251	28.346	254	158	5	173	408	700	947	1.21e-23	104
MsaG006743	MtrunA17_Chr4g0063881	27.600	250	167	6	161	404	17	258	1.25e-23	102
MsaG006743	MtrunA17_Chr1g0158301	28.205	312	181	9	134	410	364	667	1.25e-23	104
MsaG006743	MtrunA17_Chr2g0313911	30.400	250	154	5	177	409	98	344	1.32e-23	101
MsaG006743	MtrunA17_Chr6g0475091	33.161	193	118	5	160	348	595	780	1.35e-23	104
MsaG006743	MtrunA17_Chr5g0441011	31.102	254	157	7	161	405	19	263	1.36e-23	102
MsaG006743	MtrunA17_Chr2g0280781	30.508	236	149	6	124	348	478	709	1.39e-23	104
MsaG006743	MtrunA17_Chr3g0091461	28.287	251	167	4	173	413	826	1073	1.48e-23	104
MsaG006743	MtrunA17_Chr3g0114851	35.227	176	110	2	174	348	545	717	1.48e-23	104
MsaG006743	MtrunA17_Chr7g0247831	31.696	224	135	5	147	357	530	748	1.50e-23	104
MsaG006743	MtrunA17_Chr8g0347661	31.579	190	124	3	174	360	595	781	1.51e-23	104
MsaG006743	MtrunA17_Chr7g0236531	28.958	259	162	7	170	410	58	312	1.51e-23	101
MsaG006743	MtrunA17_Chr4g0017241	27.778	270	159	6	173	409	498	764	1.54e-23	103
MsaG006743	MtrunA17_Chr3g0093161	33.854	192	116	4	161	348	512	696	1.66e-23	103
MsaG006743	MtrunA17_Chr4g0065521	32.787	183	116	3	170	348	57	236	1.69e-23	101
MsaG006743	MtrunA17_Chr3g0104091	29.183	257	165	6	173	426	85	327	1.71e-23	102
MsaG006743	MtrunA17_Chr6g0467681	29.183	257	151	7	176	410	289	536	1.76e-23	103
MsaG006743	MtrunA17_Chr8g0358161	28.682	258	155	7	169	420	65	299	1.82e-23	100
MsaG006743	MtrunA17_Chr2g0329871	33.333	189	113	5	174	354	97	280	1.84e-23	100
MsaG006743	MtrunA17_Chr4g0048631	31.111	225	127	6	142	348	517	731	1.91e-23	103
MsaG006743	MtrunA17_Chr2g0320111	30.876	217	131	5	155	356	92	304	1.93e-23	102
MsaG006743	MtrunA17_Chr2g0284011	29.114	237	154	7	173	405	35	261	1.95e-23	102
MsaG006743	MtrunA17_Chr6g0455321	32.240	183	117	3	174	352	559	738	2.03e-23	103
MsaG006743	MtrunA17_Chr6g0483771	27.341	267	165	6	173	421	13	268	2.05e-23	99.4
MsaG006743	MtrunA17_Chr2g0280801	30.508	236	149	6	124	348	495	726	2.13e-23	103
MsaG006743	MtrunA17_Chr4g0035464	32.796	186	120	3	169	351	703	886	2.17e-23	103
MsaG006743	MtrunA17_Chr5g0439701	26.837	313	182	8	131	411	290	587	2.21e-23	103
MsaG006743	MtrunA17_Chr1g0148511	28.821	229	150	4	140	359	408	632	2.21e-23	103
MsaG006743	MtrunA17_Chr1g0181731	32.020	203	125	4	156	348	597	796	2.23e-23	103
MsaG006743	MtrunA17_Chr2g0334261	33.871	186	111	4	174	352	483	663	2.28e-23	103
MsaG006743	MtrunA17_Chr1g0206451	30.275	218	138	5	154	360	372	586	2.39e-23	103
MsaG006743	MtrunA17_Chr1g0209511	28.625	269	153	8	170	409	336	594	2.44e-23	103
MsaG006743	MtrunA17_Chr7g0236161	34.270	178	110	4	173	346	493	667	2.56e-23	103
MsaG006743	MtrunA17_Chr8g0357991	31.863	204	128	4	153	348	484	684	2.60e-23	103
MsaG006743	MtrunA17_Chr5g0412141	32.000	200	130	3	154	348	137	335	2.60e-23	102
MsaG006743	MtrunA17_Chr4g0065541	32.240	183	117	3	170	348	458	637	2.71e-23	103
MsaG006743	MtrunA17_Chr2g0326901	29.496	278	160	8	173	421	246	516	2.79e-23	102
MsaG006743	MtrunA17_Chr5g0424501	30.180	222	143	6	186	405	229	440	2.90e-23	102
MsaG006743	MtrunA17_Chr4g0048581	32.778	180	114	3	173	348	554	730	3.01e-23	103
MsaG006743	MtrunA17_Chr7g0236691	32.222	180	115	3	173	348	523	699	3.06e-23	103
MsaG006743	MtrunA17_Chr7g0236231	29.008	262	152	6	173	410	541	792	3.10e-23	103
MsaG006743	MtrunA17_Chr5g0419721	28.897	263	166	6	172	413	660	922	3.13e-23	103
MsaG006743	MtrunA17_Chr5g0403051	30.303	264	158	8	176	421	355	610	3.15e-23	102
MsaG006743	MtrunA17_Chr4g0042381	32.778	180	114	3	173	348	476	652	3.18e-23	103
MsaG006743	MtrunA17_Chr8g0384301	27.848	237	159	6	173	405	322	550	3.18e-23	102
MsaG006743	MtrunA17_Chr3g0135921	33.772	228	131	8	138	352	312	532	3.31e-23	102
MsaG006743	MtrunA17_Chr6g0467711	32.984	191	114	5	161	345	415	597	3.39e-23	102
MsaG006743	MtrunA17_Chr8g0346071	29.242	277	178	8	135	405	1	265	3.43e-23	101
MsaG006743	MtrunA17_Chr6g0483831	27.715	267	164	6	173	421	13	268	3.44e-23	99.0
MsaG006743	MtrunA17_Chr3g0130151	27.826	230	155	6	178	405	275	495	3.45e-23	102
MsaG006743	MtrunA17_Chr4g0049581	27.174	276	176	7	154	408	350	621	3.80e-23	102
MsaG006743	MtrunA17_Chr5g0439631	26.183	317	187	8	127	411	294	595	3.85e-23	102
MsaG006743	MtrunA17_Chr6g0467661	29.183	257	151	7	176	410	289	536	3.91e-23	102
MsaG006743	MtrunA17_Chr1g0165971	28.287	251	159	5	173	404	804	1052	3.93e-23	103
MsaG006743	MtrunA17_Chr2g0323231	27.090	299	189	9	142	415	163	457	4.15e-23	101
MsaG006743	MtrunA17_Chr8g0354281	28.626	262	153	8	173	410	358	609	4.22e-23	102
MsaG006743	MtrunA17_Chr8g0361441	33.146	178	112	3	175	348	531	705	4.29e-23	102
MsaG006743	MtrunA17_Chr7g0251771	28.137	263	156	7	173	411	74	327	4.36e-23	100
MsaG006743	MtrunA17_Chr7g0226891	32.075	212	133	4	145	348	39	247	4.53e-23	100
MsaG006743	MtrunA17_Chr4g0072891	31.373	204	129	5	160	358	278	475	4.54e-23	102
MsaG006743	MtrunA17_Chr3g0093601	35.450	189	108	6	165	348	120	299	4.61e-23	100
MsaG006743	MtrunA17_Chr8g0341011	33.146	178	113	3	174	348	593	767	4.84e-23	102
MsaG006743	MtrunA17_Chr3g0143961	28.409	264	161	6	170	411	87	344	4.91e-23	100
MsaG006743	MtrunA17_Chr1g0165261	27.413	259	159	5	173	408	341	593	5.10e-23	102
MsaG006743	MtrunA17_Chr1g0201241	28.295	258	160	6	172	408	745	998	5.31e-23	102
MsaG006743	MtrunA17_Chr3g0125381	27.861	201	139	3	205	405	7	201	5.53e-23	96.7
MsaG006743	MtrunA17_Chr8g0340111	32.420	219	133	5	142	348	489	704	5.79e-23	102
MsaG006743	MtrunA17_Chr5g0448661	28.137	263	156	7	173	411	132	385	5.81e-23	100
MsaG006743	MtrunA17_Chr1g0154371	27.798	277	177	6	154	410	356	629	5.82e-23	102
MsaG006743	MtrunA17_Chr4g0042391	32.222	180	115	3	173	348	476	652	5.89e-23	102
MsaG006743	MtrunA17_Chr4g0065211	29.720	286	161	13	151	411	1117	1387	5.94e-23	102
MsaG006743	MtrunA17_Chr3g0088321	32.967	182	112	4	170	345	72	249	6.04e-23	100
MsaG006743	MtrunA17_Chr3g0119041	29.851	268	152	9	160	404	354	608	6.25e-23	102
MsaG006743	MtrunA17_Chr2g0284031	29.741	232	153	6	176	405	57	280	6.42e-23	101
MsaG006743	MtrunA17_Chr8g0361281	30.882	204	128	5	154	348	513	712	6.52e-23	102
MsaG006743	MtrunA17_Chr3g0137191	27.888	251	159	6	175	408	90	335	6.67e-23	99.8
MsaG006743	MtrunA17_Chr3g0079051	31.925	213	131	5	147	350	447	654	6.72e-23	102
MsaG006743	MtrunA17_Chr6g0474871	33.161	193	118	5	160	348	579	764	6.78e-23	102
MsaG006743	MtrunA17_Chr1g0169841	30.556	180	123	2	173	351	835	1013	6.97e-23	102
MsaG006743	MtrunA17_Chr2g0312651	29.572	257	156	6	173	408	830	1082	7.17e-23	102
MsaG006743	MtrunA17_Chr1g0157811	34.078	179	108	5	173	345	222	396	7.27e-23	101
MsaG006743	MtrunA17_Chr6g0488761	32.857	210	123	7	155	352	486	689	7.29e-23	102
MsaG006743	MtrunA17_Chr5g0432471	27.468	233	155	7	176	404	38	260	7.31e-23	100
MsaG006743	MtrunA17_Chr8g0354441	31.050	219	130	6	143	348	339	549	7.33e-23	101
MsaG006743	MtrunA17_Chr1g0158541	27.476	313	180	8	134	409	366	668	7.38e-23	102
MsaG006743	MtrunA17_Chr1g0158411	33.503	197	117	6	159	345	409	601	7.75e-23	101
MsaG006743	MtrunA17_Chr1g0160711	33.333	180	109	4	173	345	350	525	7.81e-23	101
MsaG006743	MtrunA17_Chr8g0357961	31.863	204	128	4	153	348	483	683	7.91e-23	102
MsaG006743	MtrunA17_Chr5g0428111	31.489	235	141	8	161	390	518	737	8.06e-23	102
MsaG006743	MtrunA17_Chr4g0073641	30.072	276	150	9	169	404	687	959	8.56e-23	102
MsaG006743	MtrunA17_Chr3g0104881	28.767	219	140	5	146	348	485	703	8.62e-23	101
MsaG006743	MtrunA17_Chr1g0206531	33.005	203	125	4	154	348	337	536	8.66e-23	101
MsaG006743	MtrunA17_Chr1g0160761	33.333	180	109	4	173	345	357	532	8.88e-23	101
MsaG006743	MtrunA17_Chr8g0351491	26.738	187	130	3	176	362	42	221	9.00e-23	97.8
MsaG006743	MtrunA17_Chr6g0475201	33.333	180	113	4	173	348	597	773	9.45e-23	101
MsaG006743	MtrunA17_Chr3g0079031	33.333	186	113	4	174	353	468	648	9.73e-23	101
MsaG006743	MtrunA17_Chr4g0065561	30.542	203	130	4	154	348	446	645	9.98e-23	101
MsaG006743	MtrunA17_Chr7g0250931	30.189	265	145	8	173	409	571	823	1.02e-22	101
MsaG006743	MtrunA17_Chr3g0132671	34.123	211	123	7	194	400	93	291	1.02e-22	100
MsaG006743	MtrunA17_Chr5g0424651	30.180	222	143	6	186	405	358	569	1.03e-22	101
MsaG006743	MtrunA17_Chr7g0231541	29.412	255	151	7	170	404	464	709	1.06e-22	101
MsaG006743	MtrunA17_Chr7g0232131	29.412	255	151	7	170	404	931	1176	1.08e-22	101
MsaG006743	MtrunA17_Chr1g0158311	29.391	279	166	9	176	427	313	587	1.18e-22	100
MsaG006743	MtrunA17_Chr6g0484021	28.819	288	173	9	155	415	305	587	1.19e-22	100
MsaG006743	MtrunA17_Chr1g0157901	32.164	171	109	3	185	348	2	172	1.28e-22	97.4
MsaG006743	MtrunA17_Chr6g0467281	28.625	269	162	8	169	411	500	764	1.28e-22	101
MsaG006743	MtrunA17_Chr8g0379931	25.984	254	171	4	170	409	729	979	1.29e-22	101
MsaG006743	MtrunA17_Chr2g0277081	28.794	257	158	7	172	409	709	959	1.29e-22	101
MsaG006743	MtrunA17_Chr1g0165231	27.413	259	159	5	173	408	902	1154	1.30e-22	101
MsaG006743	MtrunA17_Chr1g0165301	27.413	259	159	5	173	408	902	1154	1.30e-22	101
MsaG006743	MtrunA17_Chr8g0359691	26.205	332	211	9	154	455	663	990	1.30e-22	101
MsaG006743	MtrunA17_Chr8g0354421	32.127	221	125	7	143	348	352	562	1.30e-22	100
MsaG006743	MtrunA17_Chr5g0402071	27.737	274	168	6	174	425	190	455	1.32e-22	100
MsaG006743	MtrunA17_Chr1g0209431	33.333	192	117	4	173	359	360	545	1.33e-22	100
MsaG006743	MtrunA17_Chr7g0236881	35.829	187	108	5	173	352	637	818	1.36e-22	101
MsaG006743	MtrunA17_Chr8g0370461	26.538	260	164	6	173	411	124	377	1.38e-22	99.4
MsaG006743	MtrunA17_Chr2g0278891	27.526	287	177	7	154	409	290	576	1.50e-22	100
MsaG006743	MtrunA17_Chr7g0245221	27.715	267	150	5	174	411	644	896	1.54e-22	101
MsaG006743	MtrunA17_Chr1g0158321	33.333	180	109	4	176	348	59	234	1.54e-22	98.6
MsaG006743	MtrunA17_Chr5g0428101	28.309	272	158	8	173	419	524	783	1.59e-22	100
MsaG006743	MtrunA17_Chr8g0360201	34.715	193	113	5	161	348	421	605	1.60e-22	100
MsaG006743	MtrunA17_Chr1g0158441	31.937	191	116	5	161	345	43	225	1.62e-22	98.6
MsaG006743	MtrunA17_Chr1g0158091	32.653	196	118	6	160	345	77	268	1.66e-22	98.6
MsaG006743	MtrunA17_Chr4g0042341	33.889	180	112	3	173	348	546	722	1.73e-22	100
MsaG006743	MtrunA17_Chr6g0483981	32.178	202	121	5	159	348	272	469	1.78e-22	100
MsaG006743	MtrunA17_Chr4g0005201	30.233	258	153	8	173	411	525	774	1.80e-22	100
MsaG006743	MtrunA17_Chr7g0251061	29.084	251	155	7	111	348	310	550	1.84e-22	100
MsaG006743	MtrunA17_Chr8g0361141	34.783	184	111	4	170	348	536	715	1.84e-22	100
MsaG006743	MtrunA17_Chr7g0239191	27.888	251	161	5	175	409	399	645	1.87e-22	100
MsaG006743	MtrunA17_Chr1g0158711	28.682	258	152	6	176	410	286	534	1.90e-22	100
MsaG006743	MtrunA17_Chr8g0367071	30.526	190	126	3	175	363	381	565	1.97e-22	100
MsaG006743	MtrunA17_Chr1g0153851	28.244	262	161	7	170	409	68	324	2.02e-22	97.8
MsaG006743	MtrunA17_Chr2g0280711	30.734	218	137	5	142	348	515	729	2.02e-22	100
MsaG006743	MtrunA17_Chr1g0202711	29.817	218	140	5	142	350	490	703	2.08e-22	100
MsaG006743	MtrunA17_Chr2g0327671	32.432	222	136	6	138	350	486	702	2.19e-22	100
MsaG006743	MtrunA17_Chr3g0082941	31.892	185	109	5	173	348	196	372	2.24e-22	99.8
MsaG006743	MtrunA17_Chr2g0280791	31.667	180	116	3	173	348	544	720	2.31e-22	100
MsaG006743	MtrunA17_Chr7g0250491	29.600	250	147	8	176	404	811	1052	2.33e-22	100
MsaG006743	MtrunA17_Chr2g0280831	28.390	236	155	5	124	348	62	294	2.34e-22	99.0
MsaG006743	MtrunA17_Chr5g0418011	26.780	295	191	7	135	408	1	291	2.43e-22	97.4
MsaG006743	MtrunA17_Chr1g0158771	33.889	180	108	4	176	348	314	489	2.50e-22	100
MsaG006743	MtrunA17_Chr3g0095081	28.794	257	161	6	172	408	745	999	2.53e-22	100
MsaG006743	MtrunA17_Chr5g0439561	25.749	334	204	10	132	436	317	635	2.62e-22	100
MsaG006743	MtrunA17_Chr7g0236651	31.667	180	116	3	173	348	508	684	2.65e-22	100
MsaG006743	MtrunA17_Chr2g0297961	36.872	179	103	5	173	346	96	269	2.74e-22	98.6
MsaG006743	MtrunA17_Chr7g0239261	27.888	251	161	5	175	409	364	610	2.75e-22	100
MsaG006743	MtrunA17_Chr3g0125461	27.059	255	160	5	176	411	469	716	2.77e-22	100
MsaG006743	MtrunA17_Chr2g0280681	25.424	354	229	9	104	429	449	795	2.77e-22	100
MsaG006743	MtrunA17_Chr4g0042441	29.762	252	157	7	176	410	526	774	3.07e-22	100
MsaG006743	MtrunA17_Chr3g0106181	34.286	175	108	3	176	348	84	253	3.13e-22	97.4
MsaG006743	MtrunA17_Chr1g0158761	34.615	182	110	4	170	345	353	531	3.23e-22	99.8
MsaG006743	MtrunA17_Chr6g0474811	32.124	193	120	5	160	348	587	772	3.25e-22	100
MsaG006743	MtrunA17_Chr2g0314881	28.346	254	162	5	173	409	251	501	3.26e-22	99.8
MsaG006743	MtrunA17_Chr8g0358121	32.105	190	122	3	173	358	485	671	3.29e-22	100
MsaG006743	MtrunA17_Chr2g0333091	32.402	179	113	3	174	348	515	689	3.44e-22	100
MsaG006743	MtrunA17_Chr1g0209381	27.181	298	183	9	142	411	312	603	3.47e-22	99.8
MsaG006743	MtrunA17_Chr8g0366971	28.708	209	138	4	147	348	68	272	3.56e-22	97.8
MsaG006743	MtrunA17_Chr3g0140551	31.633	196	117	2	173	351	720	915	3.59e-22	100
MsaG006743	MtrunA17_Chr1g0206521	28.421	285	174	8	173	430	358	639	3.61e-22	100
MsaG006743	MtrunA17_Chr1g0206521	29.528	254	160	6	173	410	1000	1250	6.26e-22	99.4
MsaG006743	MtrunA17_Chr7g0236551	32.222	180	115	3	173	348	511	687	3.64e-22	99.8
MsaG006743	MtrunA17_Chr8g0340871	27.888	251	162	6	174	409	599	845	3.64e-22	100
MsaG006743	MtrunA17_Chr4g0018801	25.260	289	179	6	162	424	497	774	3.67e-22	99.8
MsaG006743	MtrunA17_Chr1g0158611	33.333	180	109	4	176	348	76	251	3.83e-22	97.4
MsaG006743	MtrunA17_Chr7g0233881	28.462	260	164	6	173	412	692	949	3.87e-22	99.8
MsaG006743	MtrunA17_Chr7g0233841	33.516	182	117	2	173	351	60	240	3.89e-22	96.7
MsaG006743	MtrunA17_Chr6g0467301	27.881	269	164	7	169	411	505	769	4.17e-22	99.8
MsaG006743	MtrunA17_Chr8g0358071	28.099	242	163	4	115	348	437	675	4.25e-22	99.8
MsaG006743	MtrunA17_Chr8g0389011	31.455	213	124	7	155	352	498	703	4.29e-22	99.8
MsaG006743	MtrunA17_Chr3g0081011	28.906	256	160	7	173	410	362	613	4.29e-22	99.4
MsaG006743	MtrunA17_Chr8g0389031	31.455	213	124	7	155	352	262	467	4.32e-22	99.4
MsaG006743	MtrunA17_Chr7g0239181	28.000	250	162	5	175	409	376	622	4.33e-22	99.4
MsaG006743	MtrunA17_Chr7g0232171	30.242	248	145	7	170	399	836	1073	4.38e-22	99.8
MsaG006743	MtrunA17_Chr7g0242201	30.208	192	127	3	173	360	66	254	4.56e-22	97.4
MsaG006743	MtrunA17_Chr8g0361611	27.645	293	181	8	141	409	435	720	4.56e-22	99.4
MsaG006743	MtrunA17_Chr1g0157951	33.516	182	111	5	170	345	200	377	4.69e-22	98.6
MsaG006743	MtrunA17_Chr1g0202831	29.817	218	143	6	190	405	453	662	4.70e-22	99.8
MsaG006743	MtrunA17_Chr2g0328171	28.839	267	147	9	173	429	106	339	4.83e-22	97.8
MsaG006743	MtrunA17_Chr4g0042401	29.699	266	158	8	175	419	529	786	4.84e-22	99.4
MsaG006743	MtrunA17_Chr6g0485761	31.500	200	128	3	155	348	295	491	5.04e-22	99.4
MsaG006743	MtrunA17_Chr1g0206351	29.242	277	164	9	160	415	367	632	5.36e-22	99.0
MsaG006743	MtrunA17_Chr7g0239321	28.287	251	160	5	175	409	365	611	5.37e-22	99.0
MsaG006743	MtrunA17_Chr7g0221711	27.907	258	161	5	174	411	645	897	5.49e-22	99.4
MsaG006743	MtrunA17_Chr6g0453001	27.203	261	167	7	173	413	86	343	5.51e-22	97.8
MsaG006743	MtrunA17_Chr7g0251101	30.688	189	118	4	169	348	377	561	5.53e-22	99.0
MsaG006743	MtrunA17_Chr7g0274651	27.619	210	140	5	154	355	369	574	5.55e-22	99.0
MsaG006743	MtrunA17_Chr7g0251001	31.746	189	116	4	169	348	77	261	5.59e-22	97.4
MsaG006743	MtrunA17_Chr7g0232451	28.916	249	157	6	173	404	750	995	5.70e-22	99.4
MsaG006743	MtrunA17_Chr3g0143951	29.249	253	159	7	173	409	114	362	5.71e-22	97.8
MsaG006743	MtrunA17_Chr8g0391231	33.333	195	110	5	170	348	354	544	5.77e-22	99.0
MsaG006743	MtrunA17_Chr7g0222321	26.645	304	194	10	140	418	713	1012	5.79e-22	99.4
MsaG006743	MtrunA17_Chr5g0439291	28.000	250	155	7	173	403	764	1007	5.83e-22	99.4
MsaG006743	MtrunA17_Chr6g0455651	32.778	180	115	3	173	351	138	312	6.21e-22	97.8
MsaG006743	MtrunA17_Chr7g0263591	31.707	205	123	5	156	348	603	802	6.23e-22	99.4
MsaG006743	MtrunA17_Chr4g0053571	28.405	257	165	6	169	409	516	769	6.30e-22	99.4
MsaG006743	MtrunA17_Chr7g0245131	28.571	252	164	7	104	346	487	731	6.31e-22	99.4
MsaG006743	MtrunA17_Chr4g0042351	29.557	203	132	4	154	348	453	652	6.35e-22	99.0
MsaG006743	MtrunA17_Chr8g0358031	32.778	180	114	3	173	348	502	678	6.46e-22	99.0
MsaG006743	MtrunA17_Chr8g0340051	30.455	220	136	6	142	348	13	228	6.68e-22	96.7
MsaG006743	MtrunA17_Chr1g0209361	31.163	215	133	5	154	359	342	550	6.92e-22	99.0
MsaG006743	MtrunA17_Chr7g0220741	27.526	287	184	5	154	422	305	585	6.93e-22	98.6
MsaG006743	MtrunA17_Chr8g0376061	26.978	278	172	8	169	425	354	621	6.97e-22	99.0
MsaG006743	MtrunA17_Chr1g0158751	33.516	182	112	4	170	345	114	292	6.97e-22	97.4
MsaG006743	MtrunA17_Chr1g0203631	29.482	251	156	5	172	404	1014	1261	7.12e-22	99.4
MsaG006743	MtrunA17_Chr8g0367241	31.461	178	119	3	173	348	187	363	7.16e-22	98.2
MsaG006743	MtrunA17_Chr5g0393981	28.037	321	182	13	122	411	369	671	7.35e-22	99.0
MsaG006743	MtrunA17_Chr8g0366981	29.018	224	143	5	151	362	293	512	7.73e-22	98.6
MsaG006743	MtrunA17_Chr3g0079661	30.000	260	155	9	173	411	938	1191	7.81e-22	99.0
MsaG006743	MtrunA17_Chr1g0158631	28.788	264	155	8	170	409	402	656	7.97e-22	98.6
MsaG006743	MtrunA17_Chr4g0028841	29.720	286	171	9	173	433	250	530	8.12e-22	98.6
MsaG006743	MtrunA17_Chr6g0487061	29.412	187	118	3	176	348	719	905	8.21e-22	99.0
MsaG006743	MtrunA17_Chr5g0408941	28.235	255	157	8	176	411	124	371	8.26e-22	97.4
MsaG006743	MtrunA17_Chr1g0157791	33.520	179	109	5	173	345	409	583	8.65e-22	98.6
MsaG006743	MtrunA17_Chr6g0483821	33.333	210	116	7	156	348	359	561	8.74e-22	98.6
MsaG006743	MtrunA17_Chr4g0060531	33.333	180	112	5	173	348	114	289	8.93e-22	96.7
MsaG006743	MtrunA17_Chr2g0318811	33.333	180	113	3	173	348	523	699	9.28e-22	98.6
MsaG006743	MtrunA17_Chr8g0361251	32.812	192	118	4	161	348	521	705	9.47e-22	98.6
MsaG006743	MtrunA17_Chr8g0354351	28.302	265	150	8	173	410	356	607	9.60e-22	98.2
MsaG006743	MtrunA17_Chr4g0030301	28.049	246	149	5	186	411	13	250	9.87e-22	94.7
MsaG006743	MtrunA17_Chr7g0239361	28.346	254	159	5	175	409	382	631	1.00e-21	98.2
MsaG006743	MtrunA17_Chr5g0443691	27.059	255	164	5	176	411	126	377	1.01e-21	96.7

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG006743	AT4G18950.1	69.142	431	127	2	8	433	9	438	0.0	630
MsaG006743	AT4G18950.2	68.618	427	124	3	8	429	9	430	0.0	614
MsaG006743	AT3G58760.1	63.326	469	155	4	1	455	3	468	0.0	592
MsaG006743	AT3G58760.3	63.326	469	155	4	1	455	66	531	0.0	592
MsaG006743	AT3G58760.5	63.326	469	155	4	1	455	66	531	0.0	592
MsaG006743	AT3G58760.6	66.944	360	105	3	1	346	3	362	6.43e-171	484
MsaG006743	AT3G58760.2	66.944	360	105	3	1	346	66	425	6.81e-170	484
MsaG006743	AT3G58760.4	66.944	360	105	3	1	346	66	425	6.81e-170	484
MsaG006743	AT2G43850.3	47.319	429	212	4	8	422	43	471	2.25e-132	390
MsaG006743	AT2G43850.1	47.319	429	212	4	8	422	43	471	2.86e-132	390
MsaG006743	AT2G43850.2	47.086	429	213	4	8	422	43	471	1.26e-131	389
MsaG006743	AT2G31800.1	47.100	431	215	5	4	422	39	468	1.93e-130	385
MsaG006743	AT3G59830.1	45.940	431	221	4	4	422	39	469	1.34e-124	371
MsaG006743	AT1G14000.1	46.000	400	193	9	42	423	41	435	1.06e-108	329
MsaG006743	AT4G35780.1	36.364	286	160	8	145	422	284	555	2.21e-50	180
MsaG006743	AT2G17700.1	36.559	279	155	8	145	415	278	542	4.85e-50	179
MsaG006743	AT4G38470.2	36.842	285	155	10	146	421	283	551	2.14e-47	171
MsaG006743	AT4G38470.1	37.091	275	149	9	146	411	283	542	1.72e-46	169
MsaG006743	AT1G62400.1	36.187	257	130	7	169	409	103	341	3.92e-44	159
MsaG006743	AT5G49470.1	37.500	272	157	9	145	411	196	459	5.01e-44	161
MsaG006743	AT3G06640.1	36.458	288	161	9	145	421	438	714	2.32e-43	162
MsaG006743	AT5G49470.7	37.500	272	157	9	145	411	356	619	6.37e-43	160
MsaG006743	AT5G49470.4	37.500	272	157	9	145	411	457	720	9.01e-43	161
MsaG006743	AT5G49470.3	37.500	272	157	9	145	411	483	746	1.02e-42	161
MsaG006743	AT3G06640.2	36.727	275	155	8	145	411	438	701	2.52e-42	159
MsaG006743	AT3G06640.3	36.727	275	155	8	145	411	438	701	2.52e-42	159
MsaG006743	AT4G38470.3	40.465	215	108	7	146	352	283	485	2.72e-41	154
MsaG006743	AT1G67890.1	36.162	271	161	9	145	411	479	741	2.13e-40	154
MsaG006743	AT4G23050.1	33.704	270	152	8	160	416	472	727	2.70e-40	154
MsaG006743	AT4G23050.2	33.704	270	152	8	160	416	473	728	2.85e-40	154
MsaG006743	AT3G06620.1	36.029	272	161	8	145	411	486	749	3.14e-40	154
MsaG006743	AT1G18160.1	34.629	283	164	9	142	415	704	974	3.35e-40	154
MsaG006743	AT1G73660.1	37.349	249	136	8	171	411	767	1003	1.14e-39	153
MsaG006743	AT3G01490.1	33.775	302	159	12	145	416	100	390	1.96e-39	147
MsaG006743	AT4G24480.3	35.135	259	150	7	164	414	681	929	2.86e-39	151
MsaG006743	AT4G24480.2	35.135	259	150	7	164	414	681	929	3.04e-39	151
MsaG006743	AT5G11850.1	33.788	293	171	10	125	411	589	864	4.11e-39	151
MsaG006743	AT5G50000.1	33.557	298	165	10	145	416	74	364	4.36e-39	145
MsaG006743	AT5G58950.1	35.897	234	115	7	193	411	253	466	5.65e-39	148
MsaG006743	AT3G06630.2	36.508	252	148	8	164	411	446	689	1.29e-38	149
MsaG006743	AT3G22750.1	31.157	337	191	12	109	416	33	357	1.34e-38	144
MsaG006743	AT5G03730.2	36.131	274	161	7	142	411	545	808	1.63e-38	149
MsaG006743	AT5G03730.1	36.131	274	161	7	142	411	545	808	1.63e-38	149
MsaG006743	AT5G66710.1	35.983	239	129	8	190	416	112	338	2.55e-38	144
MsaG006743	AT5G49470.5	40.187	214	119	6	145	354	483	691	5.32e-38	147
MsaG006743	AT5G49470.6	40.187	214	119	6	145	354	483	691	5.57e-38	147
MsaG006743	AT1G08720.1	37.154	253	145	8	164	411	681	924	9.52e-38	147
MsaG006743	AT4G31170.7	34.545	275	148	11	170	428	145	403	1.28e-37	142
MsaG006743	AT4G31170.6	34.545	275	148	11	170	428	145	403	1.28e-37	142
MsaG006743	AT4G31170.5	34.545	275	148	11	170	428	145	403	1.28e-37	142
MsaG006743	AT4G31170.1	34.545	275	148	11	170	428	145	403	1.28e-37	142
MsaG006743	AT4G31170.2	34.545	275	148	11	170	428	145	403	1.28e-37	142
MsaG006743	AT4G31170.3	34.545	275	148	11	170	428	145	403	1.28e-37	142
MsaG006743	AT4G31170.8	34.545	275	148	11	170	428	145	403	1.28e-37	142
MsaG006743	AT4G14780.1	31.250	336	191	12	109	416	20	343	1.43e-37	141
MsaG006743	AT4G24480.1	33.969	262	154	6	164	414	681	934	2.01e-37	146
MsaG006743	AT1G67890.4	39.810	211	119	6	145	352	351	556	3.63e-37	144
MsaG006743	AT1G67890.3	39.810	211	119	6	145	352	479	684	6.64e-37	144
MsaG006743	AT1G67890.2	39.810	211	119	6	145	352	479	684	6.64e-37	144
MsaG006743	AT3G46930.2	33.333	276	140	9	171	425	220	472	1.03e-36	141
MsaG006743	AT3G46930.1	33.333	276	140	9	171	425	185	437	1.16e-36	140
MsaG006743	AT3G63260.1	31.353	303	170	10	145	416	75	370	9.81e-36	136
MsaG006743	AT1G18160.2	35.135	259	147	9	142	391	704	950	1.21e-35	140
MsaG006743	AT3G06630.6	41.081	185	101	5	164	345	362	541	3.22e-35	138
MsaG006743	AT3G06630.4	41.081	185	101	5	164	345	446	625	5.61e-35	138
MsaG006743	AT3G06630.3	41.081	185	101	5	164	345	446	625	5.61e-35	138
MsaG006743	AT3G06630.5	41.081	185	101	5	164	345	446	625	5.61e-35	138
MsaG006743	AT3G06630.1	41.081	185	101	5	164	345	446	625	6.12e-35	138
MsaG006743	AT2G24360.1	31.786	280	160	10	160	428	143	402	1.37e-34	134
MsaG006743	AT1G08720.2	37.768	233	131	8	164	391	681	904	8.01e-34	135
MsaG006743	AT3G50730.1	32.530	249	145	8	176	411	61	299	1.99e-33	130
MsaG006743	AT2G42640.4	31.599	269	168	9	145	410	482	737	6.71e-33	132
MsaG006743	AT2G42640.1	31.599	269	168	9	145	410	520	775	8.38e-33	132
MsaG006743	AT5G50180.1	29.467	319	200	10	141	445	8	315	2.46e-32	126
MsaG006743	AT3G27560.1	34.363	259	146	9	171	415	45	293	7.31e-32	125
MsaG006743	AT3G01490.2	36.522	230	109	10	145	345	100	321	8.50e-32	125
MsaG006743	AT3G50720.1	32.685	257	149	8	176	419	73	318	1.07e-31	125
MsaG006743	AT5G50000.2	35.398	226	117	8	145	345	74	295	3.87e-31	122
MsaG006743	AT5G37450.3	33.840	263	155	6	173	420	653	911	6.61e-31	127
MsaG006743	AT5G37450.4	32.082	293	176	7	147	420	420	708	7.06e-31	126
MsaG006743	AT5G01850.1	33.198	247	142	9	176	408	42	279	8.25e-31	122
MsaG006743	AT5G37450.2	33.840	263	155	6	173	420	677	935	8.60e-31	126
MsaG006743	AT5G37450.1	33.840	263	155	6	173	420	629	887	8.75e-31	126
MsaG006743	AT5G40540.1	32.558	258	152	8	171	415	45	293	8.84e-31	122
MsaG006743	AT3G06630.7	40.331	181	99	6	164	341	446	620	1.96e-30	124
MsaG006743	AT4G04540.1	34.432	273	148	9	161	415	367	626	3.32e-30	124
MsaG006743	AT4G04540.4	34.432	273	148	9	161	415	338	597	3.56e-30	124
MsaG006743	AT3G53930.2	28.897	263	167	6	154	405	19	272	5.18e-30	124
MsaG006743	AT3G53590.1	30.877	285	165	9	155	415	621	897	5.41e-30	124
MsaG006743	AT3G53930.1	28.897	263	167	6	154	405	19	272	5.47e-30	124
MsaG006743	AT4G29990.1	29.592	294	183	9	146	418	563	853	6.92e-30	124
MsaG006743	AT3G46930.6	35.176	199	94	6	171	352	124	304	1.20e-29	119
MsaG006743	AT5G40540.2	32.895	228	133	7	201	417	1	219	2.43e-29	116
MsaG006743	AT3G46930.4	35.176	199	94	6	171	352	220	400	2.56e-29	119
MsaG006743	AT3G46930.3	35.176	199	94	6	171	352	220	400	2.95e-29	119
MsaG006743	AT4G24400.2	29.562	274	164	8	140	404	3	256	3.26e-29	119
MsaG006743	AT3G46930.5	35.176	199	94	6	171	352	185	365	4.02e-29	118
MsaG006743	AT3G63260.2	31.618	272	148	9	140	380	70	334	6.09e-29	117
MsaG006743	AT4G24400.1	30.435	253	156	7	161	404	15	256	9.14e-29	118
MsaG006743	AT3G58640.1	29.630	270	171	10	145	408	545	801	9.66e-29	120
MsaG006743	AT3G58640.2	29.630	270	171	10	145	408	545	801	9.66e-29	120
MsaG006743	AT2G01820.1	32.950	261	152	6	173	411	607	866	1.12e-28	120
MsaG006743	AT1G19390.1	31.818	264	150	6	170	411	470	725	1.61e-28	119
MsaG006743	AT5G49770.1	30.833	240	146	5	195	416	675	912	1.72e-28	119
MsaG006743	AT4G04490.1	33.333	255	141	8	173	408	362	606	1.94e-28	119
MsaG006743	AT1G69730.1	30.502	259	160	4	170	411	466	721	2.09e-28	119
MsaG006743	AT2G19190.1	29.078	282	171	9	153	411	570	845	2.10e-28	119
MsaG006743	AT1G69270.1	30.802	237	145	5	193	411	300	535	2.34e-28	118
MsaG006743	AT2G19230.1	28.626	262	168	5	164	409	582	840	2.38e-28	119
MsaG006743	AT1G66150.1	32.567	261	152	6	173	411	610	868	2.71e-28	119
MsaG006743	AT4G23240.2	30.657	274	165	6	160	415	41	307	3.53e-28	115
MsaG006743	AT2G19230.2	28.626	262	168	5	164	409	581	839	3.84e-28	118
MsaG006743	AT2G31010.1	30.496	282	153	11	145	408	511	767	4.52e-28	118
MsaG006743	AT2G31010.2	30.496	282	153	11	145	408	511	767	4.52e-28	118
MsaG006743	AT4G04570.1	33.955	268	146	9	161	410	362	616	4.72e-28	117
MsaG006743	AT1G24650.1	36.458	192	116	3	173	359	569	759	6.18e-28	117
MsaG006743	AT2G37840.1	28.030	264	168	7	154	405	11	264	7.50e-28	117
MsaG006743	AT1G79680.1	30.502	259	160	4	170	411	452	707	7.72e-28	117
MsaG006743	AT1G04700.1	31.849	292	165	12	151	420	762	1041	7.91e-28	117
MsaG006743	AT1G04700.2	31.849	292	165	12	151	420	762	1041	7.91e-28	117
MsaG006743	AT5G01950.2	30.466	279	168	9	154	411	540	813	8.39e-28	117
MsaG006743	AT5G01950.3	30.466	279	168	9	154	411	625	898	9.05e-28	117
MsaG006743	AT5G01950.1	30.466	279	168	9	154	411	625	898	9.05e-28	117
MsaG006743	AT5G01950.4	30.466	279	168	9	154	411	625	898	9.05e-28	117
MsaG006743	AT5G01950.8	30.466	279	168	9	154	411	625	898	9.05e-28	117
MsaG006743	AT2G26980.2	31.890	254	155	8	161	405	20	264	9.94e-28	111
MsaG006743	AT1G17230.1	31.786	280	161	11	154	408	798	1072	1.16e-27	117
MsaG006743	AT1G17230.2	31.786	280	161	11	154	408	798	1072	1.20e-27	117
MsaG006743	AT4G31110.2	29.924	264	156	5	170	411	450	706	1.67e-27	116
MsaG006743	AT4G28490.1	31.136	273	155	8	172	415	703	971	1.78e-27	116
MsaG006743	AT4G31110.1	29.924	264	156	5	170	411	472	728	1.83e-27	116
MsaG006743	AT5G49780.1	30.126	239	150	5	195	416	575	813	2.50e-27	115
MsaG006743	AT1G30270.1	30.579	242	159	5	166	405	47	281	3.24e-27	114
MsaG006743	AT5G49780.3	30.126	239	150	5	195	416	674	912	3.30e-27	115
MsaG006743	AT5G49780.2	30.126	239	150	5	195	416	696	934	3.63e-27	115
MsaG006743	AT1G30270.2	30.579	242	159	5	166	405	47	281	4.31e-27	113
MsaG006743	AT4G00340.1	37.288	177	105	2	174	348	506	678	4.59e-27	115
MsaG006743	AT5G01850.2	34.906	212	117	8	209	408	101	303	4.73e-27	112
MsaG006743	AT4G23180.1	33.101	287	158	11	154	415	347	624	4.79e-27	114
MsaG006743	AT5G47850.1	31.405	242	144	5	190	410	491	731	5.04e-27	115
MsaG006743	AT4G00340.2	37.288	177	105	2	174	348	485	657	5.16e-27	115
MsaG006743	AT3G59110.1	30.627	271	162	5	170	420	209	473	5.40e-27	114
MsaG006743	AT1G06840.1	29.667	300	187	7	133	412	603	898	5.81e-27	115
MsaG006743	AT4G31100.1	30.682	264	154	6	170	411	463	719	6.78e-27	114
MsaG006743	AT2G42960.3	35.602	191	116	2	170	356	202	389	9.88e-27	112
MsaG006743	AT2G42960.5	35.602	191	116	2	170	356	202	389	9.88e-27	112
MsaG006743	AT2G42960.4	35.602	191	116	2	170	356	202	389	9.88e-27	112
MsaG006743	AT2G42960.1	35.602	191	116	2	170	356	202	389	9.88e-27	112
MsaG006743	AT4G04570.3	34.314	204	121	5	154	348	183	382	1.20e-26	111
MsaG006743	AT4G23240.1	30.657	274	165	6	160	415	348	614	1.21e-26	113
MsaG006743	AT1G56720.3	30.075	266	150	6	170	410	198	452	1.38e-26	112
MsaG006743	AT1G56720.1	30.075	266	150	6	170	410	198	452	1.38e-26	112
MsaG006743	AT1G56720.2	30.075	266	150	6	170	410	198	452	1.38e-26	112
MsaG006743	AT1G56720.4	30.075	266	150	6	170	410	198	452	1.38e-26	112
MsaG006743	AT4G23150.1	30.597	268	162	6	160	410	349	609	1.45e-26	113
MsaG006743	AT1G79670.1	28.750	240	155	3	188	411	455	694	1.82e-26	113
MsaG006743	AT3G21630.1	28.107	338	194	12	123	431	290	607	1.83e-26	112
MsaG006743	AT2G26980.1	31.890	254	155	8	161	405	20	264	1.92e-26	110
MsaG006743	AT1G79670.2	28.750	240	155	3	188	411	418	657	1.95e-26	113
MsaG006743	AT1G16120.1	33.679	193	122	2	170	359	448	637	1.96e-26	113
MsaG006743	AT4G00330.1	28.296	311	199	8	147	445	111	409	2.00e-26	110
MsaG006743	AT4G00330.2	28.296	311	199	8	147	445	111	409	2.00e-26	110
MsaG006743	AT1G78530.2	34.409	186	115	2	174	359	98	276	2.13e-26	108
MsaG006743	AT1G16270.1	33.210	271	147	13	160	408	868	1126	2.37e-26	113
MsaG006743	AT1G16270.2	33.210	271	147	13	160	408	868	1126	2.37e-26	113
MsaG006743	AT1G16270.3	33.210	271	147	13	160	408	868	1126	2.37e-26	113
MsaG006743	AT4G04540.2	36.458	192	111	5	161	348	367	551	2.39e-26	112
MsaG006743	AT2G26980.5	31.890	254	155	8	161	405	20	264	2.57e-26	110
MsaG006743	AT4G23320.2	31.273	275	162	8	160	415	196	462	2.71e-26	111
MsaG006743	AT4G23320.1	31.273	275	162	8	160	415	196	462	2.71e-26	111
MsaG006743	AT3G02130.1	34.302	172	110	1	176	347	899	1067	2.80e-26	113
MsaG006743	AT2G26980.3	31.890	254	155	8	161	405	20	264	2.87e-26	110
MsaG006743	AT3G02130.2	34.302	172	110	1	176	347	882	1050	2.94e-26	113
MsaG006743	AT4G23320.3	31.273	275	162	8	160	415	217	483	3.22e-26	111
MsaG006743	AT1G09440.1	30.451	266	149	6	170	410	176	430	3.68e-26	110
MsaG006743	AT1G09440.2	30.451	266	149	6	170	410	176	430	3.68e-26	110
MsaG006743	AT2G26980.4	31.890	254	155	8	161	405	30	274	3.99e-26	110
MsaG006743	AT1G16150.1	30.233	258	161	4	170	411	443	697	4.00e-26	112
MsaG006743	AT4G28650.1	30.350	257	154	7	174	408	723	976	4.78e-26	112
MsaG006743	AT3G01090.3	30.901	233	151	5	173	404	42	265	4.84e-26	110
MsaG006743	AT3G01090.1	30.901	233	151	5	173	404	42	265	4.84e-26	110
MsaG006743	AT1G29740.1	28.175	252	162	4	173	408	699	947	5.80e-26	112
MsaG006743	AT2G11520.1	32.669	251	150	7	147	388	217	457	6.22e-26	110
MsaG006743	AT4G04570.2	35.938	192	112	4	161	348	362	546	6.38e-26	111
MsaG006743	AT3G01090.2	30.901	233	151	5	173	404	65	288	6.52e-26	110
MsaG006743	AT1G28440.1	30.000	270	163	6	168	411	693	962	6.63e-26	112
MsaG006743	AT1G16110.1	34.375	192	118	2	170	356	451	639	6.91e-26	111
MsaG006743	AT3G24715.1	32.130	277	157	12	154	411	838	1102	7.07e-26	111
MsaG006743	AT3G24715.3	32.130	277	157	12	154	411	838	1102	7.07e-26	111
MsaG006743	AT3G24715.2	32.130	277	157	12	154	411	838	1102	7.07e-26	111
MsaG006743	AT3G49670.1	30.116	259	157	6	172	411	711	964	7.29e-26	111
MsaG006743	AT1G29740.2	28.175	252	162	4	173	408	699	947	7.53e-26	111
MsaG006743	AT4G29050.1	32.195	205	127	4	155	351	344	544	7.74e-26	111
MsaG006743	AT4G29050.2	32.195	205	127	4	155	351	358	558	7.87e-26	111
MsaG006743	AT4G23180.2	35.751	193	113	5	160	348	361	546	8.92e-26	110
MsaG006743	AT3G23750.1	35.567	194	115	3	173	361	600	788	9.53e-26	111
MsaG006743	AT5G01950.7	29.930	284	168	10	154	411	625	903	9.87e-26	111
MsaG006743	AT5G25930.1	34.946	186	111	3	173	348	708	893	1.01e-25	111
MsaG006743	AT4G04510.2	31.474	251	156	6	173	410	363	610	1.04e-25	110
MsaG006743	AT1G16160.1	33.143	175	114	1	188	359	466	640	1.06e-25	110
MsaG006743	AT4G04510.1	31.474	251	156	6	173	410	361	608	1.28e-25	110
MsaG006743	AT1G78530.1	34.409	186	115	2	174	359	98	276	1.29e-25	107
MsaG006743	AT3G61960.1	28.014	282	171	9	140	408	4	266	1.35e-25	110
MsaG006743	AT3G58690.1	31.628	215	130	6	155	356	87	297	1.38e-25	108
MsaG006743	AT3G61960.2	28.014	282	171	9	140	408	4	266	1.56e-25	110
MsaG006743	AT5G59670.2	28.571	287	173	8	151	409	552	834	1.72e-25	110
MsaG006743	AT5G59670.1	28.571	287	173	8	151	409	552	834	1.72e-25	110
MsaG006743	AT1G09970.1	30.380	237	149	4	189	409	716	952	1.76e-25	110
MsaG006743	AT5G65700.1	30.116	259	157	6	172	411	715	968	1.81e-25	110
MsaG006743	AT5G65700.2	30.116	259	157	6	172	411	715	968	1.81e-25	110
MsaG006743	AT5G49660.1	35.829	187	112	4	173	351	678	864	1.93e-25	110
MsaG006743	AT1G29730.2	27.668	253	164	4	173	409	695	944	2.00e-25	110
MsaG006743	AT3G25560.3	32.273	220	139	4	135	348	292	507	2.07e-25	109
MsaG006743	AT3G25560.1	32.273	220	139	4	135	348	292	507	2.10e-25	109
MsaG006743	AT5G54590.3	29.502	261	168	4	173	422	135	390	2.15e-25	108
MsaG006743	AT5G54590.4	29.502	261	168	4	173	422	135	390	2.15e-25	108
MsaG006743	AT5G54590.2	29.502	261	168	4	173	422	135	390	2.15e-25	108
MsaG006743	AT3G25560.2	32.273	220	139	4	135	348	293	508	2.27e-25	109
MsaG006743	AT4G11490.1	30.112	269	163	8	160	410	334	595	2.42e-25	109
MsaG006743	AT5G58940.4	30.169	295	167	9	147	411	139	424	2.55e-25	108
MsaG006743	AT5G58940.1	30.169	295	167	9	147	411	139	424	2.55e-25	108
MsaG006743	AT5G58940.3	30.169	295	167	9	147	411	139	424	2.55e-25	108
MsaG006743	AT5G58940.2	30.169	295	167	9	147	411	139	424	2.55e-25	108
MsaG006743	AT1G34110.1	26.923	260	170	5	172	411	793	1052	2.63e-25	110
MsaG006743	AT1G49180.2	33.505	194	115	4	194	381	50	235	2.74e-25	107
MsaG006743	AT4G21390.1	27.358	318	203	9	127	420	498	811	2.74e-25	109
MsaG006743	AT1G34110.2	26.923	260	170	5	172	411	793	1052	2.87e-25	110
MsaG006743	AT1G01540.2	29.658	263	149	7	173	410	176	427	2.88e-25	108
MsaG006743	AT3G29160.3	30.043	233	153	5	173	404	43	266	2.95e-25	106
MsaG006743	AT1G16130.1	29.845	258	162	4	170	411	435	689	3.02e-25	109
MsaG006743	AT1G01540.1	32.979	188	119	3	173	356	176	360	3.50e-25	107
MsaG006743	AT1G49180.1	33.505	194	115	4	194	381	50	235	3.52e-25	107
MsaG006743	AT1G54820.2	28.571	217	141	4	154	356	146	362	3.95e-25	107
MsaG006743	AT4G34500.1	30.566	265	146	8	173	410	167	420	3.99e-25	107
MsaG006743	AT5G61480.1	31.418	261	154	9	172	409	740	998	4.08e-25	109
MsaG006743	AT4G18700.1	31.034	232	150	6	176	405	52	275	4.22e-25	108
MsaG006743	AT1G79620.1	28.986	276	173	7	152	411	643	911	4.28e-25	109
MsaG006743	AT5G39440.1	28.512	242	164	4	163	404	32	264	4.32e-25	108
MsaG006743	AT1G29730.3	32.105	190	124	2	173	360	695	881	4.41e-25	109
MsaG006743	AT2G17220.2	27.820	266	153	9	173	411	116	369	4.47e-25	107
MsaG006743	AT3G17420.1	34.737	190	117	2	174	359	177	363	4.52e-25	107
MsaG006743	AT1G79620.5	28.986	276	173	7	152	411	669	937	4.62e-25	109
MsaG006743	AT2G17220.1	27.820	266	153	9	173	411	117	370	4.65e-25	107
MsaG006743	AT5G18700.1	29.185	233	158	3	167	398	15	241	5.81e-25	109
MsaG006743	AT1G18390.1	31.092	238	144	6	128	356	316	542	5.93e-25	108
MsaG006743	AT5G07280.1	29.921	254	157	5	176	411	942	1192	6.06e-25	108
MsaG006743	AT5G18500.2	34.555	191	118	2	170	356	185	372	6.39e-25	107
MsaG006743	AT5G18500.5	34.555	191	118	2	170	356	185	372	6.39e-25	107
MsaG006743	AT5G18500.4	34.555	191	118	2	170	356	185	372	6.39e-25	107
MsaG006743	AT5G18500.1	34.555	191	118	2	170	356	185	372	6.39e-25	107
MsaG006743	AT5G18500.3	34.555	191	118	2	170	356	185	372	6.39e-25	107
MsaG006743	AT5G18500.6	34.555	191	118	2	170	356	185	372	6.39e-25	107
MsaG006743	AT5G49760.1	35.625	160	100	2	195	351	672	831	6.67e-25	108
MsaG006743	AT1G49100.1	29.084	251	156	6	175	408	605	850	6.89e-25	108
MsaG006743	AT2G23950.2	35.227	176	112	2	173	348	321	494	7.20e-25	107
MsaG006743	AT2G19130.1	28.788	264	152	6	174	411	516	769	7.21e-25	108
MsaG006743	AT2G25220.6	36.765	204	118	6	155	351	146	345	7.60e-25	105
MsaG006743	AT1G18390.2	31.092	238	144	6	128	356	322	548	8.43e-25	108
MsaG006743	AT5G59700.1	27.852	298	192	7	132	409	459	753	8.50e-25	108
MsaG006743	AT2G21480.1	35.359	181	110	4	173	350	547	723	9.62e-25	108
MsaG006743	AT4G30520.1	35.196	179	114	2	170	348	322	498	9.64e-25	107
MsaG006743	AT4G23210.3	32.157	255	151	9	173	410	380	629	9.74e-25	107
MsaG006743	AT5G35410.2	28.854	253	160	7	161	404	17	258	9.85e-25	105
MsaG006743	AT5G25110.1	32.456	228	133	8	161	375	49	268	1.01e-24	107
MsaG006743	AT5G40540.4	31.915	235	126	9	171	392	45	258	1.02e-24	103
MsaG006743	AT2G23950.1	35.227	176	112	2	173	348	321	494	1.02e-24	107
MsaG006743	AT2G25220.4	36.765	204	118	6	155	351	97	296	1.08e-24	105
MsaG006743	AT1G54820.1	28.571	217	141	4	154	356	146	362	1.14e-24	106
MsaG006743	AT4G21390.2	30.769	234	146	7	127	348	498	727	1.15e-24	107
MsaG006743	AT4G01330.3	30.038	263	148	6	173	410	184	435	1.17e-24	106
MsaG006743	AT1G16260.3	30.830	253	156	5	173	409	403	652	1.18e-24	107
MsaG006743	AT1G16260.1	30.830	253	156	5	173	409	412	661	1.19e-24	107
MsaG006743	AT1G16260.2	30.830	253	156	5	173	409	412	661	1.19e-24	107
MsaG006743	AT3G29160.1	30.043	233	153	5	173	404	43	266	1.23e-24	107
MsaG006743	AT3G29160.2	30.043	233	153	5	173	404	43	266	1.23e-24	107
MsaG006743	AT3G21340.1	27.972	286	164	9	153	408	588	861	1.31e-24	107
MsaG006743	AT1G51890.5	28.175	252	159	6	174	408	320	566	1.33e-24	107
MsaG006743	AT4G23220.1	29.412	221	146	4	135	348	317	534	1.40e-24	107
MsaG006743	AT5G10520.2	34.921	189	116	4	160	346	166	349	1.42e-24	105
MsaG006743	AT5G10930.1	31.496	254	156	9	161	405	18	262	1.50e-24	105
MsaG006743	AT4G29810.1	28.750	240	161	5	171	405	91	325	1.53e-24	104
MsaG006743	AT4G29810.3	28.631	241	162	5	171	406	100	335	1.53e-24	104
MsaG006743	AT4G29810.2	28.750	240	161	5	171	405	100	334	1.70e-24	104
MsaG006743	AT2G25220.5	36.765	204	118	6	155	351	97	296	1.78e-24	105
MsaG006743	AT1G51940.1	26.736	288	157	7	164	411	353	626	1.79e-24	107
MsaG006743	AT5G57630.2	31.356	236	151	7	173	407	35	260	1.87e-24	105
MsaG006743	AT1G25390.1	28.253	269	153	7	173	413	313	569	1.94e-24	107
MsaG006743	AT1G25390.2	28.253	269	153	7	173	413	313	569	1.94e-24	107
MsaG006743	AT1G29730.1	27.559	254	164	5	173	409	662	912	1.97e-24	107
MsaG006743	AT4G01330.1	30.038	263	148	6	173	410	184	435	1.99e-24	105
MsaG006743	AT4G34440.2	31.636	275	168	6	85	352	251	512	2.03e-24	107
MsaG006743	AT4G34440.1	31.636	275	168	6	85	352	251	512	2.03e-24	107
MsaG006743	AT4G01330.2	30.038	263	148	6	173	410	184	435	2.08e-24	105
MsaG006743	AT5G57630.1	31.356	236	151	7	173	407	35	260	2.15e-24	105
MsaG006743	AT5G35410.1	29.237	236	152	6	173	404	34	258	2.17e-24	105
MsaG006743	AT5G45780.2	27.273	297	191	5	137	411	239	532	2.18e-24	106
MsaG006743	AT4G23230.1	29.856	278	159	9	160	415	350	613	2.21e-24	106
MsaG006743	AT4G02630.1	27.331	311	187	8	128	410	137	436	2.22e-24	105
MsaG006743	AT1G21590.1	27.483	302	174	10	173	445	431	716	2.32e-24	107
MsaG006743	AT4G23210.1	34.807	181	109	4	173	348	380	556	2.35e-24	106
MsaG006743	AT2G25220.3	36.765	204	118	6	155	351	146	345	2.40e-24	105
MsaG006743	AT1G21590.2	27.483	302	174	10	173	445	391	676	2.51e-24	106
MsaG006743	AT3G51740.1	30.741	270	159	10	162	411	547	808	2.52e-24	107
MsaG006743	AT4G39110.1	35.359	181	110	4	173	350	548	724	2.58e-24	107
MsaG006743	AT1G34300.1	32.296	257	151	9	174	411	507	759	2.60e-24	107
MsaG006743	AT2G28970.2	28.400	250	161	6	175	409	468	714	2.67e-24	106
MsaG006743	AT1G72540.1	31.064	235	136	8	198	411	135	364	3.13e-24	105
MsaG006743	AT4G23250.3	29.658	263	160	6	160	404	367	622	3.18e-24	106
MsaG006743	AT1G17910.1	29.885	261	159	6	170	411	473	728	3.37e-24	106
MsaG006743	AT1G51890.1	28.175	252	159	6	174	408	592	838	3.38e-24	106
MsaG006743	AT2G25220.1	36.765	204	118	6	155	351	146	345	3.54e-24	104
MsaG006743	AT5G59680.1	29.167	312	184	10	129	409	545	850	3.57e-24	106
MsaG006743	AT5G45780.1	27.273	297	191	5	137	411	282	575	3.58e-24	105
MsaG006743	AT1G51890.4	28.175	252	159	6	174	408	528	774	3.72e-24	106
MsaG006743	AT3G19700.1	28.692	237	149	5	195	411	730	966	3.76e-24	106
MsaG006743	AT1G11340.1	30.455	220	137	6	141	348	498	713	3.89e-24	106
MsaG006743	AT2G28970.1	28.400	250	161	6	175	409	503	749	3.91e-24	106
MsaG006743	AT4G23250.1	29.658	263	160	6	160	404	372	627	4.09e-24	105
MsaG006743	AT1G69220.2	31.169	231	151	5	176	405	248	471	4.22e-24	106
MsaG006743	AT4G11460.2	34.197	193	116	5	160	348	284	469	4.27e-24	105
MsaG006743	AT1G11340.3	30.455	220	137	6	141	348	566	781	4.50e-24	106
MsaG006743	AT3G16030.1	33.161	193	122	4	173	361	549	738	4.56e-24	106
MsaG006743	AT1G67520.5	31.944	216	136	5	154	361	258	470	4.75e-24	105
MsaG006743	AT5G38260.1	37.363	182	105	4	170	346	340	517	4.80e-24	105
MsaG006743	AT1G69220.1	31.169	231	151	5	176	405	275	498	4.85e-24	105
MsaG006743	AT4G23160.1	30.403	273	164	7	160	415	372	635	4.92e-24	105
MsaG006743	AT1G09970.2	30.252	238	149	5	189	409	716	953	5.08e-24	106
MsaG006743	AT5G10520.1	34.921	189	116	4	160	346	166	349	5.12e-24	104
MsaG006743	AT1G70130.1	30.144	209	134	4	155	355	334	538	5.25e-24	105
MsaG006743	AT3G16030.6	33.161	193	122	4	173	361	570	759	5.36e-24	105
MsaG006743	AT1G67520.8	31.944	216	136	5	154	361	287	499	5.50e-24	105
MsaG006743	AT1G67520.7	31.944	216	136	5	154	361	287	499	5.50e-24	105
MsaG006743	AT2G25220.2	36.765	204	118	6	155	351	151	350	5.51e-24	104
MsaG006743	AT1G61610.2	31.771	192	120	4	161	348	539	723	5.58e-24	105
MsaG006743	AT4G32300.1	28.358	268	150	8	173	412	515	768	5.59e-24	105
MsaG006743	AT5G62710.2	29.317	249	157	5	177	409	304	549	5.60e-24	105
MsaG006743	AT3G25490.1	32.979	188	112	4	176	356	133	313	5.62e-24	104
MsaG006743	AT1G67520.4	31.944	216	136	5	154	361	452	664	5.72e-24	105
MsaG006743	AT1G74360.1	27.734	256	165	4	173	411	836	1088	5.90e-24	105
MsaG006743	AT1G29730.4	31.937	191	124	3	173	360	662	849	5.93e-24	105
MsaG006743	AT4G11460.3	34.197	193	116	5	160	348	359	544	6.09e-24	105
MsaG006743	AT5G62710.1	29.317	249	157	5	177	409	338	583	6.27e-24	105
MsaG006743	AT4G00960.1	27.875	287	168	9	154	410	55	332	6.43e-24	103
MsaG006743	AT1G67520.3	31.944	216	136	5	154	361	495	707	6.51e-24	105
MsaG006743	AT2G39360.1	29.021	286	161	9	154	409	486	759	6.61e-24	105
MsaG006743	AT1G67520.6	31.944	216	136	5	154	361	502	714	6.73e-24	105
MsaG006743	AT5G38210.2	30.242	248	157	6	105	346	327	564	6.99e-24	105
MsaG006743	AT1G48260.1	31.086	267	165	10	143	404	8	260	6.99e-24	103
MsaG006743	AT1G61610.1	31.771	192	120	4	161	348	539	723	7.01e-24	105
MsaG006743	AT3G16030.2	33.161	193	122	4	173	361	426	615	7.25e-24	105
MsaG006743	AT5G38210.3	30.242	248	157	6	105	346	309	546	7.66e-24	105
MsaG006743	AT4G23270.3	32.353	204	127	4	160	359	339	535	7.85e-24	105
MsaG006743	AT4G23140.1	29.078	282	156	8	160	415	364	627	7.87e-24	105
MsaG006743	AT2G28250.2	29.054	296	176	8	156	420	212	504	7.95e-24	104
MsaG006743	AT2G28250.5	29.054	296	176	8	156	420	212	504	7.95e-24	104
MsaG006743	AT2G28250.4	29.054	296	176	8	156	420	212	504	7.95e-24	104
MsaG006743	AT2G28250.1	29.054	296	176	8	156	420	212	504	7.95e-24	104
MsaG006743	AT2G28250.6	29.054	296	176	8	156	420	212	504	7.95e-24	104
MsaG006743	AT2G28250.3	29.054	296	176	8	156	420	212	504	7.95e-24	104
MsaG006743	AT4G23250.2	29.658	263	160	6	160	404	367	622	8.25e-24	105
MsaG006743	AT1G21210.1	35.754	179	103	5	176	348	435	607	8.65e-24	105
MsaG006743	AT4G23270.2	32.353	204	127	4	160	359	339	535	8.89e-24	105
MsaG006743	AT4G23270.1	32.353	204	127	4	160	359	339	535	8.89e-24	105
MsaG006743	AT5G59650.2	28.244	262	163	6	167	409	602	857	9.12e-24	105
MsaG006743	AT5G38210.1	30.120	249	158	6	105	347	315	553	9.27e-24	105
MsaG006743	AT1G21240.2	32.258	186	120	2	174	356	177	359	9.57e-24	103
MsaG006743	AT1G69790.2	29.070	258	156	8	173	411	105	354	1.01e-23	102
MsaG006743	AT5G48740.1	28.470	281	163	8	161	413	612	882	1.04e-23	105
MsaG006743	AT2G35050.1	30.627	271	158	11	162	414	984	1242	1.04e-23	105
MsaG006743	AT2G35050.2	30.627	271	158	11	162	414	984	1242	1.04e-23	105
MsaG006743	AT4G20270.1	29.297	256	151	6	173	405	732	980	1.06e-23	105
MsaG006743	AT5G59270.1	28.516	256	157	5	173	409	371	619	1.06e-23	104
MsaG006743	AT1G54960.1	27.126	247	164	7	168	405	86	325	1.10e-23	104
MsaG006743	AT1G54960.2	27.126	247	164	7	168	405	86	325	1.10e-23	104
MsaG006743	AT4G27290.1	33.854	192	116	4	161	348	479	663	1.14e-23	104
MsaG006743	AT5G59270.3	28.516	256	157	5	173	409	374	622	1.18e-23	104
MsaG006743	AT5G59270.2	28.405	257	158	5	173	410	390	639	1.21e-23	104
MsaG006743	AT4G27290.2	33.854	192	116	4	161	348	525	709	1.32e-23	104
MsaG006743	AT4G11460.1	33.673	196	116	5	160	348	359	547	1.37e-23	104
MsaG006743	AT5G59650.1	28.244	262	163	6	167	409	594	849	1.38e-23	104
MsaG006743	AT1G09000.2	27.711	249	160	8	168	405	87	326	1.38e-23	104
MsaG006743	AT2G37050.3	30.400	250	153	5	115	348	558	802	1.40e-23	104
MsaG006743	AT4G00960.4	29.954	217	137	6	154	359	55	267	1.41e-23	100
MsaG006743	AT4G00970.1	27.660	282	175	7	154	410	343	620	1.45e-23	104
MsaG006743	AT1G69790.1	29.070	258	156	8	173	411	116	365	1.46e-23	102
MsaG006743	AT2G37050.1	31.111	225	142	4	132	348	582	801	1.51e-23	104
MsaG006743	AT3G24550.1	34.225	187	118	2	170	354	299	482	1.53e-23	104
MsaG006743	AT5G65710.1	33.161	193	118	3	170	351	705	897	1.54e-23	104
MsaG006743	AT5G16000.1	29.762	252	159	4	174	409	335	584	1.57e-23	104
MsaG006743	AT4G04500.1	31.801	261	148	8	173	409	367	621	1.58e-23	104
MsaG006743	AT1G21230.1	33.146	178	109	3	176	348	433	605	1.61e-23	104
MsaG006743	AT4G00970.2	32.212	208	122	6	154	348	343	544	1.70e-23	103
MsaG006743	AT2G20850.1	29.344	259	160	8	173	411	500	755	1.71e-23	104
MsaG006743	AT1G09000.1	27.586	261	164	9	161	405	75	326	1.73e-23	103
MsaG006743	AT1G31420.2	28.295	258	165	5	168	410	323	575	1.73e-23	103
MsaG006743	AT4G29180.2	31.220	205	124	4	161	348	573	777	1.76e-23	104
MsaG006743	AT4G21230.1	27.465	284	169	9	154	410	332	605	1.81e-23	103
MsaG006743	AT4G29180.3	31.220	205	124	4	161	348	570	774	1.84e-23	104
MsaG006743	AT5G58380.1	30.043	233	149	7	176	404	38	260	1.95e-23	103
MsaG006743	AT4G23140.2	28.819	288	155	8	160	415	364	633	1.99e-23	103
MsaG006743	AT1G70110.1	30.244	205	131	4	155	351	344	544	2.05e-23	103
MsaG006743	AT2G40860.2	25.581	301	182	7	155	420	30	323	2.15e-23	103
MsaG006743	AT2G19210.1	26.984	252	164	6	175	409	599	847	2.16e-23	103
MsaG006743	AT4G21410.1	33.014	209	119	7	154	348	231	432	2.22e-23	103
MsaG006743	AT1G51850.2	28.839	267	168	8	161	408	584	847	2.27e-23	103
MsaG006743	AT2G40860.1	25.581	301	182	7	155	420	30	323	2.28e-23	103
MsaG006743	AT4G23260.2	29.658	263	160	7	160	404	341	596	2.32e-23	103
MsaG006743	AT4G23260.1	29.658	263	160	7	160	404	352	607	2.33e-23	103
MsaG006743	AT2G40860.3	25.581	301	182	7	155	420	30	323	2.34e-23	103
MsaG006743	AT2G30360.1	28.151	238	157	7	173	405	44	272	2.36e-23	102
MsaG006743	AT5G38990.1	31.897	232	140	8	133	351	503	729	2.36e-23	103
MsaG006743	AT4G29180.1	31.220	205	124	4	161	348	571	775	2.39e-23	103
MsaG006743	AT1G01140.1	29.787	235	156	5	173	405	42	269	2.40e-23	102
MsaG006743	AT2G07020.1	30.000	240	149	7	126	352	389	622	2.41e-23	103
MsaG006743	AT1G51810.1	29.137	278	173	10	153	409	446	720	2.47e-23	103
MsaG006743	AT1G21240.1	33.333	180	110	3	174	348	438	612	2.49e-23	103
MsaG006743	AT1G51850.1	28.839	267	168	8	161	408	564	827	2.52e-23	103
MsaG006743	AT1G01140.3	29.787	235	156	5	173	405	42	269	2.52e-23	102
MsaG006743	AT3G46400.1	29.231	260	156	8	175	414	600	851	2.52e-23	103
MsaG006743	AT3G59420.1	32.669	251	147	9	110	348	474	714	2.61e-23	103
MsaG006743	AT4G23190.1	28.070	285	176	8	155	415	350	629	2.75e-23	103
MsaG006743	AT4G23190.3	28.070	285	176	8	155	415	272	551	2.80e-23	103
MsaG006743	AT4G23190.4	28.070	285	176	8	155	415	272	551	2.80e-23	103
MsaG006743	AT3G15220.1	29.614	233	152	7	175	405	40	262	2.90e-23	103
MsaG006743	AT5G39000.1	31.169	231	141	8	134	351	497	722	2.92e-23	103
MsaG006743	AT5G61350.1	32.258	186	115	2	173	350	547	729	2.94e-23	103
MsaG006743	AT1G16760.2	32.258	217	130	7	147	352	442	652	3.00e-23	103
MsaG006743	AT4G04960.1	26.481	287	187	7	145	410	339	622	3.02e-23	103
MsaG006743	AT2G45490.1	27.442	215	139	5	195	405	67	268	3.07e-23	99.8
MsaG006743	AT4G21400.2	30.249	281	157	8	161	415	363	630	3.09e-23	103
MsaG006743	AT3G04690.1	27.778	288	175	8	147	409	509	788	3.15e-23	103
MsaG006743	AT5G63930.1	26.715	277	180	7	154	408	803	1078	3.21e-23	103
MsaG006743	AT3G46920.2	28.763	299	173	12	151	424	868	1151	3.24e-23	103
MsaG006743	AT4G21410.3	33.014	209	119	7	154	348	356	557	3.24e-23	103
MsaG006743	AT1G16760.1	32.258	217	130	7	147	352	442	652	3.36e-23	103
MsaG006743	AT2G45910.2	31.111	225	136	6	142	352	461	680	3.37e-23	103
MsaG006743	AT2G45910.1	31.111	225	136	6	142	352	461	680	3.37e-23	103
MsaG006743	AT4G23280.2	33.161	193	118	4	160	348	355	540	3.44e-23	103
MsaG006743	AT3G46920.1	29.153	295	169	12	151	420	802	1081	3.49e-23	103
MsaG006743	AT2G02220.1	27.564	312	174	10	140	411	709	1008	3.50e-23	103
MsaG006743	AT4G21400.1	30.686	277	161	8	161	415	375	642	3.51e-23	103
MsaG006743	AT5G44700.1	28.364	275	162	8	170	413	967	1237	3.53e-23	103
MsaG006743	AT5G63930.2	26.715	277	180	7	154	408	739	1014	3.58e-23	103
MsaG006743	AT4G23280.1	33.161	193	118	4	160	348	357	542	3.74e-23	103
MsaG006743	AT4G11530.1	28.975	283	176	6	155	415	352	631	4.20e-23	102
MsaG006743	AT4G20140.1	28.826	281	163	9	172	419	972	1248	4.26e-23	103
MsaG006743	AT3G46370.2	29.236	301	181	8	143	414	465	762	4.40e-23	103
MsaG006743	AT3G46370.1	29.236	301	181	8	143	414	465	762	4.40e-23	103
MsaG006743	AT3G45410.1	29.323	266	161	8	160	408	355	610	4.43e-23	102
MsaG006743	AT4G27300.1	32.222	180	115	3	173	348	522	698	5.04e-23	102
MsaG006743	AT5G40380.2	30.222	225	146	4	132	348	291	512	5.44e-23	102
MsaG006743	AT1G21250.1	32.447	188	113	4	176	356	434	614	5.44e-23	102
MsaG006743	AT5G45810.1	29.787	235	155	6	173	405	51	277	5.62e-23	101
MsaG006743	AT1G01140.2	30.279	251	150	6	173	403	42	287	5.77e-23	101
MsaG006743	AT5G15730.1	30.137	219	140	6	140	351	98	310	6.04e-23	101
MsaG006743	AT2G28960.1	28.102	274	174	8	164	419	453	721	6.68e-23	102
MsaG006743	AT1G51880.1	28.929	280	174	11	150	408	559	834	6.72e-23	102
MsaG006743	AT2G35620.3	27.734	256	169	5	168	410	321	573	6.78e-23	102
MsaG006743	AT2G35620.1	27.734	256	169	5	168	410	321	573	6.78e-23	102
MsaG006743	AT2G35620.2	27.734	256	169	5	168	410	321	573	6.78e-23	102
MsaG006743	AT2G35620.4	27.734	256	169	5	168	410	321	573	6.78e-23	102
MsaG006743	AT1G17540.1	31.401	207	126	5	155	350	409	610	6.83e-23	102
MsaG006743	AT1G51880.2	28.929	280	174	11	150	408	577	852	6.99e-23	102
MsaG006743	AT5G15730.3	29.864	221	140	6	140	351	98	312	7.01e-23	100
MsaG006743	AT5G15730.2	29.864	221	140	6	140	351	98	312	7.01e-23	100
MsaG006743	AT5G11020.3	35.000	180	105	4	177	351	106	278	7.16e-23	100
MsaG006743	AT2G23450.2	33.143	175	112	3	176	348	373	544	7.17e-23	102
MsaG006743	AT2G23450.1	33.143	175	112	3	176	348	373	544	7.17e-23	102
MsaG006743	AT1G51880.3	28.929	280	174	11	150	408	585	860	7.22e-23	102
MsaG006743	AT1G75820.1	29.323	266	157	9	170	408	706	967	7.78e-23	102
MsaG006743	AT5G40380.1	30.222	225	146	4	132	348	291	512	8.05e-23	102
MsaG006743	AT2G28960.2	28.102	274	174	8	164	419	585	853	8.10e-23	102
MsaG006743	AT5G54380.1	36.224	196	110	7	161	351	524	709	8.18e-23	102
MsaG006743	AT5G11020.4	35.000	180	105	4	177	351	129	301	8.29e-23	100
MsaG006743	AT1G21270.1	33.333	180	106	4	176	348	429	601	8.38e-23	102
MsaG006743	AT3G55550.1	28.000	250	161	4	176	409	372	618	8.40e-23	102
MsaG006743	AT2G45490.2	29.762	168	111	3	195	362	67	227	8.50e-23	97.8
MsaG006743	AT5G11020.2	35.000	180	105	4	177	351	133	305	8.81e-23	100
MsaG006743	AT5G21222.1	30.380	237	152	6	173	405	36	263	9.37e-23	102
MsaG006743	AT5G21222.2	30.380	237	152	6	173	405	36	263	9.37e-23	102
MsaG006743	AT5G21222.4	30.380	237	152	6	173	405	36	263	9.37e-23	102
MsaG006743	AT5G21222.3	30.380	237	152	6	173	405	36	263	9.37e-23	102
MsaG006743	AT1G78940.1	31.797	217	131	6	147	352	369	579	9.48e-23	102
MsaG006743	AT1G31420.1	28.185	259	165	5	168	410	323	576	9.58e-23	101
MsaG006743	AT1G31420.3	28.185	259	165	5	168	410	323	576	9.58e-23	101
MsaG006743	AT1G78940.3	31.797	217	131	6	147	352	440	650	9.89e-23	102
MsaG006743	AT1G78940.2	31.797	217	131	6	147	352	440	650	9.92e-23	102
MsaG006743	AT5G57670.2	32.973	185	119	4	170	351	286	468	9.95e-23	101
MsaG006743	AT1G63700.1	29.707	239	152	8	173	405	423	651	1.03e-22	102
MsaG006743	AT1G63700.2	29.707	239	152	8	173	405	423	651	1.03e-22	102
MsaG006743	AT3G46290.1	29.646	226	149	5	132	350	462	684	1.04e-22	102
MsaG006743	AT4G00960.3	28.631	241	142	6	195	410	10	245	1.08e-22	98.2
MsaG006743	AT4G23300.1	30.325	277	162	10	160	415	366	632	1.09e-22	101
MsaG006743	AT1G66880.3	33.516	182	110	4	170	346	365	540	1.10e-22	101
MsaG006743	AT5G35380.1	30.806	211	128	6	154	352	413	617	1.10e-22	101
MsaG006743	AT5G65600.1	28.311	219	149	4	174	390	374	586	1.11e-22	101
MsaG006743	AT3G20200.2	31.944	216	130	7	147	351	445	654	1.12e-22	101
MsaG006743	AT3G20200.4	31.944	216	130	7	147	351	445	654	1.12e-22	101
MsaG006743	AT3G24540.1	33.690	187	119	2	170	354	202	385	1.21e-22	100
MsaG006743	AT1G10620.1	32.512	203	128	5	155	351	370	569	1.26e-22	101

Find 95 sgRNAs with CRISPR-Local

Find sgRNAs with CRISPR-GE

CRISPR-Local

CRISPR-Local
sgRNA_sequence	on_target_score	Position	Region
TCTTCTTCACGGTGTCTTTC+TGG	0.121508	2:-9066829	None:intergenic
ACCTAAAAGTTGCAGACTTT+GGG	0.219191	2:+9070294	MsaT006743.1:CDS
CTGAATGTTGGCCTCTTTGC+CGG	0.244514	2:-9072525	None:intergenic
TTTAGGATTGATTTCATATT+CGG	0.248731	2:-9068301	None:intergenic
AATATATTGCGGGATGATTC+CGG	0.271441	2:+9070269	MsaT006743.1:CDS
AGCACCCACAAGAAGTTTCT+TGG	0.293548	2:-9070361	None:intergenic
TTTCCTAGCTTGAACCTTGT+TGG	0.296944	2:-9066790	None:intergenic
CTACTATTGATCCTGGTGTT+AGG	0.300608	2:+9066875	MsaT006743.1:CDS
TCATCGCGCTTTGCAGAAAA+AGG	0.316275	2:-9071472	None:intergenic
CCAAATGTAGTGCAGTTTCT+TGG	0.318571	2:+9069067	MsaT006743.1:CDS
TTGGTGAAATCAAGTTCTTT+AGG	0.319979	2:-9068318	None:intergenic
TTGACCAATTGTATTGTAGA+TGG	0.325879	2:-9072571	None:intergenic
TCAAGATCACGATGAATAAT+AGG	0.339063	2:-9070119	None:intergenic
CACCTAAAAGTTGCAGACTT+TGG	0.342314	2:+9070293	MsaT006743.1:CDS
CGGCAAAGAGGCCAACATTC+AGG	0.349049	2:+9072526	MsaT006743.1:CDS
CAACGATGTGATCAAACTAT+TGG	0.351419	2:+9068115	MsaT006743.1:CDS
TTAGGATTGATTTCATATTC+GGG	0.360868	2:-9068300	None:intergenic
CCAAGAAACTGCACTACATT+TGG	0.361121	2:-9069067	None:intergenic
GAAGTTTCTTGGCAAGTTAG+AGG	0.371279	2:-9070350	None:intergenic
CCATGAGAATAACGCTTGAT+TGG	0.371369	2:-9071544	None:intergenic
ATTCGTGAGGTCCTTGAATC+AGG	0.386052	2:+9066934	MsaT006743.1:CDS
GCTACACTTTAGATGATTGA+AGG	0.398555	2:+9071442	MsaT006743.1:intron
CTTCATATTGCTGCTTGTCA+AGG	0.419855	2:+9066997	MsaT006743.1:CDS
CGTGATTTCATGAAAAGAAA+AGG	0.426241	2:+9069260	MsaT006743.1:CDS
AGCTAACAGTAATATATTGC+GGG	0.429879	2:+9070259	MsaT006743.1:intron
GATGAACTTCATCTTCTTCA+CGG	0.432010	2:-9066840	None:intergenic
TGGCTCTGTTTCAGAAGATT+CGG	0.435754	2:+9069041	MsaT006743.1:CDS
TTCTGTCTTGCGTTGTGGCG+TGG	0.436894	2:+9068856	MsaT006743.1:CDS
TAACACTAACACCTGATTCA+AGG	0.439625	2:-9066945	None:intergenic
ATATATTGCGGGATGATTCC+GGG	0.444268	2:+9070270	MsaT006743.1:CDS
TGTTGATCCTAAAGATCAAT+GGG	0.445076	2:+9067062	MsaT006743.1:CDS
TCTGTCTTGCGTTGTGGCGT+GGG	0.446415	2:+9068857	MsaT006743.1:CDS
GCAAATCTCACAGCAGTACT+TGG	0.450893	2:-9069293	None:intergenic
ATGTTGATCCTAAAGATCAA+TGG	0.462166	2:+9067061	MsaT006743.1:CDS
TATTCTGTCACAATCATCAT+TGG	0.469620	2:-9069109	None:intergenic
TTCATATTGCTGCTTGTCAA+GGG	0.472262	2:+9066998	MsaT006743.1:CDS
TTTCATATTCGGGGACTTCA+CGG	0.476422	2:-9068290	None:intergenic
GTTATTATTTGCCTGAATGT+TGG	0.480840	2:-9072537	None:intergenic
ACAGGTTGATTGAAGAGTGC+TGG	0.486534	2:+9072493	MsaT006743.1:intron
GTTCAGTTGTTGCTTGAGAA+AGG	0.487292	2:+9067033	MsaT006743.1:CDS
CCAATCAAGCGTTATTCTCA+TGG	0.488845	2:+9071544	MsaT006743.1:CDS
TTCATATTCGGGGACTTCAC+GGG	0.491234	2:-9068289	None:intergenic
GAGTCCATCTACAATACAAT+TGG	0.493227	2:+9072567	MsaT006743.1:CDS
TCGTTCAAATCTAAGCAGTC+GGG	0.499596	2:+9072931	MsaT006743.1:CDS
CTTCCTCCTTCATGTACGGC+TGG	0.503636	2:-9072975	None:intergenic
CTTTGTTATCTCCACACTGT+TGG	0.504626	2:-9068337	None:intergenic
GCGAATGAAGGTGATGTTGA+TGG	0.505127	2:+9066910	MsaT006743.1:CDS
GAATCATGGAGCAAAGCCTC+TGG	0.509816	2:+9068139	MsaT006743.1:CDS
GGTGCTGCTACTATTGATCC+TGG	0.510251	2:+9066868	MsaT006743.1:CDS
AGAAGAATATGACACTAAAG+TGG	0.511875	2:+9070574	MsaT006743.1:CDS
ATCAAACTATTGGAGAATCA+TGG	0.512854	2:+9068125	MsaT006743.1:CDS
CAGGCAAATAATAACAAGAC+TGG	0.514565	2:+9072545	MsaT006743.1:CDS
ATAAAATATAGCATCTGCAA+GGG	0.519587	2:-9068087	None:intergenic
ACGCTTGATTGGAGCTCGGA+AGG	0.520231	2:-9071533	None:intergenic
AGATTCTGAAAGCACCTCAA+TGG	0.526797	2:-9072887	None:intergenic
ATCGTTCAAATCTAAGCAGT+CGG	0.531106	2:+9072930	MsaT006743.1:CDS
AGAGTGCTGGAATGAGAATC+CGG	0.532699	2:+9072506	MsaT006743.1:CDS
TTTAAATTATGCAGGGGTGT+GGG	0.539303	2:+9070071	MsaT006743.1:intron
CAATCTTCCTCCTTCATGTA+CGG	0.543689	2:-9072979	None:intergenic
GAAGGCTTTCAGAGACGAGC+TGG	0.546816	2:+9069021	MsaT006743.1:CDS
TATAAAATATAGCATCTGCA+AGG	0.547270	2:-9068088	None:intergenic
TGCGTTGTGGCGTGGGACTG+AGG	0.547600	2:+9068864	MsaT006743.1:CDS
TTCTGCAAAGCGCGATGATG+AGG	0.548522	2:+9071477	MsaT006743.1:CDS
GATTTGCACTTGATATTGCT+AGG	0.551030	2:+9069309	MsaT006743.1:CDS
GGACTTTCTGTCTTGCGTTG+TGG	0.554779	2:+9068851	MsaT006743.1:CDS
GCGCGATGATGAGGTTCCTA+AGG	0.556170	2:+9071486	MsaT006743.1:CDS
CGCTTGATTGGAGCTCGGAA+GGG	0.559110	2:-9071532	None:intergenic
TTGATGTATTCAGCGAATGA+AGG	0.568898	2:+9066898	MsaT006743.1:CDS
AATCCAACAAGGTTCAAGCT+AGG	0.572761	2:+9066787	MsaT006743.1:CDS
TTGATTGGAGCTCGGAAGGG+TGG	0.578717	2:-9071529	None:intergenic
TGTGACAGAATATCTTCCCA+AGG	0.583137	2:+9069120	MsaT006743.1:CDS
CAACTTCCAGCCGTACATGA+AGG	0.586051	2:+9072969	MsaT006743.1:CDS
AAGCTAACAGTAATATATTG+CGG	0.591871	2:+9070258	MsaT006743.1:intron
GAAGATGAAGTTCATCATGA+TGG	0.593522	2:+9066847	MsaT006743.1:CDS
TTGATTAATAGGCCGCTATG+TGG	0.596273	2:+9070532	MsaT006743.1:intron
AGGCCGCTATGTGGCTCCTG+AGG	0.598775	2:+9070541	MsaT006743.1:intron
ATTTGCACTAATTCTACAAG+AGG	0.600181	2:+9070607	MsaT006743.1:CDS
TAGGATTGATTTCATATTCG+GGG	0.600297	2:-9068299	None:intergenic
TCACGATGAATAATAGGTGA+TGG	0.600673	2:-9070113	None:intergenic
CCTAAAAGTTGCAGACTTTG+GGG	0.616745	2:+9070295	MsaT006743.1:CDS
GGAGGATGTGAGCAGTGATG+AGG	0.623401	2:+9068906	MsaT006743.1:CDS
AATAACGCTTGATTGGAGCT+CGG	0.640636	2:-9071537	None:intergenic
GGAATGAGAATCCGGCAAAG+AGG	0.657352	2:+9072514	MsaT006743.1:CDS
AGGTATATGCTTCAAAAGAG+CGG	0.662220	2:+9071506	MsaT006743.1:CDS
GAATACATCAACCTAACACC+AGG	0.663807	2:-9066886	None:intergenic
ACCTGCAGGTTAGACCATTG+AGG	0.664425	2:+9072873	MsaT006743.1:intron
ACTTGATTTCACCAACAGTG+TGG	0.668121	2:+9068326	MsaT006743.1:CDS
CGTTCAAATCTAAGCAGTCG+GGG	0.680515	2:+9072932	MsaT006743.1:CDS
TAAAATATAGCATCTGCAAG+GGG	0.681562	2:-9068086	None:intergenic
TTGATCCTAAAGATCAATGG+GGG	0.701658	2:+9067064	MsaT006743.1:CDS
CAACAGTGTGGAGATAACAA+AGG	0.716646	2:+9068338	MsaT006743.1:CDS
AAACCTCAGGAGCCACATAG+CGG	0.724011	2:-9070544	None:intergenic
TGGAATCAAAGAATCCAACA+AGG	0.725213	2:+9066776	MsaT006743.1:CDS
GTTGATCCTAAAGATCAATG+GGG	0.731719	2:+9067063	MsaT006743.1:CDS
TGATGTTGATGGAATTCGTG+AGG	0.734166	2:+9066921	MsaT006743.1:CDS

CRISPR-GE

badsite warning	sgRNA_sequence	Strand	Position	Region	GC_content

Chromosome	Type	Strat	End	Strand	Name
Chr2	gene	9066775	9072988	9066775	ID=MsaG006743
Chr2	mRNA	9066775	9072988	9066775	ID=MsaT006743.1;Parent=MsaG006743
Chr2	exon	9066775	9067092	9066775	ID=MsaT006743.1.exon1;Parent=MsaT006743.1
Chr2	CDS	9066775	9067092	9066775	ID=cds.MsaT006743.1;Parent=MsaT006743.1
Chr2	exon	9068086	9068160	9068086	ID=MsaT006743.1.exon2;Parent=MsaT006743.1
Chr2	CDS	9068086	9068160	9068086	ID=cds.MsaT006743.1;Parent=MsaT006743.1
Chr2	exon	9068264	9068359	9068264	ID=MsaT006743.1.exon3;Parent=MsaT006743.1
Chr2	CDS	9068264	9068359	9068264	ID=cds.MsaT006743.1;Parent=MsaT006743.1
Chr2	exon	9068850	9068935	9068850	ID=MsaT006743.1.exon4;Parent=MsaT006743.1
Chr2	CDS	9068850	9068935	9068850	ID=cds.MsaT006743.1;Parent=MsaT006743.1
Chr2	exon	9069021	9069141	9069021	ID=MsaT006743.1.exon5;Parent=MsaT006743.1
Chr2	CDS	9069021	9069141	9069021	ID=cds.MsaT006743.1;Parent=MsaT006743.1
Chr2	exon	9069251	9069330	9069251	ID=MsaT006743.1.exon6;Parent=MsaT006743.1
Chr2	CDS	9069251	9069330	9069251	ID=cds.MsaT006743.1;Parent=MsaT006743.1
Chr2	exon	9070085	9070147	9070085	ID=MsaT006743.1.exon7;Parent=MsaT006743.1
Chr2	CDS	9070085	9070147	9070085	ID=cds.MsaT006743.1;Parent=MsaT006743.1
Chr2	exon	9070268	9070374	9070268	ID=MsaT006743.1.exon8;Parent=MsaT006743.1
Chr2	CDS	9070268	9070374	9070268	ID=cds.MsaT006743.1;Parent=MsaT006743.1
Chr2	exon	9070543	9070628	9070543	ID=MsaT006743.1.exon9;Parent=MsaT006743.1
Chr2	CDS	9070543	9070628	9070543	ID=cds.MsaT006743.1;Parent=MsaT006743.1
Chr2	exon	9071454	9071575	9071454	ID=MsaT006743.1.exon10;Parent=MsaT006743.1
Chr2	CDS	9071454	9071575	9071454	ID=cds.MsaT006743.1;Parent=MsaT006743.1
Chr2	exon	9072497	9072608	9072497	ID=MsaT006743.1.exon11;Parent=MsaT006743.1
Chr2	CDS	9072497	9072608	9072497	ID=cds.MsaT006743.1;Parent=MsaT006743.1
Chr2	exon	9072881	9072988	9072881	ID=MsaT006743.1.exon12;Parent=MsaT006743.1
Chr2	CDS	9072881	9072988	9072881	ID=cds.MsaT006743.1;Parent=MsaT006743.1

Gene Sequence

>MsaT006743.1

ATGGAATCAAAGAATCCAACAAGGTTCAAGCTAGGAAAACAATCATCATTAGCACCAGAAAGACACCGTGAAGAAGATGAAGTTCATCATGATGGTGCTGCTACTATTGATCCTGGTGTTAGGTTGATGTATTCAGCGAATGAAGGTGATGTTGATGGAATTCGTGAGGTCCTTGAATCAGGTGTTAGTGTTAATTTTAGAGATGTTGATGGAAGGACTGCTCTTCATATTGCTGCTTGTCAAGGGTTGACTCATGTTGTTCAGTTGTTGCTTGAGAAAGGAGCTGATGTTGATCCTAAAGATCAATGGGGGAGCACGCCCCTTGCAGATGCTATATTTTATAAAAACAACGATGTGATCAAACTATTGGAGAATCATGGAGCAAAGCCTCTGATGGCTTCTATGCATGTTAATCATGCCCGTGAAGTCCCCGAATATGAAATCAATCCTAAAGAACTTGATTTCACCAACAGTGTGGAGATAACAAAGGGGACTTTCTGTCTTGCGTTGTGGCGTGGGACTGAGGTTGCAGTAAAAAAGCTCGGGGAGGATGTGAGCAGTGATGAGGAGAAAGTGAAGGCTTTCAGAGACGAGCTGGCTCTGTTTCAGAAGATTCGGCATCCAAATGTAGTGCAGTTTCTTGGTGCTGTGACACAGAGTACTCCAATGATGATTGTGACAGAATATCTTCCCAAGGGAGATCTTCGTGATTTCATGAAAAGAAAAGGAGCTTTGAAACCAAGTACTGCTGTGAGATTTGCACTTGATATTGCTAGGGGTGTGGGTTATTTGCATGAAAATAAACCATCACCTATTATTCATCGTGATCTTGAGCCTTCTAATATATTGCGGGATGATTCCGGGCACCTAAAAGTTGCAGACTTTGGGGTCAGCAAGTTGCTAGCAAATAAAGAAGACAAGCCTCTAACTTGCCAAGAAACTTCTTGCCGCTATGTGGCTCCTGAGGTTTTTAAACAAGAAGAATATGACACTAAAGTGGATGTGTTCTCATTTGCACTAATTCTACAAGAGATGATTGAAGGCTGCCCTCCTTTTTCTGCAAAGCGCGATGATGAGGTTCCTAAGGTATATGCTTCAAAAGAGCGGCCACCCTTCCGAGCTCCAATCAAGCGTTATTCTCATGGAATTCGAGAGTTGATTGAAGAGTGCTGGAATGAGAATCCGGCAAAGAGGCCAACATTCAGGCAAATAATAACAAGACTGGAGTCCATCTACAATACAATTGGTCAAAAAAGGCGTTGGAAGGTTAGACCATTGAGGTGCTTTCAGAATCTTGAAGCTTTGTTGAAGAGAGATCGTTCAAATCTAAGCAGTCGGGGCAGTTCATCTCGCTCAACTTCCAGCCGTACATGA

Protein sequence

>MsaT006743.1

MESKNPTRFKLGKQSSLAPERHREEDEVHHDGAATIDPGVRLMYSANEGDVDGIREVLESGVSVNFRDVDGRTALHIAACQGLTHVVQLLLEKGADVDPKDQWGSTPLADAIFYKNNDVIKLLENHGAKPLMASMHVNHAREVPEYEINPKELDFTNSVEITKGTFCLALWRGTEVAVKKLGEDVSSDEEKVKAFRDELALFQKIRHPNVVQFLGAVTQSTPMMIVTEYLPKGDLRDFMKRKGALKPSTAVRFALDIARGVGYLHENKPSPIIHRDLEPSNILRDDSGHLKVADFGVSKLLANKEDKPLTCQETSCRYVAPEVFKQEEYDTKVDVFSFALILQEMIEGCPPFSAKRDDEVPKVYASKERPPFRAPIKRYSHGIRELIEECWNENPAKRPTFRQIITRLESIYNTIGQKRRWKVRPLRCFQNLEALLKRDRSNLSSRGSSSRSTSSRT*