Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG014251 | XP_003600453.1 | 76.316 | 114 | 27 | 0 | 1 | 114 | 171 | 284 | 2.08e-56 | 186 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG014251 | tr|G8A2Z4|G8A2Z4_MEDTR | 76.316 | 114 | 27 | 0 | 1 | 114 | 171 | 284 | 9.94e-57 | 186 |
Gene ID | Type | Classification |
---|---|---|
MsaG014251 | TF | B3 |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000118 | MsaG014251 | 0.825563 | 7.776034e-54 | 1.986638e-51 |
MsaG000523 | MsaG014251 | 0.812238 | 8.055261e-51 | 1.453033e-48 |
MsaG001390 | MsaG014251 | 0.804969 | 2.826871e-49 | 4.282642e-47 |
MsaG004084 | MsaG014251 | 0.811183 | 1.363132e-50 | 2.396032e-48 |
MsaG004902 | MsaG014251 | 0.820511 | 1.157251e-52 | 2.579858e-50 |
MsaG005394 | MsaG014251 | 0.805457 | 2.236745e-49 | 3.427221e-47 |
MsaG006119 | MsaG014251 | 0.822397 | 4.267218e-53 | 1.000193e-50 |
MsaG006979 | MsaG014251 | 0.817688 | 5.043807e-52 | 1.044277e-49 |
MsaG010497 | MsaG014251 | 0.804346 | 3.808823e-49 | 5.687624e-47 |
MsaG013266 | MsaG014251 | 0.824158 | 1.662167e-53 | 4.086106e-51 |
MsaG014125 | MsaG014251 | 0.965793 | 1.763034e-124 | 1.405567e-118 |
MsaG014251 | MsaG018121 | 0.802580 | 8.810202e-49 | 1.263014e-46 |
MsaG014251 | MsaG018974 | 0.819207 | 2.291817e-52 | 4.936368e-50 |
MsaG014251 | MsaG027237 | 0.806527 | 1.335960e-49 | 2.099268e-47 |
MsaG014251 | MsaG040952 | 0.827859 | 2.215041e-54 | 6.033343e-52 |
MsaG014251 | MsaG042772 | 0.806207 | 1.558807e-49 | 2.431079e-47 |
MsaG014251 | MsaG045506 | 0.810896 | 1.572245e-50 | 2.744208e-48 |
MsaG014251 | MsaG045980 | 0.822164 | 4.828899e-53 | 1.124767e-50 |
MsaG014251 | MsaG046794 | 0.808712 | 4.611861e-50 | 7.635257e-48 |
MsaG014251 | MsaG002695 | 0.813447 | 4.391892e-51 | 8.165097e-49 |
MsaG014251 | MsaG008516 | 0.818106 | 4.063137e-52 | 8.503910e-50 |
MsaG014251 | MsaG026065 | 0.818928 | 2.649911e-52 | 5.665970e-50 |
MsaG014251 | MsaG031431 | 0.819830 | 1.654409e-52 | 3.622111e-50 |
MsaG014251 | MsaG036797 | 0.807342 | 9.000048e-50 | 1.441681e-47 |
MsaG014251 | MsaG041605 | 0.800590 | 2.244699e-48 | 3.075728e-46 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG014251 | MtrunA17_Chr3g0103201 | 74.561 | 114 | 29 | 0 | 1 | 114 | 107 | 220 | 3.60e-57 | 176 |
MsaG014251 | MtrunA17_Chr3g0103161 | 69.231 | 117 | 36 | 0 | 2 | 118 | 11 | 127 | 2.48e-55 | 168 |
MsaG014251 | MtrunA17_Chr3g0103181 | 69.912 | 113 | 34 | 0 | 2 | 114 | 167 | 279 | 6.91e-51 | 162 |
MsaG014251 | MtrunA17_Chr3g0103171 | 63.793 | 116 | 40 | 1 | 1 | 114 | 150 | 265 | 1.97e-44 | 145 |
MsaG014251 | MtrunA17_Chr3g0103191 | 69.512 | 82 | 24 | 1 | 1 | 81 | 170 | 251 | 3.68e-32 | 113 |
MsaG014251 | MtrunA17_Chr8g0390841 | 52.381 | 63 | 29 | 1 | 53 | 115 | 457 | 518 | 6.59e-16 | 72.4 |
MsaG014251 | MtrunA17_Chr8g0390841 | 33.333 | 114 | 66 | 3 | 5 | 115 | 225 | 331 | 3.20e-13 | 64.7 |
MsaG014251 | MtrunA17_Chr1g0208771 | 36.522 | 115 | 68 | 3 | 5 | 115 | 345 | 458 | 1.76e-15 | 70.9 |
MsaG014251 | MtrunA17_Chr1g0208771 | 34.862 | 109 | 59 | 6 | 13 | 117 | 192 | 292 | 1.08e-12 | 63.2 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Find 22 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
TCAATAACCCCTTTAAAATC+TGG | 0.344940 | 3:+69753829 | None:intergenic |
ACTGATAAACAAGAAAGATT+TGG | 0.358474 | 3:-69753647 | MsaT014251.1:CDS |
CGTTGTTACGAAGGCAGATA+TGG | 0.391650 | 3:-69753745 | MsaT014251.1:CDS |
ATAGAACTTCATCAATGAAT+TGG | 0.394729 | 3:-69754052 | None:intergenic |
AGTGAGAGTGGACTGGAATC+AGG | 0.399530 | 3:-69753688 | MsaT014251.1:CDS |
TCTCGAGCTCTAGCATCCTT+TGG | 0.429549 | 3:+69754029 | None:intergenic |
AGAATGTGATGATGCAGATT+AGG | 0.440524 | 3:-69753795 | MsaT014251.1:CDS |
AAACTTAATCATATAGAAGA+TGG | 0.505339 | 3:-69753957 | MsaT014251.1:CDS |
GTCGTCGCCTTTCCGTGGGT+TGG | 0.516583 | 3:-69753723 | MsaT014251.1:CDS |
TGATGATGCAGATTAGGAAA+AGG | 0.518118 | 3:-69753789 | MsaT014251.1:CDS |
TCATATAGAAGATGGTCAGC+TGG | 0.541802 | 3:-69753949 | MsaT014251.1:intron |
TAAAGGGGTTATTGAGAACA+AGG | 0.546960 | 3:-69753821 | MsaT014251.1:CDS |
TATGGTCGTCGCCTTTCCGT+GGG | 0.562523 | 3:-69753727 | MsaT014251.1:CDS |
ATATGGTCGTCGCCTTTCCG+TGG | 0.567959 | 3:-69753728 | MsaT014251.1:CDS |
TCATTGTTTGCAAGTGAGAG+TGG | 0.589705 | 3:-69753700 | MsaT014251.1:CDS |
TTCATCAATGAATTGGCCAA+AGG | 0.600242 | 3:-69754045 | None:intergenic |
ACAATGACCAACCCACGGAA+AGG | 0.604310 | 3:+69753716 | None:intergenic |
AAATTACTCCGTTGTTACGA+AGG | 0.605850 | 3:-69753754 | MsaT014251.1:CDS |
GTTTGCAAGTGAGAGTGGAC+TGG | 0.609003 | 3:-69753695 | MsaT014251.1:CDS |
TGCAGATTAGGAAAAGGTCA+TGG | 0.613419 | 3:-69753783 | MsaT014251.1:CDS |
TGCAAACAATGACCAACCCA+CGG | 0.632224 | 3:+69753711 | None:intergenic |
CATATCTGCCTTCGTAACAA+CGG | 0.666214 | 3:+69753746 | None:intergenic |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr3 | gene | 69753612 | 69754060 | 69753612 | ID=MsaG014251 |
Chr3 | mRNA | 69753612 | 69754060 | 69753612 | ID=MsaT014251.1;Parent=MsaG014251 |
Chr3 | exon | 69753612 | 69753857 | 69753612 | ID=MsaT014251.1.exon2;Parent=MsaT014251.1 |
Chr3 | CDS | 69753612 | 69753857 | 69753612 | ID=cds.MsaT014251.1;Parent=MsaT014251.1 |
Chr3 | exon | 69753950 | 69754060 | 69753950 | ID=MsaT014251.1.exon1;Parent=MsaT014251.1 |
Chr3 | CDS | 69753950 | 69754060 | 69753950 | ID=cds.MsaT014251.1;Parent=MsaT014251.1 |
Gene Sequence |
Protein sequence |