Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG008388 | XP_039686054.1 | 73.913 | 92 | 24 | 0 | 25 | 116 | 133 | 224 | 3.03e-34 | 129 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG008388 | sp|Q501B2|BZP16_ARATH | 41.429 | 70 | 40 | 1 | 48 | 116 | 300 | 369 | 2.71e-11 | 62.4 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG008388 | G7IST9 | 73.913 | 92 | 24 | 0 | 25 | 116 | 169 | 260 | 2.58e-34 | 129 |
Gene ID | Type | Classification |
---|---|---|
MsaG008388 | TF | bZIP |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG008388 | MtrunA17_Chr1g0162721 | 71.622 | 74 | 21 | 0 | 43 | 116 | 213 | 286 | 2.40e-26 | 99.4 |
MsaG008388 | MtrunA17_Chr4g0065261 | 38.739 | 111 | 65 | 3 | 7 | 116 | 46 | 154 | 8.27e-14 | 63.9 |
MsaG008388 | MtrunA17_Chr2g0302481 | 73.810 | 42 | 11 | 0 | 75 | 116 | 126 | 167 | 9.48e-13 | 61.6 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG008388 | AT2G35530.1 | 41.429 | 70 | 40 | 1 | 48 | 116 | 300 | 369 | 2.76e-12 | 62.4 |
Find 14 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
TTGATCATCAATTTAAGATT+TGG | 0.235285 | 2:+33631334 | MsaT008388.1:CDS |
CTTAAATTGATGATCAACTA+TGG | 0.330405 | 2:-33631328 | None:intergenic |
GCTCAGTGAGCGTTTGTGTT+AGG | 0.338250 | 2:-33634447 | None:intergenic |
TGATCATCAATTTAAGATTT+GGG | 0.346102 | 2:+33631335 | MsaT008388.1:CDS |
TCAAGAGATAAACACTCTTA+AGG | 0.430729 | 2:+33634411 | MsaT008388.1:CDS |
AAGATCAAAGATAAAGAAAC+AGG | 0.437513 | 2:+33634057 | MsaT008388.1:CDS |
CAATGAAAACGATTCTATTG+AGG | 0.546332 | 2:+33634495 | MsaT008388.1:CDS |
GGAAGCAAGAGATCGACAGA+TGG | 0.554192 | 2:+33633255 | MsaT008388.1:CDS |
GCAGACATCAATGGCTCAAG+AGG | 0.556539 | 2:+33631284 | None:intergenic |
TCGAAGCAGATTACTGAGGA+TGG | 0.562030 | 2:+33633309 | MsaT008388.1:CDS |
AGTGAGCGTTTGTGTTAGGA+CGG | 0.605256 | 2:-33634443 | None:intergenic |
CAGACATCAATGGCTCAAGA+GGG | 0.613094 | 2:+33631285 | None:intergenic |
AGACATCAATGGCTCAAGAG+GGG | 0.679742 | 2:+33631286 | None:intergenic |
TTTATCGAAGCAGATTACTG+AGG | 0.687115 | 2:+33633305 | MsaT008388.1:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr2 | gene | 33631294 | 33635025 | 33631294 | ID=MsaG008388 |
Chr2 | mRNA | 33631294 | 33635025 | 33631294 | ID=MsaT008388.1;Parent=MsaG008388 |
Chr2 | exon | 33631294 | 33631356 | 33631294 | ID=MsaT008388.1.exon1;Parent=MsaT008388.1 |
Chr2 | CDS | 33631294 | 33631356 | 33631294 | ID=cds.MsaT008388.1;Parent=MsaT008388.1 |
Chr2 | exon | 33633250 | 33633330 | 33633250 | ID=MsaT008388.1.exon2;Parent=MsaT008388.1 |
Chr2 | CDS | 33633250 | 33633330 | 33633250 | ID=cds.MsaT008388.1;Parent=MsaT008388.1 |
Chr2 | exon | 33634001 | 33634078 | 33634001 | ID=MsaT008388.1.exon3;Parent=MsaT008388.1 |
Chr2 | CDS | 33634001 | 33634078 | 33634001 | ID=cds.MsaT008388.1;Parent=MsaT008388.1 |
Chr2 | exon | 33634391 | 33634516 | 33634391 | ID=MsaT008388.1.exon4;Parent=MsaT008388.1 |
Chr2 | CDS | 33634391 | 33634516 | 33634391 | ID=cds.MsaT008388.1;Parent=MsaT008388.1 |
Chr2 | exon | 33635020 | 33635025 | 33635020 | ID=MsaT008388.1.exon5;Parent=MsaT008388.1 |
Chr2 | CDS | 33635020 | 33635025 | 33635020 | ID=cds.MsaT008388.1;Parent=MsaT008388.1 |
Gene Sequence |
Protein sequence |