AlfalfaGEDB | MsaG012332

M. sativa ssp. caerulea / MsaG012332

KEGG: -
GO: -
PFAM: PF13912.9

Nr:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG012332	XP_013459208.1	91.273	275	20	1	1	271	1	275	2.59e-174	491

Swissprot:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score

Trembl:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG012332	A0A072UTD1	91.273	275	20	1	1	271	1	275	1.24e-174	491

TFs/TRs:

Gene ID	Type	Classification
MsaG012332	TF	C2H2

Protein Kinases:

Gene ID	Type	Classification

Network:

Co-expression Network

Gene1	Gene2	correlation coefficient	p_value	FDR
MsaG001767	MsaG012332	0.821141	8.301556e-53	1.881856e-50
MsaG003309	MsaG012332	0.801452	1.499344e-48	2.094804e-46
MsaG003806	MsaG012332	0.821898	5.561450e-53	1.286224e-50
MsaG003987	MsaG012332	0.802592	8.761279e-49	1.256349e-46
MsaG004086	MsaG012332	0.817547	5.424473e-52	1.119071e-49
MsaG004298	MsaG012332	0.811842	9.815323e-51	1.753439e-48
MsaG004377	MsaG012332	0.805960	1.756425e-49	2.723115e-47
MsaG004433	MsaG012332	0.816378	9.901838e-52	1.982226e-49
MsaG004443	MsaG012332	0.804373	3.759837e-49	5.617958e-47
MsaG006281	MsaG012332	0.802236	1.036553e-48	1.474265e-46
MsaG006284	MsaG012332	0.853099	5.743199e-61	3.467515e-58
MsaG006355	MsaG012332	0.808660	4.731004e-50	7.822574e-48
MsaG006713	MsaG012332	0.827165	3.244858e-54	8.667909e-52
MsaG006803	MsaG012332	0.829081	1.126670e-54	3.175969e-52
MsaG007063	MsaG012332	0.814612	2.436560e-51	4.664093e-49
MsaG007269	MsaG012332	0.818468	3.367215e-52	7.113473e-50
MsaG007516	MsaG012332	0.814139	3.095754e-51	5.856128e-49
MsaG008299	MsaG012332	0.809565	3.034685e-50	5.128404e-48
MsaG009674	MsaG012332	0.804732	3.167263e-49	4.771984e-47
MsaG009900	MsaG012332	0.839363	3.055519e-57	1.169134e-54
MsaG012026	MsaG012332	0.812470	7.173406e-51	1.301517e-48
MsaG012332	MsaG012396	0.805505	2.186510e-49	3.353868e-47
MsaG012332	MsaG012592	0.803729	5.111446e-49	7.524296e-47
MsaG012332	MsaG014547	0.819061	2.472421e-52	5.305084e-50
MsaG012332	MsaG014554	0.816952	7.370042e-52	1.497356e-49
MsaG012332	MsaG014718	0.807006	1.059390e-49	1.683548e-47
MsaG012332	MsaG015195	0.811026	1.473997e-50	2.580935e-48
MsaG012332	MsaG016056	0.803434	5.881099e-49	8.598114e-47
MsaG012332	MsaG016911	0.823048	3.015045e-53	7.192406e-51
MsaG012332	MsaG017061	0.808473	5.186160e-50	8.536321e-48
MsaG012332	MsaG017106	0.808866	4.277407e-50	7.107704e-48
MsaG012332	MsaG017230	0.811406	1.220215e-50	2.156588e-48
MsaG012332	MsaG018167	0.801124	1.748168e-48	2.424374e-46
MsaG012332	MsaG018437	0.822263	4.581359e-53	1.069950e-50
MsaG012332	MsaG018682	0.817634	5.185632e-52	1.072152e-49
MsaG012332	MsaG018889	0.801849	1.243843e-48	1.753600e-46
MsaG012332	MsaG019134	0.803449	5.837020e-49	8.536851e-47
MsaG012332	MsaG020499	0.805591	2.098018e-49	3.224642e-47
MsaG012332	MsaG021042	0.824736	1.217135e-53	3.039646e-51
MsaG012332	MsaG021339	0.801998	1.159888e-48	1.640717e-46
MsaG012332	MsaG022303	0.838791	4.291988e-57	1.613350e-54
MsaG012332	MsaG022579	0.814807	2.207379e-51	4.246346e-49
MsaG012332	MsaG024877	0.801720	1.321672e-48	1.857848e-46
MsaG012332	MsaG026826	0.811749	1.028267e-50	1.832701e-48
MsaG012332	MsaG027275	0.820759	1.015444e-52	2.278569e-50
MsaG012332	MsaG027911	0.837664	8.348930e-57	3.030604e-54
MsaG012332	MsaG028585	0.804307	3.880946e-49	5.790050e-47
MsaG012332	MsaG029377	0.822814	3.415196e-53	8.095829e-51
MsaG012332	MsaG029318	0.812808	6.053890e-51	1.107661e-48
MsaG012332	MsaG029403	0.813024	5.431911e-51	9.992589e-49
MsaG012332	MsaG029742	0.803273	6.346215e-49	9.243949e-47
MsaG012332	MsaG030494	0.809217	3.600028e-50	6.032566e-48
MsaG012332	MsaG030665	0.825279	9.072411e-54	2.299712e-51
MsaG012332	MsaG032594	0.806381	1.433128e-49	2.244252e-47
MsaG012332	MsaG033289	0.836927	1.286138e-56	4.564746e-54
MsaG012332	MsaG035467	0.800396	2.457455e-48	3.352545e-46
MsaG012332	MsaG035706	0.809881	2.596474e-50	4.421351e-48
MsaG012332	MsaG036049	0.814205	2.995446e-51	5.675822e-49
MsaG012332	MsaG036081	0.808851	4.308497e-50	7.156792e-48
MsaG012332	MsaG037924	0.803519	5.647616e-49	8.273207e-47
MsaG012332	MsaG038522	0.805673	2.016253e-49	3.104991e-47
MsaG012332	MsaG038999	0.817529	5.473726e-52	1.128728e-49
MsaG012332	MsaG040685	0.822929	3.212249e-53	7.638124e-51
MsaG012332	MsaG041746	0.818338	3.600734e-52	7.581397e-50
MsaG012332	MsaG041898	0.818925	2.654552e-52	5.675412e-50
MsaG012332	MsaG043554	0.842684	4.143121e-58	1.761111e-55
MsaG012332	MsaG044881	0.827983	2.068116e-54	5.652943e-52
MsaG012332	MsaG045413	0.800585	2.249788e-48	3.082379e-46
MsaG012332	MsaG046278	0.815924	1.249345e-51	2.472265e-49
MsaG012332	MsaG046929	0.829784	7.617340e-55	2.190906e-52
MsaG012332	MsaG002644	0.838641	4.689255e-57	1.754455e-54
MsaG012332	MsaG001749	0.829359	9.654297e-55	2.743113e-52
MsaG012332	MsaG003078	0.841744	7.324822e-58	3.021184e-55
MsaG012332	MsaG005823	0.833357	1.013432e-55	3.232812e-53
MsaG012332	MsaG007676	0.801570	1.418149e-48	1.986667e-46
MsaG012332	MsaG014915	0.800310	2.558802e-48	3.483887e-46
MsaG012332	MsaG020180	0.803257	6.396687e-49	9.313841e-47
MsaG012332	MsaG019765	0.829151	1.083717e-54	3.060894e-52
MsaG012332	MsaG019535	0.805621	2.067945e-49	3.180702e-47
MsaG012332	MsaG031534	0.835635	2.730080e-56	9.320135e-54
MsaG012332	MsaG031505	0.809464	3.189191e-50	5.376368e-48
MsaG012332	MsaG030125	0.806070	1.665824e-49	2.589421e-47
MsaG012332	MsaG038289	0.806312	1.481683e-49	2.316533e-47
MsaG012332	MsaG036792	0.814523	2.549519e-51	4.869476e-49
MsaG012332	MsaG038133	0.816946	7.393960e-52	1.501982e-49
MsaG012332	MsaG036541	0.824092	1.722763e-53	4.227540e-51
MsaG012332	MsaG036115	0.802341	9.865463e-49	1.406585e-46
MsaG012332	MsaG036763	0.805463	2.230388e-49	3.417920e-47
MsaG012332	MsaG036344	0.833575	8.943716e-56	2.871505e-53

PPI

Gene1	Gene2	Type

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG012332	MtrunA17_Chr3g0079131	91.273	275	20	1	1	271	1	275	2.38e-178	491
MsaG012332	MtrunA17_Chr3g0079061	63.273	275	97	2	1	271	1	275	5.16e-115	331
MsaG012332	MtrunA17_Chr3g0079091	63.842	177	60	2	1	173	1	177	2.97e-64	199
MsaG012332	MtrunA17_Chr4g0018761	28.731	268	153	7	3	265	4	238	1.98e-24	98.6
MsaG012332	MtrunA17_Chr7g0231181	25.538	325	172	11	4	269	2	315	6.36e-12	65.1

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG012332	AT1G02030.1	25.830	271	149	8	5	264	4	233	5.33e-12	64.7
MsaG012332	AT3G60580.1	26.354	277	148	10	7	262	5	246	1.36e-11	63.9

Find 26 sgRNAs with CRISPR-Local

Find sgRNAs with CRISPR-GE

CRISPR-Local

CRISPR-Local
sgRNA_sequence	on_target_score	Position	Region
CGGTCGTAGACAATTTAATT+TGG	0.272723	3:+22709814	MsaT012332.1:CDS
AACAATCTATCTGAAGAAAT+TGG	0.300908	3:+22710139	MsaT012332.1:CDS
TGAGAATACACAAGTTAAAT+TGG	0.302912	3:+22709913	MsaT012332.1:CDS
ATACTATAGTGAGAAGAAAA+AGG	0.312924	3:+22710015	MsaT012332.1:CDS
TAAATTGGTGTATAGTGATT+TGG	0.323391	3:+22709928	MsaT012332.1:CDS
CTATTATTTGTGTGAATGAA+TGG	0.399412	3:+22709975	MsaT012332.1:CDS
TCACGTGCTTGGTTGTTGAT+TGG	0.399497	3:-22709599	None:intergenic
TATCATACCCTTGTAAACTT+TGG	0.406116	3:+22709734	MsaT012332.1:CDS
TCTGAAGAAATTGGTATAAG+TGG	0.426032	3:+22710148	MsaT012332.1:CDS
AATAGAGAGAGTTTGATGTT+TGG	0.448411	3:-22709639	None:intergenic
TACAGAAGCTGCTGAAACAT+TGG	0.473334	3:+22709952	MsaT012332.1:CDS
TATTCTTACCAAAGTTTACA+AGG	0.477139	3:-22709742	None:intergenic
TCACAAGTGCACATATTGCT+TGG	0.480968	3:+22710201	MsaT012332.1:CDS
CAATGCTTTCCCATTAGAAA+AGG	0.484168	3:-22709525	None:intergenic
AAGATCGAAGATTATGCATA+GGG	0.485747	3:-22709697	None:intergenic
TGTACTTGAGGAACACAAAA+CGG	0.523616	3:+22710243	MsaT012332.1:CDS
CAACTGAGTGTTCACGTGCT+TGG	0.533072	3:-22709610	None:intergenic
TGAATCTGATCATGTACTTG+AGG	0.537940	3:+22710231	MsaT012332.1:CDS
ATAATCTTCGATCTTTGAAG+AGG	0.557615	3:+22709705	MsaT012332.1:CDS
AAAGATCGAAGATTATGCAT+AGG	0.557994	3:-22709698	None:intergenic
AGAAATTGGTATAAGTGGAA+AGG	0.574832	3:+22710153	MsaT012332.1:CDS
AGAGAATACAATATTTAATG+TGG	0.616169	3:+22709841	MsaT012332.1:CDS
TGTGGCTGAAGAAAATGAAG+AGG	0.616323	3:+22709859	MsaT012332.1:CDS
ATTCTTACCAAAGTTTACAA+GGG	0.625545	3:-22709741	None:intergenic
TCTAATGGGAAAGCATTGGG+AGG	0.669450	3:+22709530	MsaT012332.1:CDS
GAATGAATGGAAACAAGTTG+AGG	0.698163	3:+22709988	MsaT012332.1:CDS

CRISPR-GE

badsite warning	sgRNA_sequence	Strand	Position	Region	GC_content

Chromosome	Type	Strat	End	Strand	Name
Chr3	gene	22709485	22710300	22709485	ID=MsaG012332
Chr3	mRNA	22709485	22710300	22709485	ID=MsaT012332.1;Parent=MsaG012332
Chr3	exon	22709485	22710300	22709485	ID=MsaT012332.1.exon1;Parent=MsaT012332.1
Chr3	CDS	22709485	22710300	22709485	ID=cds.MsaT012332.1;Parent=MsaT012332.1

Gene Sequence

>MsaT012332.1

ATGGAGAACAATAGAAGAGAATGTCACATTTGTAACAAGTCCTTTTCTAATGGGAAAGCATTGGGAGGCCACATGAAAACTCACTTAGCTAAACTACTAATCCCTCTAAAATCTCCAATCAACAACCAAGCACGTGAACACTCAGTTGAGTCAACCAAACATCAAACTCTCTCTATTTCTACATCTTCCTCATCAATTTCCAATCCAAAAAACCCTATGCATAATCTTCGATCTTTGAAGAGGAATTTTTATCATACCCTTGTAAACTTTGGTAAGAATAGTGTGTTTGATTCTTTTCCAAAAAACCCAACTGGAAAAAGATCGAAACGCGGTCGTAGACAATTTAATTTGGCTGAAGAGAATACAATATTTAATGTGGCTGAAGAAAATGAAGAGGATACACAATTTAATGCAGTTGAAGAAATAAATGAGAATACACAAGTTAAATTGGTGTATAGTGATTTGGATACAGAAGCTGCTGAAACATTGGCTATTATTTGTGTGAATGAATGGAAACAAGTTGAGGAGAAATACTATAGTGAGAAGAAAAAGGTTAGTGAAAATGGCAACATCATGTTTGAATGCGATATTTGTCATGAAGTGTTTCAATATTGCAAAGATCTTGTTAGACATGAAGCAATCCATAAGAAAAATAACAATCTATCTGAAGAAATTGGTATAAGTGGAAAGGAATATGATGTTGTAAATGAAGAAGTTCACAAGTGCACATATTGCTTGGAATTTTTTGAATCTGATCATGTACTTGAGGAACACAAAACGGTACACTTATCCAATTTTTCTGATTCTAACCCATAG

Protein sequence

>MsaT012332.1

MENNRRECHICNKSFSNGKALGGHMKTHLAKLLIPLKSPINNQAREHSVESTKHQTLSISTSSSSISNPKNPMHNLRSLKRNFYHTLVNFGKNSVFDSFPKNPTGKRSKRGRRQFNLAEENTIFNVAEENEEDTQFNAVEEINENTQVKLVYSDLDTEAAETLAIICVNEWKQVEEKYYSEKKKVSENGNIMFECDICHEVFQYCKDLVRHEAIHKKNNNLSEEIGISGKEYDVVNEEVHKCTYCLEFFESDHVLEEHKTVHLSNFSDSNP*