Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG014247 | XP_003600455.1 | 78.596 | 285 | 56 | 3 | 1 | 284 | 1 | 281 | 4.86e-156 | 446 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG014247 | sp|Q8L3W1|VRN1_ARATH | 26.765 | 340 | 183 | 10 | 8 | 285 | 1 | 336 | 2.59e-33 | 127 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG014247 | tr|G8A2Z2|G8A2Z2_MEDTR | 78.596 | 285 | 56 | 3 | 1 | 284 | 1 | 281 | 2.32e-156 | 446 |
Gene ID | Type | Classification |
---|---|---|
MsaG014247 | TF | B3 |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000193 | MsaG014247 | 0.814564 | 2.497335e-51 | 4.774628e-49 |
MsaG000237 | MsaG014247 | 0.801802 | 1.271647e-48 | 1.790892e-46 |
MsaG000458 | MsaG014247 | 0.846836 | 3.186388e-59 | 1.551800e-56 |
MsaG000476 | MsaG014247 | 0.805114 | 2.637004e-49 | 4.008494e-47 |
MsaG001238 | MsaG014247 | 0.836762 | 1.416229e-56 | 5.001600e-54 |
MsaG001538 | MsaG014247 | 0.837471 | 9.351416e-57 | 3.374688e-54 |
MsaG001836 | MsaG014247 | 0.802426 | 9.477188e-49 | 1.353843e-46 |
MsaG003174 | MsaG014247 | 0.805746 | 1.947157e-49 | 3.003686e-47 |
MsaG003768 | MsaG014247 | 0.837017 | 1.220483e-56 | 4.343502e-54 |
MsaG004462 | MsaG014247 | 0.818025 | 4.235845e-52 | 8.847089e-50 |
MsaG004504 | MsaG014247 | 0.820794 | 9.969051e-53 | 2.239055e-50 |
MsaG004538 | MsaG014247 | 0.818474 | 3.355504e-52 | 7.089933e-50 |
MsaG004986 | MsaG014247 | 0.803888 | 4.738371e-49 | 7.000682e-47 |
MsaG005092 | MsaG014247 | 0.835159 | 3.597521e-56 | 1.210757e-53 |
MsaG005274 | MsaG014247 | 0.855363 | 1.283358e-61 | 8.400565e-59 |
MsaG005329 | MsaG014247 | 0.840192 | 1.863528e-57 | 7.318616e-55 |
MsaG005702 | MsaG014247 | 0.828836 | 1.290586e-54 | 3.612913e-52 |
MsaG006219 | MsaG014247 | 0.810648 | 1.777225e-50 | 3.083372e-48 |
MsaG006926 | MsaG014247 | 0.825589 | 7.666754e-54 | 1.960090e-51 |
MsaG007122 | MsaG014247 | 0.807216 | 9.565366e-50 | 1.527648e-47 |
MsaG007432 | MsaG014247 | 0.812380 | 7.504707e-51 | 1.358572e-48 |
MsaG008035 | MsaG014247 | 0.803382 | 6.028099e-49 | 8.802627e-47 |
MsaG009061 | MsaG014247 | 0.820116 | 1.423847e-52 | 3.141337e-50 |
MsaG009786 | MsaG014247 | 0.854683 | 2.019119e-61 | 1.289711e-58 |
MsaG010278 | MsaG014247 | 0.853571 | 4.211761e-61 | 2.585522e-58 |
MsaG010365 | MsaG014247 | 0.826390 | 4.958845e-54 | 1.296365e-51 |
MsaG010768 | MsaG014247 | 0.836343 | 1.809391e-56 | 6.310072e-54 |
MsaG011080 | MsaG014247 | 0.801009 | 1.845051e-48 | 2.552091e-46 |
MsaG011298 | MsaG014247 | 0.849906 | 4.553136e-60 | 2.459676e-57 |
MsaG012448 | MsaG014247 | 0.885035 | 2.477142e-71 | 5.683392e-68 |
MsaG012555 | MsaG014247 | 0.842566 | 4.451347e-58 | 1.885033e-55 |
MsaG013917 | MsaG014247 | 0.813002 | 5.491419e-51 | 1.009645e-48 |
MsaG014153 | MsaG014247 | 0.958568 | 6.006975e-116 | 2.775936e-110 |
MsaG014247 | MsaG015092 | 0.820537 | 1.141263e-52 | 2.546030e-50 |
MsaG014247 | MsaG015807 | 0.805714 | 1.977325e-49 | 3.047967e-47 |
MsaG014247 | MsaG016291 | 0.800759 | 2.074540e-48 | 2.853429e-46 |
MsaG014247 | MsaG017057 | 0.807783 | 7.262573e-50 | 1.175739e-47 |
MsaG014247 | MsaG017150 | 0.805813 | 1.885277e-49 | 2.912821e-47 |
MsaG014247 | MsaG017515 | 0.839450 | 2.901137e-57 | 1.113170e-54 |
MsaG014247 | MsaG017518 | 0.842605 | 4.347053e-58 | 1.843127e-55 |
MsaG014247 | MsaG017946 | 0.810423 | 1.987288e-50 | 3.428988e-48 |
MsaG014247 | MsaG018489 | 0.815602 | 1.472110e-51 | 2.889479e-49 |
MsaG014247 | MsaG018565 | 0.825152 | 9.717395e-54 | 2.454649e-51 |
MsaG014247 | MsaG018577 | 0.825501 | 8.045509e-54 | 2.051909e-51 |
MsaG014247 | MsaG018786 | 0.845895 | 5.738403e-59 | 2.708333e-56 |
MsaG014247 | MsaG018793 | 0.802485 | 9.215840e-49 | 1.318282e-46 |
MsaG014247 | MsaG018913 | 0.831753 | 2.520536e-55 | 7.673566e-53 |
MsaG014247 | MsaG018975 | 0.822939 | 3.196308e-53 | 7.602228e-51 |
MsaG014247 | MsaG019055 | 0.817748 | 4.889516e-52 | 1.013919e-49 |
MsaG014247 | MsaG019564 | 0.825096 | 1.002127e-53 | 2.527489e-51 |
MsaG014247 | MsaG019628 | 0.823374 | 2.531874e-53 | 6.093546e-51 |
MsaG014247 | MsaG019935 | 0.845880 | 5.789355e-59 | 2.731028e-56 |
MsaG014247 | MsaG019985 | 0.808336 | 5.542706e-50 | 9.093081e-48 |
MsaG014247 | MsaG020467 | 0.808172 | 6.005548e-50 | 9.813921e-48 |
MsaG014247 | MsaG020616 | 0.821605 | 6.495846e-53 | 1.490679e-50 |
MsaG014247 | MsaG020652 | 0.854989 | 1.646778e-61 | 1.063426e-58 |
MsaG014247 | MsaG020824 | 0.824456 | 1.415869e-53 | 3.509161e-51 |
MsaG014247 | MsaG020963 | 0.820489 | 1.170789e-52 | 2.608540e-50 |
MsaG014247 | MsaG022116 | 0.822270 | 4.565422e-53 | 1.066419e-50 |
MsaG014247 | MsaG022515 | 0.805843 | 1.858211e-49 | 2.873046e-47 |
MsaG014247 | MsaG022895 | 0.813305 | 4.716983e-51 | 8.737901e-49 |
MsaG014247 | MsaG023119 | 0.804177 | 4.128463e-49 | 6.140738e-47 |
MsaG014247 | MsaG023885 | 0.839143 | 3.482600e-57 | 1.323505e-54 |
MsaG014247 | MsaG023890 | 0.830143 | 6.234233e-55 | 1.811626e-52 |
MsaG014247 | MsaG024668 | 0.814556 | 2.507105e-51 | 4.792418e-49 |
MsaG014247 | MsaG025492 | 0.815185 | 1.821545e-51 | 3.537702e-49 |
MsaG014247 | MsaG025651 | 0.810868 | 1.593907e-50 | 2.780111e-48 |
MsaG014247 | MsaG026849 | 0.814567 | 2.492525e-51 | 4.765848e-49 |
MsaG014247 | MsaG027026 | 0.808951 | 4.101937e-50 | 6.830081e-48 |
MsaG014247 | MsaG027775 | 0.840669 | 1.400502e-57 | 5.583199e-55 |
MsaG014247 | MsaG028109 | 0.828225 | 1.809990e-54 | 4.980999e-52 |
MsaG014247 | MsaG028416 | 0.809671 | 2.879974e-50 | 4.879242e-48 |
MsaG014247 | MsaG028757 | 0.813130 | 5.151237e-51 | 9.500907e-49 |
MsaG014247 | MsaG029232 | 0.831416 | 3.049411e-55 | 9.191812e-53 |
MsaG014247 | MsaG029335 | 0.843477 | 2.553022e-58 | 1.113185e-55 |
MsaG014247 | MsaG029413 | 0.822623 | 3.782539e-53 | 8.920161e-51 |
MsaG014247 | MsaG029424 | 0.846096 | 5.062504e-59 | 2.405352e-56 |
MsaG014247 | MsaG029625 | 0.838358 | 5.543925e-57 | 2.055838e-54 |
MsaG014247 | MsaG029896 | 0.861185 | 2.416866e-63 | 1.965826e-60 |
MsaG014247 | MsaG030032 | 0.811407 | 1.219680e-50 | 2.155695e-48 |
MsaG014247 | MsaG030827 | 0.827215 | 3.155491e-54 | 8.441107e-52 |
MsaG014247 | MsaG031754 | 0.859975 | 5.598396e-63 | 4.348518e-60 |
MsaG014247 | MsaG033318 | 0.817247 | 6.332656e-52 | 1.296422e-49 |
MsaG014247 | MsaG033593 | 0.817739 | 4.911670e-52 | 1.018289e-49 |
MsaG014247 | MsaG033646 | 0.836967 | 1.256612e-56 | 4.465247e-54 |
MsaG014247 | MsaG034601 | 0.828471 | 1.579499e-54 | 4.377108e-52 |
MsaG014247 | MsaG034946 | 0.826421 | 4.875549e-54 | 1.275717e-51 |
MsaG014247 | MsaG035051 | 0.803580 | 5.486784e-49 | 8.048792e-47 |
MsaG014247 | MsaG034996 | 0.819224 | 2.270695e-52 | 4.893046e-50 |
MsaG014247 | MsaG035198 | 0.807997 | 6.543133e-50 | 1.064733e-47 |
MsaG014247 | MsaG035407 | 0.838297 | 5.748290e-57 | 2.127680e-54 |
MsaG014247 | MsaG036154 | 0.887064 | 4.300987e-72 | 1.090753e-68 |
MsaG014247 | MsaG040379 | 0.801701 | 1.333484e-48 | 1.873625e-46 |
MsaG014247 | MsaG041112 | 0.817543 | 5.434411e-52 | 1.121017e-49 |
MsaG014247 | MsaG041285 | 0.801340 | 1.579902e-48 | 2.201806e-46 |
MsaG014247 | MsaG041306 | 0.801349 | 1.573517e-48 | 2.193287e-46 |
MsaG014247 | MsaG041336 | 0.808421 | 5.317205e-50 | 8.741142e-48 |
MsaG014247 | MsaG041819 | 0.801591 | 1.404600e-48 | 1.968598e-46 |
MsaG014247 | MsaG041949 | 0.800368 | 2.489583e-48 | 3.394215e-46 |
MsaG014247 | MsaG042415 | 0.803043 | 7.078385e-49 | 1.025572e-46 |
MsaG014247 | MsaG042579 | 0.858163 | 1.942886e-62 | 1.409477e-59 |
MsaG014247 | MsaG042717 | 0.818085 | 4.107435e-52 | 8.591813e-50 |
MsaG014247 | MsaG044218 | 0.803312 | 6.230703e-49 | 9.083685e-47 |
MsaG014247 | MsaG044451 | 0.806943 | 1.092057e-49 | 1.732857e-47 |
MsaG014247 | MsaG044622 | 0.825665 | 7.359454e-54 | 1.885491e-51 |
MsaG014247 | MsaG045078 | 0.810692 | 1.739543e-50 | 3.021119e-48 |
MsaG014247 | MsaG045310 | 0.869787 | 4.842700e-66 | 5.561780e-63 |
MsaG014247 | MsaG045262 | 0.865009 | 1.609029e-64 | 1.520734e-61 |
MsaG014247 | MsaG045372 | 0.811557 | 1.131571e-50 | 2.007352e-48 |
MsaG014247 | MsaG045374 | 0.807526 | 8.229168e-50 | 1.324021e-47 |
MsaG014247 | MsaG045392 | 0.843904 | 1.964506e-58 | 8.683617e-56 |
MsaG014247 | MsaG045395 | 0.801734 | 1.313368e-48 | 1.846760e-46 |
MsaG014247 | MsaG045567 | 0.804417 | 3.682346e-49 | 5.507642e-47 |
MsaG014247 | MsaG045568 | 0.828302 | 1.734303e-54 | 4.783072e-52 |
MsaG014247 | MsaG045576 | 0.814550 | 2.513902e-51 | 4.804738e-49 |
MsaG014247 | MsaG046027 | 0.813530 | 4.211823e-51 | 7.846661e-49 |
MsaG014247 | MsaG046473 | 0.872251 | 7.525112e-67 | 9.598442e-64 |
MsaG014247 | MsaG046498 | 0.832029 | 2.156904e-55 | 6.619284e-53 |
MsaG014247 | MsaG046507 | 0.858786 | 1.268799e-62 | 9.421543e-60 |
MsaG014247 | MsaG047019 | 0.808624 | 4.815628e-50 | 7.955231e-48 |
MsaG014247 | MsaG047047 | 0.812668 | 6.496772e-51 | 1.184518e-48 |
MsaG014247 | MsaG002204 | 0.809891 | 2.584424e-50 | 4.401848e-48 |
MsaG014247 | MsaG001950 | 0.810063 | 2.373971e-50 | 4.060280e-48 |
MsaG014247 | MsaG003742 | 0.833306 | 1.042889e-55 | 3.321894e-53 |
MsaG014247 | MsaG008251 | 0.838338 | 5.612584e-57 | 2.080014e-54 |
MsaG014247 | MsaG009266 | 0.817977 | 4.343785e-52 | 9.061109e-50 |
MsaG014247 | MsaG015507 | 0.804711 | 3.198725e-49 | 4.816933e-47 |
MsaG014247 | MsaG018209 | 0.854789 | 1.881376e-61 | 1.206252e-58 |
MsaG014247 | MsaG019866 | 0.804761 | 3.123844e-49 | 4.709723e-47 |
MsaG014247 | MsaG019592 | 0.851327 | 1.823104e-60 | 1.034351e-57 |
MsaG014247 | MsaG026434 | 0.810807 | 1.643138e-50 | 2.861784e-48 |
MsaG014247 | MsaG028121 | 0.811580 | 1.118583e-50 | 1.985463e-48 |
MsaG014247 | MsaG026431 | 0.837972 | 6.964220e-57 | 2.552013e-54 |
MsaG014247 | MsaG028141 | 0.835598 | 2.790115e-56 | 9.514599e-54 |
MsaG014247 | MsaG034262 | 0.853783 | 3.660793e-61 | 2.264531e-58 |
MsaG014247 | MsaG030190 | 0.823112 | 2.913845e-53 | 6.962885e-51 |
MsaG014247 | MsaG032408 | 0.806918 | 1.105326e-49 | 1.752886e-47 |
MsaG014247 | MsaG030214 | 0.818703 | 2.979415e-52 | 6.332926e-50 |
MsaG014247 | MsaG033182 | 0.806368 | 1.442392e-49 | 2.258036e-47 |
MsaG014247 | MsaG036471 | 0.814037 | 3.259620e-51 | 6.150274e-49 |
MsaG014247 | MsaG040777 | 0.822660 | 3.708551e-53 | 8.754321e-51 |
MsaG014247 | MsaG038711 | 0.812459 | 7.210553e-51 | 1.307920e-48 |
MsaG014247 | MsaG037513 | 0.802029 | 1.142827e-48 | 1.617739e-46 |
MsaG014247 | MsaG037376 | 0.807713 | 7.513101e-50 | 1.214264e-47 |
MsaG014247 | MsaG036473 | 0.844099 | 1.742677e-58 | 7.752564e-56 |
MsaG014247 | MsaG035795 | 0.827877 | 2.193403e-54 | 5.977459e-52 |
MsaG014247 | MsaG036029 | 0.800274 | 2.601986e-48 | 3.539787e-46 |
MsaG014247 | MsaG042989 | 0.816786 | 8.027425e-52 | 1.623945e-49 |
MsaG014247 | MsaG042833 | 0.814695 | 2.335626e-51 | 4.480370e-49 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG014247 | MtrunA17_Chr3g0103191 | 80.952 | 252 | 46 | 2 | 1 | 251 | 1 | 251 | 1.18e-147 | 414 |
MsaG014247 | MtrunA17_Chr3g0103181 | 72.887 | 284 | 72 | 3 | 1 | 284 | 1 | 279 | 8.14e-147 | 413 |
MsaG014247 | MtrunA17_Chr3g0103171 | 69.732 | 261 | 78 | 1 | 25 | 284 | 5 | 265 | 2.04e-129 | 368 |
MsaG014247 | MtrunA17_Chr3g0103201 | 76.923 | 221 | 49 | 2 | 65 | 284 | 1 | 220 | 4.29e-118 | 338 |
MsaG014247 | MtrunA17_Chr3g0103151 | 77.640 | 161 | 36 | 0 | 1 | 161 | 1 | 161 | 1.02e-89 | 264 |
MsaG014247 | MtrunA17_Chr3g0103161 | 66.935 | 124 | 40 | 1 | 162 | 285 | 2 | 124 | 3.94e-52 | 167 |
MsaG014247 | MtrunA17_Chr8g0390841 | 33.974 | 312 | 157 | 8 | 10 | 287 | 37 | 333 | 6.93e-51 | 175 |
MsaG014247 | MtrunA17_Chr8g0390841 | 48.438 | 64 | 30 | 2 | 223 | 285 | 457 | 518 | 3.12e-11 | 63.5 |
MsaG014247 | MtrunA17_Chr1g0163071 | 36.395 | 294 | 145 | 10 | 26 | 285 | 2 | 287 | 2.23e-49 | 166 |
MsaG014247 | MtrunA17_Chr1g0208771 | 32.886 | 298 | 150 | 8 | 21 | 285 | 10 | 290 | 1.12e-44 | 157 |
MsaG014247 | MtrunA17_Chr1g0208771 | 26.207 | 290 | 166 | 13 | 12 | 285 | 201 | 458 | 9.91e-12 | 65.1 |
MsaG014247 | MtrunA17_Chr7g0233561 | 31.561 | 301 | 185 | 6 | 7 | 286 | 13 | 313 | 3.73e-42 | 147 |
MsaG014247 | MtrunA17_Chr3g0131891 | 31.788 | 302 | 169 | 8 | 9 | 286 | 16 | 304 | 6.19e-39 | 139 |
MsaG014247 | MtrunA17_Chr7g0233521 | 31.716 | 268 | 173 | 4 | 25 | 286 | 1 | 264 | 1.40e-35 | 129 |
MsaG014247 | MtrunA17_Chr1g0163251 | 29.682 | 283 | 179 | 8 | 12 | 285 | 9 | 280 | 1.10e-30 | 118 |
MsaG014247 | MtrunA17_Chr5g0429931 | 30.075 | 266 | 154 | 5 | 21 | 285 | 8 | 242 | 1.35e-30 | 115 |
MsaG014247 | MtrunA17_Chr7g0233541 | 29.110 | 292 | 164 | 8 | 26 | 286 | 2 | 281 | 1.76e-30 | 116 |
MsaG014247 | MtrunA17_Chr4g0067431 | 31.949 | 313 | 161 | 13 | 10 | 284 | 13 | 311 | 2.26e-30 | 116 |
MsaG014247 | MtrunA17_Chr7g0233531 | 30.855 | 269 | 172 | 7 | 26 | 286 | 2 | 264 | 1.02e-29 | 114 |
MsaG014247 | MtrunA17_Chr3g0077451 | 28.947 | 266 | 148 | 5 | 24 | 287 | 10 | 236 | 7.81e-29 | 110 |
MsaG014247 | MtrunA17_Chr1g0163131 | 30.063 | 316 | 165 | 12 | 2 | 281 | 8 | 303 | 1.63e-28 | 111 |
MsaG014247 | MtrunA17_Chr7g0233571 | 37.908 | 153 | 93 | 1 | 4 | 154 | 2 | 154 | 8.23e-28 | 107 |
MsaG014247 | MtrunA17_Chr1g0163261 | 26.481 | 287 | 184 | 6 | 9 | 281 | 6 | 279 | 4.73e-27 | 107 |
MsaG014247 | MtrunA17_Chr5g0419201 | 35.333 | 150 | 93 | 2 | 12 | 157 | 16 | 165 | 1.56e-26 | 103 |
MsaG014247 | MtrunA17_Chr1g0163181 | 28.475 | 295 | 172 | 12 | 14 | 283 | 11 | 291 | 1.99e-26 | 107 |
MsaG014247 | MtrunA17_Chr3g0077411 | 28.136 | 295 | 172 | 7 | 1 | 284 | 251 | 516 | 9.97e-26 | 106 |
MsaG014247 | MtrunA17_Chr3g0077411 | 26.199 | 271 | 143 | 5 | 12 | 278 | 25 | 242 | 1.08e-20 | 91.7 |
MsaG014247 | MtrunA17_Chr3g0077461 | 30.970 | 268 | 133 | 8 | 12 | 274 | 237 | 457 | 2.75e-25 | 104 |
MsaG014247 | MtrunA17_Chr3g0077461 | 39.450 | 109 | 64 | 1 | 20 | 128 | 19 | 125 | 4.67e-19 | 87.0 |
MsaG014247 | MtrunA17_Chr1g0163221 | 30.717 | 293 | 174 | 11 | 10 | 284 | 9 | 290 | 7.19e-25 | 102 |
MsaG014247 | MtrunA17_Chr1g0163201 | 26.056 | 284 | 175 | 8 | 25 | 287 | 18 | 287 | 4.73e-24 | 100 |
MsaG014247 | MtrunA17_Chr1g0162441 | 36.957 | 138 | 75 | 3 | 8 | 133 | 1 | 138 | 2.92e-23 | 98.6 |
MsaG014247 | MtrunA17_Chr4g0033961 | 34.848 | 132 | 76 | 2 | 12 | 133 | 6 | 137 | 5.41e-22 | 95.1 |
MsaG014247 | MtrunA17_Chr1g0163231 | 24.913 | 289 | 186 | 9 | 9 | 283 | 6 | 277 | 1.23e-21 | 92.4 |
MsaG014247 | MtrunA17_Chr3g0077421 | 28.017 | 232 | 125 | 5 | 57 | 285 | 4 | 196 | 1.05e-19 | 85.1 |
MsaG014247 | MtrunA17_Chr3g0077441 | 28.017 | 232 | 125 | 5 | 57 | 285 | 4 | 196 | 1.05e-19 | 85.1 |
MsaG014247 | MtrunA17_Chr1g0162411 | 39.823 | 113 | 63 | 3 | 7 | 117 | 3 | 112 | 1.30e-19 | 88.6 |
MsaG014247 | MtrunA17_Chr3g0077431 | 27.660 | 235 | 125 | 6 | 57 | 287 | 4 | 197 | 3.52e-19 | 83.6 |
MsaG014247 | MtrunA17_Chr3g0077381 | 34.483 | 116 | 76 | 0 | 13 | 128 | 23 | 138 | 1.20e-18 | 85.5 |
MsaG014247 | MtrunA17_Chr3g0077381 | 42.529 | 87 | 50 | 0 | 22 | 108 | 259 | 345 | 5.38e-16 | 77.8 |
MsaG014247 | MtrunA17_Chr1g0171611 | 23.611 | 288 | 179 | 7 | 9 | 283 | 6 | 265 | 1.21e-18 | 84.0 |
MsaG014247 | MtrunA17_Chr6g0467351 | 32.692 | 156 | 91 | 3 | 10 | 162 | 13 | 157 | 2.40e-18 | 82.0 |
MsaG014247 | MtrunA17_Chr3g0077361 | 26.259 | 278 | 136 | 10 | 12 | 278 | 40 | 259 | 3.81e-18 | 84.3 |
MsaG014247 | MtrunA17_Chr4g0009491 | 34.711 | 121 | 68 | 1 | 22 | 131 | 237 | 357 | 5.42e-18 | 83.6 |
MsaG014247 | MtrunA17_Chr4g0009491 | 30.973 | 113 | 78 | 0 | 16 | 128 | 3 | 115 | 5.67e-15 | 74.7 |
MsaG014247 | MtrunA17_Chr1g0163241 | 36.522 | 115 | 66 | 3 | 15 | 126 | 14 | 124 | 1.15e-17 | 78.6 |
MsaG014247 | MtrunA17_Chr1g0163191 | 31.304 | 115 | 75 | 2 | 12 | 126 | 9 | 119 | 1.26e-17 | 78.6 |
MsaG014247 | MtrunA17_Chr1g0163061 | 40.385 | 104 | 59 | 2 | 8 | 108 | 11 | 114 | 1.40e-17 | 80.9 |
MsaG014247 | MtrunA17_Chr1g0154161 | 23.077 | 286 | 203 | 6 | 13 | 287 | 30 | 309 | 4.85e-17 | 80.1 |
MsaG014247 | MtrunA17_Chr6g0476181 | 41.509 | 106 | 59 | 2 | 26 | 131 | 2 | 104 | 5.11e-17 | 76.6 |
MsaG014247 | MtrunA17_Chr1g0154131 | 22.222 | 288 | 205 | 6 | 10 | 281 | 182 | 466 | 2.16e-16 | 79.0 |
MsaG014247 | MtrunA17_Chr1g0163161 | 41.176 | 102 | 51 | 3 | 38 | 133 | 1 | 99 | 1.10e-15 | 72.4 |
MsaG014247 | MtrunA17_Chr1g0163081 | 39.130 | 115 | 60 | 4 | 26 | 134 | 6 | 116 | 1.56e-15 | 72.4 |
MsaG014247 | MtrunA17_Chr1g0162161 | 29.545 | 176 | 96 | 7 | 26 | 196 | 4 | 156 | 7.55e-15 | 70.9 |
MsaG014247 | MtrunA17_Chr1g0163121 | 35.461 | 141 | 75 | 6 | 24 | 158 | 9 | 139 | 1.07e-14 | 70.1 |
MsaG014247 | MtrunA17_Chr1g0163101 | 30.496 | 141 | 87 | 5 | 2 | 134 | 7 | 144 | 1.80e-14 | 70.5 |
MsaG014247 | MtrunA17_Chr1g0163141 | 39.583 | 96 | 55 | 2 | 24 | 119 | 9 | 101 | 1.85e-14 | 70.5 |
MsaG014247 | MtrunA17_Chr1g0162421 | 39.655 | 58 | 35 | 0 | 24 | 81 | 7 | 64 | 2.55e-11 | 58.2 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG014247 | AT3G18990.1 | 26.765 | 340 | 183 | 10 | 8 | 285 | 1 | 336 | 2.64e-34 | 127 |
MsaG014247 | AT3G18990.2 | 26.765 | 340 | 183 | 10 | 8 | 285 | 1 | 336 | 5.57e-34 | 127 |
MsaG014247 | AT1G49475.1 | 38.843 | 121 | 70 | 3 | 11 | 129 | 33 | 151 | 3.27e-19 | 84.0 |
MsaG014247 | AT4G01580.1 | 32.609 | 138 | 85 | 2 | 11 | 146 | 29 | 160 | 2.06e-18 | 81.6 |
MsaG014247 | AT3G18960.2 | 39.000 | 100 | 59 | 1 | 11 | 108 | 29 | 128 | 1.29e-17 | 79.7 |
MsaG014247 | AT3G18960.1 | 39.000 | 100 | 59 | 1 | 11 | 108 | 29 | 128 | 1.35e-17 | 79.7 |
MsaG014247 | AT4G33280.1 | 25.083 | 303 | 194 | 10 | 10 | 285 | 23 | 319 | 9.15e-17 | 79.7 |
MsaG014247 | AT3G18960.3 | 41.667 | 84 | 49 | 0 | 25 | 108 | 8 | 91 | 6.62e-15 | 71.6 |
MsaG014247 | AT1G49480.3 | 29.457 | 129 | 84 | 4 | 160 | 285 | 97 | 221 | 2.79e-13 | 68.2 |
MsaG014247 | AT1G49480.1 | 29.457 | 129 | 84 | 4 | 160 | 285 | 97 | 221 | 2.79e-13 | 68.2 |
MsaG014247 | AT1G49480.2 | 29.457 | 129 | 84 | 4 | 160 | 285 | 97 | 221 | 2.79e-13 | 68.2 |
Find 51 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
CGACCACATAAGAAAGTTAA+AGG | 0.201598 | 3:+69713336 | MsaT014247.1:CDS |
TGTCTCCTAGTAAACTTATT+TGG | 0.219584 | 3:-69712964 | None:intergenic |
GCACTAAATGGAAAGTTTAT+TGG | 0.220986 | 3:+69713031 | MsaT014247.1:CDS |
TCCTGAGCTCTAGCATCTTT+TGG | 0.280232 | 3:-69720394 | None:intergenic |
CAATCCTTTGAAGATTAGTT+TGG | 0.289306 | 3:-69712657 | None:intergenic |
AGACTCCTGATGGCACTAAA+TGG | 0.296213 | 3:+69713019 | MsaT014247.1:CDS |
CTCTCTTGGACATGGCTGTT+TGG | 0.307883 | 3:+69713113 | MsaT014247.1:CDS |
GGTGAGATTTGGTTTGAAAA+TGG | 0.311641 | 3:+69713066 | MsaT014247.1:CDS |
TTTACTGAAAATTACTCTCT+TGG | 0.354240 | 3:+69713099 | MsaT014247.1:CDS |
AAAGAACTTCATCAATGAAT+TGG | 0.387908 | 3:+69720371 | MsaT014247.1:CDS |
TATGTAACTGCAGATTTAAA+AGG | 0.392361 | 3:+69720614 | MsaT014247.1:CDS |
TCTTAGATGAATGGCTTAAT+CGG | 0.403352 | 3:+69713277 | MsaT014247.1:CDS |
AATCTATTTCCACTGCATTC+CGG | 0.411258 | 3:-69713185 | None:intergenic |
CACTTGAGATCTTAGATGAA+TGG | 0.431142 | 3:+69713268 | MsaT014247.1:CDS |
ACTTTCCATTTAGTGCCATC+AGG | 0.440549 | 3:-69713024 | None:intergenic |
AGTATGTGATTCTGCAGATT+GGG | 0.463556 | 3:+69720657 | MsaT014247.1:CDS |
AAACCTTTAACTTTCTTATG+TGG | 0.464229 | 3:-69713339 | None:intergenic |
TCCTTTGAAGATTAGTTTGG+AGG | 0.466963 | 3:-69712654 | None:intergenic |
ACTTCAAACAGATACATTAA+CGG | 0.476013 | 3:-69720858 | None:intergenic |
TTCACTTTCGCTTGCAAACA+AGG | 0.476076 | 3:-69720753 | None:intergenic |
AGATTTGGTTTGAAAATGGT+TGG | 0.487548 | 3:+69713070 | MsaT014247.1:CDS |
AAATATGTGTACATCAAACT+TGG | 0.487598 | 3:-69713160 | None:intergenic |
AAATACCAAATAAGTTTACT+AGG | 0.488511 | 3:+69712959 | MsaT014247.1:CDS |
TTGGTGGTGTTTGAATATAA+AGG | 0.491592 | 3:+69713132 | MsaT014247.1:CDS |
TGCAGATTGGGAAAAGATCA+TGG | 0.498577 | 3:+69720669 | MsaT014247.1:CDS |
GATATAATTTCCTTTAGCCA+TGG | 0.504996 | 3:-69712605 | None:intergenic |
TTAACTTTCTTATGTGGTCG+AGG | 0.505436 | 3:-69713333 | None:intergenic |
TCTTGGACATGGCTGTTTGG+TGG | 0.505898 | 3:+69713116 | MsaT014247.1:CDS |
ACTCCATCATCCATGGCTAA+AGG | 0.511990 | 3:+69712595 | None:intergenic |
TGTGGTCGAGGAGAAGCTAA+TGG | 0.512745 | 3:-69713321 | None:intergenic |
GCCAAAAGATGCTAGAGCTC+AGG | 0.513948 | 3:+69720393 | MsaT014247.1:CDS |
CCAGCTTACTATCTACTGTA+TGG | 0.515143 | 3:-69720474 | None:intergenic |
AATGGTTTCTATCTATCGGC+GGG | 0.522564 | 3:+69720725 | MsaT014247.1:CDS |
GAGTATGTGATTCTGCAGAT+TGG | 0.526064 | 3:+69720656 | MsaT014247.1:CDS |
TTGATGTACACATATTTGAC+CGG | 0.536461 | 3:+69713166 | MsaT014247.1:CDS |
TCAGGAGTCTTTATCAACAC+TGG | 0.545485 | 3:-69713006 | None:intergenic |
GTTTCTATCTATCGGCGGGT+TGG | 0.546695 | 3:+69720729 | MsaT014247.1:CDS |
TCCTCCAAACTAATCTTCAA+AGG | 0.552905 | 3:+69712653 | MsaT014247.1:CDS |
AGCGAAAGTGAACTGCAACC+AGG | 0.561940 | 3:+69720764 | MsaT014247.1:CDS |
TCAAAGACACAAACATCTCC+TGG | 0.563620 | 3:-69720782 | None:intergenic |
TGAATGGCTTAATCGGAAGA+AGG | 0.573439 | 3:+69713284 | MsaT014247.1:CDS |
AAATGGTTTCTATCTATCGG+CGG | 0.576380 | 3:+69720724 | MsaT014247.1:CDS |
CCATACAGTAGATAGTAAGC+TGG | 0.603183 | 3:+69720474 | MsaT014247.1:CDS |
TTACTATCTACTGTATGGTG+AGG | 0.604910 | 3:-69720469 | None:intergenic |
AGGAGTTATTGAGAACAAAG+AGG | 0.607683 | 3:+69720634 | MsaT014247.1:CDS |
CATATTTGACCGGAATGCAG+TGG | 0.622074 | 3:+69713176 | MsaT014247.1:CDS |
GAAAATTACTCTCTTGGACA+TGG | 0.632483 | 3:+69713105 | MsaT014247.1:CDS |
AATAAGTTTACTAGGAGACA+TGG | 0.640204 | 3:+69712967 | MsaT014247.1:CDS |
GTGTTGATAAAGACTCCTGA+TGG | 0.643737 | 3:+69713009 | MsaT014247.1:CDS |
ATCGGAAGAAGGCTAGACAA+AGG | 0.662228 | 3:+69713295 | MsaT014247.1:CDS |
GAAATTGATCTGTTCTAACG+AGG | 0.726190 | 3:+69720697 | MsaT014247.1:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr3 | gene | 69712607 | 69720877 | 69712607 | ID=MsaG014247 |
Chr3 | mRNA | 69712607 | 69720877 | 69712607 | ID=MsaT014247.1;Parent=MsaG014247 |
Chr3 | exon | 69712607 | 69712678 | 69712607 | ID=MsaT014247.1.exon1;Parent=MsaT014247.1 |
Chr3 | CDS | 69712607 | 69712678 | 69712607 | ID=cds.MsaT014247.1;Parent=MsaT014247.1 |
Chr3 | exon | 69712958 | 69713357 | 69712958 | ID=MsaT014247.1.exon2;Parent=MsaT014247.1 |
Chr3 | CDS | 69712958 | 69713357 | 69712958 | ID=cds.MsaT014247.1;Parent=MsaT014247.1 |
Chr3 | exon | 69720350 | 69720495 | 69720350 | ID=MsaT014247.1.exon3;Parent=MsaT014247.1 |
Chr3 | CDS | 69720350 | 69720495 | 69720350 | ID=cds.MsaT014247.1;Parent=MsaT014247.1 |
Chr3 | exon | 69720614 | 69720877 | 69720614 | ID=MsaT014247.1.exon4;Parent=MsaT014247.1 |
Chr3 | CDS | 69720614 | 69720877 | 69720614 | ID=cds.MsaT014247.1;Parent=MsaT014247.1 |
Gene Sequence |
Protein sequence |