Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG015371 | XP_003601228.2 | 93.542 | 480 | 31 | 0 | 15 | 494 | 16 | 495 | 0.0 | 939 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG015371 | sp|Q08BY5|JMJD4_DANRE | 40.000 | 335 | 172 | 6 | 20 | 351 | 34 | 342 | 1.82e-77 | 251 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG015371 | tr|G7J4W1|G7J4W1_MEDTR | 93.542 | 480 | 31 | 0 | 15 | 494 | 16 | 495 | 0.0 | 939 |
Gene ID | Type | Classification |
---|---|---|
MsaG015371 | TR | Jumonji |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000717 | MsaG015371 | 0.863963 | 3.403932e-64 | 3.085653e-61 |
MsaG001026 | MsaG015371 | 0.812873 | 5.861627e-51 | 1.074215e-48 |
MsaG001134 | MsaG015371 | 0.813679 | 3.906169e-51 | 7.304428e-49 |
MsaG001468 | MsaG015371 | 0.840471 | 1.576500e-57 | 6.246111e-55 |
MsaG001542 | MsaG015371 | 0.842356 | 5.057501e-58 | 2.127282e-55 |
MsaG001551 | MsaG015371 | 0.835118 | 3.682776e-56 | 1.237948e-53 |
MsaG001939 | MsaG015371 | 0.848667 | 1.003630e-59 | 5.198025e-57 |
MsaG002379 | MsaG015371 | 0.844456 | 1.399152e-58 | 6.297238e-56 |
MsaG002489 | MsaG015371 | 0.831189 | 3.465507e-55 | 1.037685e-52 |
MsaG002775 | MsaG015371 | 0.807960 | 6.660446e-50 | 1.082857e-47 |
MsaG003861 | MsaG015371 | 0.842994 | 3.429691e-58 | 1.472436e-55 |
MsaG004006 | MsaG015371 | 0.820169 | 1.385115e-52 | 3.060162e-50 |
MsaG003932 | MsaG015371 | 0.823558 | 2.294960e-53 | 5.550732e-51 |
MsaG003936 | MsaG015371 | 0.818993 | 2.561511e-52 | 5.486292e-50 |
MsaG004107 | MsaG015371 | 0.866624 | 4.999227e-65 | 5.042423e-62 |
MsaG004184 | MsaG015371 | 0.841848 | 6.880657e-58 | 2.847566e-55 |
MsaG004452 | MsaG015371 | 0.835810 | 2.465853e-56 | 8.462410e-54 |
MsaG005410 | MsaG015371 | 0.823905 | 1.904354e-53 | 4.649554e-51 |
MsaG005496 | MsaG015371 | 0.832886 | 1.325576e-55 | 4.170484e-53 |
MsaG005526 | MsaG015371 | 0.851919 | 1.240928e-60 | 7.188660e-58 |
MsaG005603 | MsaG015371 | 0.831663 | 2.651870e-55 | 8.052114e-53 |
MsaG005792 | MsaG015371 | 0.840394 | 1.651677e-57 | 6.528166e-55 |
MsaG005869 | MsaG015371 | 0.866708 | 4.700730e-65 | 4.757567e-62 |
MsaG006500 | MsaG015371 | 0.821610 | 6.477484e-53 | 1.486678e-50 |
MsaG006620 | MsaG015371 | 0.816577 | 8.936976e-52 | 1.798250e-49 |
MsaG006670 | MsaG015371 | 0.822437 | 4.176546e-53 | 9.799916e-51 |
MsaG006809 | MsaG015371 | 0.837763 | 7.877428e-57 | 2.868121e-54 |
MsaG006842 | MsaG015371 | 0.815206 | 1.802023e-51 | 3.501663e-49 |
MsaG007139 | MsaG015371 | 0.818374 | 3.535357e-52 | 7.450539e-50 |
MsaG007616 | MsaG015371 | 0.828662 | 1.420929e-54 | 3.958548e-52 |
MsaG007817 | MsaG015371 | 0.835249 | 3.413769e-56 | 1.151994e-53 |
MsaG008029 | MsaG015371 | 0.814543 | 2.523862e-51 | 4.822783e-49 |
MsaG008056 | MsaG015371 | 0.800668 | 2.164422e-48 | 2.970994e-46 |
MsaG008222 | MsaG015371 | 0.817019 | 7.123541e-52 | 1.449773e-49 |
MsaG008234 | MsaG015371 | 0.854751 | 1.929539e-61 | 1.235491e-58 |
MsaG008561 | MsaG015371 | 0.828844 | 1.285008e-54 | 3.598056e-52 |
MsaG008619 | MsaG015371 | 0.887960 | 1.964786e-72 | 5.215512e-69 |
MsaG009656 | MsaG015371 | 0.801580 | 1.411537e-48 | 1.977821e-46 |
MsaG010829 | MsaG015371 | 0.823003 | 3.088452e-53 | 7.358549e-51 |
MsaG011175 | MsaG015371 | 0.804757 | 3.129003e-49 | 4.717128e-47 |
MsaG011474 | MsaG015371 | 0.803180 | 6.634492e-49 | 9.642946e-47 |
MsaG011584 | MsaG015371 | 0.805921 | 1.789417e-49 | 2.771765e-47 |
MsaG011624 | MsaG015371 | 0.817232 | 6.382565e-52 | 1.306134e-49 |
MsaG011831 | MsaG015371 | 0.866316 | 6.256159e-65 | 6.230260e-62 |
MsaG012015 | MsaG015371 | 0.837948 | 7.061021e-57 | 2.585624e-54 |
MsaG012522 | MsaG015371 | 0.853117 | 5.674662e-61 | 3.428389e-58 |
MsaG012549 | MsaG015371 | 0.830199 | 6.041860e-55 | 1.758530e-52 |
MsaG012723 | MsaG015371 | 0.860269 | 4.568336e-63 | 3.589173e-60 |
MsaG013271 | MsaG015371 | 0.858456 | 1.589941e-62 | 1.166214e-59 |
MsaG014855 | MsaG015371 | 0.801408 | 1.530618e-48 | 2.136357e-46 |
MsaG015236 | MsaG015371 | 0.852016 | 1.165436e-60 | 6.774496e-58 |
MsaG015371 | MsaG015871 | 0.813125 | 5.164304e-51 | 9.523820e-49 |
MsaG015371 | MsaG016209 | 0.875325 | 6.979759e-68 | 1.018159e-64 |
MsaG015371 | MsaG016215 | 0.875316 | 7.034239e-68 | 1.025674e-64 |
MsaG015371 | MsaG016327 | 0.858985 | 1.106849e-62 | 8.280724e-60 |
MsaG015371 | MsaG016471 | 0.841424 | 8.891109e-58 | 3.630214e-55 |
MsaG015371 | MsaG017009 | 0.876466 | 2.843237e-68 | 4.364829e-65 |
MsaG015371 | MsaG017068 | 0.807897 | 6.870298e-50 | 1.115298e-47 |
MsaG015371 | MsaG017081 | 0.831100 | 3.643437e-55 | 1.088189e-52 |
MsaG015371 | MsaG017189 | 0.858210 | 1.880666e-62 | 1.366768e-59 |
MsaG015371 | MsaG017324 | 0.819608 | 1.858539e-52 | 4.045139e-50 |
MsaG015371 | MsaG017644 | 0.890138 | 2.840371e-73 | 8.431530e-70 |
MsaG015371 | MsaG017699 | 0.828386 | 1.656317e-54 | 4.578906e-52 |
MsaG015371 | MsaG017954 | 0.851643 | 1.484597e-60 | 8.516067e-58 |
MsaG015371 | MsaG017983 | 0.838304 | 5.725725e-57 | 2.119786e-54 |
MsaG015371 | MsaG018085 | 0.826627 | 4.355050e-54 | 1.146034e-51 |
MsaG015371 | MsaG018169 | 0.838963 | 3.876421e-57 | 1.464960e-54 |
MsaG015371 | MsaG018223 | 0.842992 | 3.433275e-58 | 1.473909e-55 |
MsaG015371 | MsaG018754 | 0.827623 | 2.522514e-54 | 6.825651e-52 |
MsaG015371 | MsaG018959 | 0.811039 | 1.463966e-50 | 2.564263e-48 |
MsaG015371 | MsaG019120 | 0.852242 | 1.005723e-60 | 5.892117e-58 |
MsaG015371 | MsaG019223 | 0.824112 | 1.703656e-53 | 4.183060e-51 |
MsaG015371 | MsaG019491 | 0.829660 | 8.161473e-55 | 2.339138e-52 |
MsaG015371 | MsaG019526 | 0.813012 | 5.464494e-51 | 1.004939e-48 |
MsaG015371 | MsaG019527 | 0.826517 | 4.624989e-54 | 1.213396e-51 |
MsaG015371 | MsaG019638 | 0.849649 | 5.367986e-60 | 2.874950e-57 |
MsaG015371 | MsaG019649 | 0.856368 | 6.546970e-62 | 4.445607e-59 |
MsaG015371 | MsaG019907 | 0.823013 | 3.071162e-53 | 7.319365e-51 |
MsaG015371 | MsaG019936 | 0.812658 | 6.529105e-51 | 1.190120e-48 |
MsaG015371 | MsaG020021 | 0.867865 | 2.014561e-65 | 2.137092e-62 |
MsaG015371 | MsaG020321 | 0.801740 | 1.309456e-48 | 1.841506e-46 |
MsaG015371 | MsaG020382 | 0.824172 | 1.650033e-53 | 4.057806e-51 |
MsaG015371 | MsaG020550 | 0.842230 | 5.456854e-58 | 2.285819e-55 |
MsaG015371 | MsaG020733 | 0.889777 | 3.924942e-73 | 1.143522e-69 |
MsaG015371 | MsaG020812 | 0.802555 | 8.916520e-49 | 1.277526e-46 |
MsaG015371 | MsaG021515 | 0.855135 | 1.494049e-61 | 9.698971e-59 |
MsaG015371 | MsaG022766 | 0.819299 | 2.183694e-52 | 4.714958e-50 |
MsaG015371 | MsaG022811 | 0.829984 | 6.812421e-55 | 1.970664e-52 |
MsaG015371 | MsaG023188 | 0.854119 | 2.933916e-61 | 1.836726e-58 |
MsaG015371 | MsaG023649 | 0.810270 | 2.142936e-50 | 3.683674e-48 |
MsaG015371 | MsaG023729 | 0.865990 | 7.926542e-65 | 7.790924e-62 |
MsaG015371 | MsaG023756 | 0.804167 | 4.148180e-49 | 6.168662e-47 |
MsaG015371 | MsaG023861 | 0.878805 | 4.380067e-69 | 7.482383e-66 |
MsaG015371 | MsaG024295 | 0.820242 | 1.333329e-52 | 2.951468e-50 |
MsaG015371 | MsaG025143 | 0.856456 | 6.170084e-62 | 4.203121e-59 |
MsaG015371 | MsaG026587 | 0.830360 | 5.519107e-55 | 1.613786e-52 |
MsaG015371 | MsaG026686 | 0.878345 | 6.349440e-69 | 1.061685e-65 |
MsaG015371 | MsaG026692 | 0.818268 | 3.734905e-52 | 7.849588e-50 |
MsaG015371 | MsaG027170 | 0.827413 | 2.830942e-54 | 7.615011e-52 |
MsaG015371 | MsaG027198 | 0.863960 | 3.410387e-64 | 3.091116e-61 |
MsaG015371 | MsaG027207 | 0.835160 | 3.595622e-56 | 1.210147e-53 |
MsaG015371 | MsaG027210 | 0.841499 | 8.497716e-58 | 3.477791e-55 |
MsaG015371 | MsaG027376 | 0.815276 | 1.738392e-51 | 3.384085e-49 |
MsaG015371 | MsaG027483 | 0.829096 | 1.117483e-54 | 3.151371e-52 |
MsaG015371 | MsaG027738 | 0.822135 | 4.904548e-53 | 1.141525e-50 |
MsaG015371 | MsaG027828 | 0.830585 | 4.865171e-55 | 1.431692e-52 |
MsaG015371 | MsaG027807 | 0.802395 | 9.618569e-49 | 1.373069e-46 |
MsaG015371 | MsaG027963 | 0.873021 | 4.171617e-67 | 5.500707e-64 |
MsaG015371 | MsaG027984 | 0.844577 | 1.298216e-58 | 5.866369e-56 |
MsaG015371 | MsaG027987 | 0.826433 | 4.843889e-54 | 1.267872e-51 |
MsaG015371 | MsaG028028 | 0.846401 | 4.183105e-59 | 2.007773e-56 |
MsaG015371 | MsaG028191 | 0.816022 | 1.188000e-51 | 2.356746e-49 |
MsaG015371 | MsaG028211 | 0.858457 | 1.589046e-62 | 1.165608e-59 |
MsaG015371 | MsaG028335 | 0.856370 | 6.540200e-62 | 4.441294e-59 |
MsaG015371 | MsaG028420 | 0.801695 | 1.337280e-48 | 1.878705e-46 |
MsaG015371 | MsaG028531 | 0.882000 | 3.196986e-70 | 6.336626e-67 |
MsaG015371 | MsaG029048 | 0.804126 | 4.231120e-49 | 6.285984e-47 |
MsaG015371 | MsaG029141 | 0.803341 | 6.146709e-49 | 8.967078e-47 |
MsaG015371 | MsaG029212 | 0.816517 | 9.217683e-52 | 1.851826e-49 |
MsaG015371 | MsaG029546 | 0.854518 | 2.252564e-61 | 1.430463e-58 |
MsaG015371 | MsaG029579 | 0.811491 | 1.169580e-50 | 2.071405e-48 |
MsaG015371 | MsaG029953 | 0.850934 | 2.349834e-60 | 1.315290e-57 |
MsaG015371 | MsaG030649 | 0.817209 | 6.456686e-52 | 1.320536e-49 |
MsaG015371 | MsaG031091 | 0.815084 | 1.916708e-51 | 3.713006e-49 |
MsaG015371 | MsaG031129 | 0.833710 | 8.280527e-56 | 2.669126e-53 |
MsaG015371 | MsaG032848 | 0.840087 | 1.984637e-57 | 7.768775e-55 |
MsaG015371 | MsaG032901 | 0.838540 | 4.979893e-57 | 1.857328e-54 |
MsaG015371 | MsaG033051 | 0.831039 | 3.771346e-55 | 1.124395e-52 |
MsaG015371 | MsaG034047 | 0.810815 | 1.636275e-50 | 2.850373e-48 |
MsaG015371 | MsaG034319 | 0.807613 | 7.888753e-50 | 1.271874e-47 |
MsaG015371 | MsaG034514 | 0.817013 | 7.142438e-52 | 1.453428e-49 |
MsaG015371 | MsaG034836 | 0.829320 | 9.861866e-55 | 2.798954e-52 |
MsaG015371 | MsaG035233 | 0.812197 | 8.221616e-51 | 1.481575e-48 |
MsaG015371 | MsaG036065 | 0.853617 | 4.083994e-61 | 2.511232e-58 |
MsaG015371 | MsaG036423 | 0.829626 | 8.319926e-55 | 2.382258e-52 |
MsaG015371 | MsaG039734 | 0.817599 | 5.279834e-52 | 1.090689e-49 |
MsaG015371 | MsaG039902 | 0.804997 | 2.789056e-49 | 4.228157e-47 |
MsaG015371 | MsaG040270 | 0.802707 | 8.300477e-49 | 1.193338e-46 |
MsaG015371 | MsaG040504 | 0.887753 | 2.354234e-72 | 6.182930e-69 |
MsaG015371 | MsaG040577 | 0.818077 | 4.122743e-52 | 8.622263e-50 |
MsaG015371 | MsaG040600 | 0.812703 | 6.380870e-51 | 1.164466e-48 |
MsaG015371 | MsaG041334 | 0.803929 | 4.647725e-49 | 6.873337e-47 |
MsaG015371 | MsaG041754 | 0.848312 | 1.257478e-59 | 6.434612e-57 |
MsaG015371 | MsaG041800 | 0.869544 | 5.805267e-66 | 6.599840e-63 |
MsaG015371 | MsaG043669 | 0.848365 | 1.215825e-59 | 6.232011e-57 |
MsaG015371 | MsaG043725 | 0.851124 | 2.078350e-60 | 1.170933e-57 |
MsaG015371 | MsaG043817 | 0.806629 | 1.271271e-49 | 2.002500e-47 |
MsaG015371 | MsaG044104 | 0.811056 | 1.451746e-50 | 2.543914e-48 |
MsaG015371 | MsaG044200 | 0.890703 | 1.708420e-73 | 5.223813e-70 |
MsaG015371 | MsaG044661 | 0.802316 | 9.982003e-49 | 1.422375e-46 |
MsaG015371 | MsaG044688 | 0.800343 | 2.519296e-48 | 3.432713e-46 |
MsaG015371 | MsaG045117 | 0.833896 | 7.441274e-56 | 2.411620e-53 |
MsaG015371 | MsaG045580 | 0.806842 | 1.146769e-49 | 1.815347e-47 |
MsaG015371 | MsaG045581 | 0.804013 | 4.465388e-49 | 6.616661e-47 |
MsaG015371 | MsaG045819 | 0.839405 | 2.980918e-57 | 1.142113e-54 |
MsaG015371 | MsaG045832 | 0.866162 | 6.993066e-65 | 6.921656e-62 |
MsaG015371 | MsaG046041 | 0.825927 | 6.381213e-54 | 1.646952e-51 |
MsaG015371 | MsaG046173 | 0.825954 | 6.287251e-54 | 1.623912e-51 |
MsaG015371 | MsaG046306 | 0.832066 | 2.112013e-55 | 6.488476e-53 |
MsaG015371 | MsaG046364 | 0.804718 | 3.188861e-49 | 4.802858e-47 |
MsaG015371 | MsaG046522 | 0.885678 | 1.426657e-71 | 3.377296e-68 |
MsaG015371 | MsaG046501 | 0.863788 | 3.855389e-64 | 3.470987e-61 |
MsaG015371 | MsaG046603 | 0.837587 | 8.734274e-57 | 3.163051e-54 |
MsaG015371 | MsaG046902 | 0.851329 | 1.820855e-60 | 1.033140e-57 |
MsaG015371 | MsaG046939 | 0.851738 | 1.396148e-60 | 8.035502e-58 |
MsaG015371 | MsaG046975 | 0.820032 | 1.488333e-52 | 3.276234e-50 |
MsaG015371 | MsaG047097 | 0.842296 | 5.244640e-58 | 2.201634e-55 |
MsaG015371 | MsaG002654 | 0.839000 | 3.792142e-57 | 1.434798e-54 |
MsaG015371 | MsaG000634 | 0.807466 | 8.474055e-50 | 1.361443e-47 |
MsaG015371 | MsaG001987 | 0.831518 | 2.877951e-55 | 8.701060e-53 |
MsaG015371 | MsaG005167 | 0.829110 | 1.108482e-54 | 3.127294e-52 |
MsaG015371 | MsaG011183 | 0.836932 | 1.282308e-56 | 4.551865e-54 |
MsaG015371 | MsaG006148 | 0.816007 | 1.197419e-51 | 2.374465e-49 |
MsaG015371 | MsaG013496 | 0.827653 | 2.481141e-54 | 6.719252e-52 |
MsaG015371 | MsaG019458 | 0.814767 | 2.252115e-51 | 4.328073e-49 |
MsaG015371 | MsaG018912 | 0.801759 | 1.297522e-48 | 1.825529e-46 |
MsaG015371 | MsaG022828 | 0.854006 | 3.160960e-61 | 1.971023e-58 |
MsaG015371 | MsaG019847 | 0.860033 | 5.378336e-63 | 4.186820e-60 |
MsaG015371 | MsaG017938 | 0.800116 | 2.801076e-48 | 3.797055e-46 |
MsaG015371 | MsaG029155 | 0.800795 | 2.040131e-48 | 2.808363e-46 |
MsaG015371 | MsaG029390 | 0.847918 | 1.612875e-59 | 8.145867e-57 |
MsaG015371 | MsaG028079 | 0.831438 | 3.011041e-55 | 9.082116e-53 |
MsaG015371 | MsaG033602 | 0.895989 | 1.280201e-75 | 5.205916e-72 |
MsaG015371 | MsaG031012 | 0.808183 | 5.973330e-50 | 9.763703e-48 |
MsaG015371 | MsaG031635 | 0.809635 | 2.931199e-50 | 4.961736e-48 |
MsaG015371 | MsaG034655 | 0.857142 | 3.883945e-62 | 2.712734e-59 |
MsaG015371 | MsaG033082 | 0.831785 | 2.475411e-55 | 7.543258e-53 |
MsaG015371 | MsaG032525 | 0.843854 | 2.025905e-58 | 8.940256e-56 |
MsaG015371 | MsaG031847 | 0.821758 | 5.990920e-53 | 1.380378e-50 |
MsaG015371 | MsaG038885 | 0.803667 | 5.264624e-49 | 7.738537e-47 |
MsaG015371 | MsaG036286 | 0.842045 | 6.107047e-58 | 2.543366e-55 |
MsaG015371 | MsaG037374 | 0.838654 | 4.654075e-57 | 1.741977e-54 |
MsaG015371 | MsaG036672 | 0.810647 | 1.778375e-50 | 3.085260e-48 |
MsaG015371 | MsaG035600 | 0.823387 | 2.515167e-53 | 6.055319e-51 |
MsaG015371 | MsaG036233 | 0.832240 | 1.913108e-55 | 5.906756e-53 |
MsaG015371 | MsaG037531 | 0.833770 | 8.000932e-56 | 2.583519e-53 |
MsaG015371 | MsaG036685 | 0.803740 | 5.084009e-49 | 7.485898e-47 |
MsaG015371 | MsaG037058 | 0.800772 | 2.062193e-48 | 2.837271e-46 |
MsaG015371 | MsaG036758 | 0.840904 | 1.215708e-57 | 4.882526e-55 |
MsaG015371 | MsaG037508 | 0.842847 | 3.749630e-58 | 1.602202e-55 |
MsaG015371 | MsaG043366 | 0.822344 | 4.387829e-53 | 1.027031e-50 |
MsaG015371 | MsaG041442 | 0.867446 | 2.741014e-65 | 2.857945e-62 |
MsaG015371 | MsaG044977 | 0.824050 | 1.761638e-53 | 4.318192e-51 |
MsaG015371 | MsaG044531 | 0.822202 | 4.731527e-53 | 1.103222e-50 |
MsaG015371 | MsaG046885 | 0.818435 | 3.424578e-52 | 7.228513e-50 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG015371 | MtrunA17_Chr3g0117261 | 93.542 | 480 | 31 | 0 | 15 | 494 | 16 | 495 | 0.0 | 939 |
MsaG015371 | MtrunA17_Chr7g0268031 | 28.165 | 316 | 148 | 14 | 7 | 303 | 197 | 452 | 1.17e-19 | 92.0 |
MsaG015371 | MtrunA17_Chr3g0132281 | 25.000 | 296 | 165 | 13 | 12 | 299 | 132 | 378 | 3.93e-15 | 78.6 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG015371 | AT5G63080.1 | 56.356 | 472 | 180 | 6 | 8 | 476 | 3 | 451 | 0.0 | 533 |
MsaG015371 | AT5G06550.1 | 25.000 | 324 | 157 | 13 | 14 | 319 | 194 | 449 | 3.24e-14 | 75.5 |
MsaG015371 | AT1G78280.1 | 23.411 | 299 | 166 | 10 | 12 | 299 | 125 | 371 | 5.34e-13 | 72.0 |
Find 89 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
TGTAACTTATGCAGACTATT+TGG | 0.218231 | 3:+86075419 | MsaT015371.1:intron |
GTATCATCAAGTTCATAATT+TGG | 0.246758 | 3:+86075492 | MsaT015371.1:CDS |
CACTTGTTCTGGCAGGATCT+TGG | 0.254470 | 3:+86074807 | MsaT015371.1:intron |
GTGCTGCTTTGCTATATATA+TGG | 0.271036 | 3:+86076352 | MsaT015371.1:CDS |
CTCAAAATCAGAGGACAAAT+TGG | 0.271585 | 3:-86076593 | None:intergenic |
TCAATGCCTATAACCTTTCT+TGG | 0.293305 | 3:+86075719 | MsaT015371.1:CDS |
ACTGATTGGGTTACACCTAA+TGG | 0.293546 | 3:+86073417 | MsaT015371.1:CDS |
AGTGGTGTTAACTGGATTAA+TGG | 0.294120 | 3:+86073374 | MsaT015371.1:CDS |
GTTATGTATGCTACATATTC+TGG | 0.294875 | 3:-86074540 | None:intergenic |
CATCAACAACATCAAAATAA+AGG | 0.300767 | 3:+86073275 | MsaT015371.1:CDS |
TTTGTTTATATGGGAGTTAA+AGG | 0.310574 | 3:+86074675 | MsaT015371.1:CDS |
AACAAACCAGTGGTGTTAAC+TGG | 0.321042 | 3:+86073366 | MsaT015371.1:CDS |
TGAATTTGTTGATAGATATA+TGG | 0.323277 | 3:+86073338 | MsaT015371.1:CDS |
CTTTAAATATTGCGTCTATT+AGG | 0.325382 | 3:+86076425 | MsaT015371.1:CDS |
ATAAATTTGATGAGGTCTTC+AGG | 0.341372 | 3:-86076685 | None:intergenic |
GATGTCTTCAATGTATTCCT+TGG | 0.357631 | 3:-86075879 | None:intergenic |
GTTCAGTGCAGTAATGAAAA+TGG | 0.363737 | 3:+86073875 | MsaT015371.1:CDS |
CTGGATTAATGGATCATCAT+TGG | 0.366707 | 3:+86073385 | MsaT015371.1:CDS |
GAGTGCTTCATTGGTTGATT+TGG | 0.369774 | 3:+86076615 | MsaT015371.1:CDS |
TACCACCCAAGAAAGGTTAT+AGG | 0.377980 | 3:-86075725 | None:intergenic |
ATTGGAGAGCTTCCACTGAT+TGG | 0.381303 | 3:+86073403 | MsaT015371.1:CDS |
CAATGCCTATAACCTTTCTT+GGG | 0.382210 | 3:+86075720 | MsaT015371.1:CDS |
TGACAGTGACCAGCAAAATA+AGG | 0.385417 | 3:+86074629 | MsaT015371.1:CDS |
AGACAATACCGTCGCAGAGC+TGG | 0.401710 | 3:+86076708 | MsaT015371.1:CDS |
AAACACGTGCGTGCTCTAGA+AGG | 0.404523 | 3:+86076466 | MsaT015371.1:CDS |
TTGGAGAGCTTCCACTGATT+GGG | 0.421960 | 3:+86073404 | MsaT015371.1:CDS |
ATCAACAACATCAAAATAAA+GGG | 0.427273 | 3:+86073276 | MsaT015371.1:CDS |
CTGCAGAACCCTCAACTTCA+AGG | 0.428740 | 3:-86073853 | None:intergenic |
TTTCATTTCATACTTTGCCT+TGG | 0.431384 | 3:+86076321 | MsaT015371.1:CDS |
CTGTACCGTATTTGAAGGAT+TGG | 0.436080 | 3:+86073921 | MsaT015371.1:CDS |
GAGAAATTGAGAAGGTGAAC+GGG | 0.436671 | 3:+86073298 | MsaT015371.1:CDS |
CAATATCTATAAACCACAAT+TGG | 0.441545 | 3:+86075695 | MsaT015371.1:CDS |
CAGCAAGGTTGCGCTGGCAG+AGG | 0.448536 | 3:-86075928 | None:intergenic |
TTGGTTGATTTGGTGGGACT+CGG | 0.453555 | 3:+86076625 | MsaT015371.1:CDS |
CATGCCTGTCAAACACGAAA+TGG | 0.455876 | 3:-86074922 | None:intergenic |
CTCAATTTACCACCCAAGAA+AGG | 0.458313 | 3:-86075732 | None:intergenic |
ATACTTTGCCTTGGCCAACT+TGG | 0.465254 | 3:+86076330 | MsaT015371.1:CDS |
TGTGTCTGTACCGTATTTGA+AGG | 0.465358 | 3:+86073916 | MsaT015371.1:CDS |
AGTGCCATTTCGTGTTTGAC+AGG | 0.469316 | 3:+86074918 | MsaT015371.1:CDS |
TGCTTCATTGGTTGATTTGG+TGG | 0.472657 | 3:+86076618 | MsaT015371.1:CDS |
TGAACGTTGCCTTGAAGTTG+AGG | 0.484615 | 3:+86073844 | MsaT015371.1:CDS |
GACAATACCGTCGCAGAGCT+GGG | 0.485971 | 3:+86076709 | MsaT015371.1:CDS |
TTCTAAATTCTGCATGCAGG+TGG | 0.497798 | 3:+86076540 | MsaT015371.1:CDS |
GCTTCATTGGTTGATTTGGT+GGG | 0.500949 | 3:+86076619 | MsaT015371.1:CDS |
AATGAAAATGGTTCAAGTAA+TGG | 0.504999 | 3:+86073887 | MsaT015371.1:CDS |
CGCAACCTTGCTGCCAACAC+AGG | 0.505053 | 3:+86075938 | MsaT015371.1:CDS |
AAATGCCAATCCTTCAAATA+CGG | 0.505177 | 3:-86073926 | None:intergenic |
TGTTGGCAGCAAGGTTGCGC+TGG | 0.509302 | 3:-86075934 | None:intergenic |
TGTCAAACACGAAATGGCAC+TGG | 0.510078 | 3:-86074916 | None:intergenic |
GAACGTTGCCTTGAAGTTGA+GGG | 0.513815 | 3:+86073845 | MsaT015371.1:CDS |
TTAGAATGCACACAAGAAGC+AGG | 0.515116 | 3:+86075442 | MsaT015371.1:CDS |
ATACAGATGACTCCATGTTA+AGG | 0.518181 | 3:-86076735 | None:intergenic |
TATAGGCATTGAACCAATTG+TGG | 0.520435 | 3:-86075708 | None:intergenic |
TCATATTTGTTCCCAGTGGA+TGG | 0.526700 | 3:+86075470 | MsaT015371.1:CDS |
ATTAATCCAGTTAACACCAC+TGG | 0.527498 | 3:-86073372 | None:intergenic |
AACTTGATGATACCATCCAC+TGG | 0.531578 | 3:-86075482 | None:intergenic |
GGAATACATTGAAGACATCA+AGG | 0.541622 | 3:+86075883 | MsaT015371.1:CDS |
AAATATTGCGTCTATTAGGA+AGG | 0.550115 | 3:+86076429 | MsaT015371.1:CDS |
AAGCAGCACCAAGTTGGCCA+AGG | 0.555336 | 3:-86076338 | None:intergenic |
TACTCTTGACAAACTTTCAG+TGG | 0.558191 | 3:-86076389 | None:intergenic |
GTCAAACACGAAATGGCACT+GGG | 0.569616 | 3:-86074915 | None:intergenic |
TGCCTATAACCTTTCTTGGG+TGG | 0.577403 | 3:+86075723 | MsaT015371.1:CDS |
ATGTCTGTGGAAAGAAGAGA+TGG | 0.577930 | 3:+86074876 | MsaT015371.1:CDS |
GGAGAAATTGAGAAGGTGAA+CGG | 0.580825 | 3:+86073297 | MsaT015371.1:CDS |
TCTAAATTCTGCATGCAGGT+GGG | 0.581693 | 3:+86076541 | MsaT015371.1:CDS |
AACACGTGCGTGCTCTAGAA+GGG | 0.582042 | 3:+86076467 | MsaT015371.1:CDS |
CTGCACCTGTGTTGGCAGCA+AGG | 0.594405 | 3:-86075943 | None:intergenic |
AACACGAAATGGCACTGGGA+AGG | 0.599724 | 3:-86074911 | None:intergenic |
GAGCGACTACAATGAGGCCA+AGG | 0.603057 | 3:+86075862 | MsaT015371.1:CDS |
TAGAATGCACACAAGAAGCA+GGG | 0.604713 | 3:+86075443 | MsaT015371.1:CDS |
AATTGAGAAGGTGAACGGGA+AGG | 0.605761 | 3:+86073302 | MsaT015371.1:CDS |
AAGGTCGCCCAGCTCTGCGA+CGG | 0.606124 | 3:-86076716 | None:intergenic |
ACACAGTACTGCACCTGTGT+TGG | 0.611154 | 3:-86075951 | None:intergenic |
AGAGCTGGGCGACCTTAACA+TGG | 0.618534 | 3:+86076723 | MsaT015371.1:CDS |
ATAGCAAAGCAGCACCAAGT+TGG | 0.619753 | 3:-86076344 | None:intergenic |
ATTAGGTGTAACCCAATCAG+TGG | 0.622628 | 3:-86073415 | None:intergenic |
AGCTGGTCAGCAAATGTCTG+TGG | 0.623034 | 3:+86074863 | MsaT015371.1:CDS |
TATTGTCTATAAATTTGATG+AGG | 0.630189 | 3:-86076693 | None:intergenic |
ATGCAGAATTTAGAAAACCT+AGG | 0.631755 | 3:-86076532 | None:intergenic |
CTGAAAACATCAGCATGTAG+AGG | 0.641625 | 3:-86074833 | None:intergenic |
TGAAGCACTCTCAAAATCAG+AGG | 0.642152 | 3:-86076602 | None:intergenic |
GTATCTGACTCAAAATACCC+TGG | 0.643979 | 3:+86075311 | MsaT015371.1:CDS |
AATAAAGGGAGAAATTGAGA+AGG | 0.646492 | 3:+86073290 | MsaT015371.1:CDS |
ACTTGATGATACCATCCACT+GGG | 0.651707 | 3:-86075481 | None:intergenic |
AGAATGCACACAAGAAGCAG+GGG | 0.665619 | 3:+86075444 | MsaT015371.1:CDS |
GAAATCATATTTGTTCCCAG+TGG | 0.671903 | 3:+86075466 | MsaT015371.1:CDS |
CAATCATCACAAAAGTACGT+TGG | 0.708793 | 3:-86074564 | None:intergenic |
TATGGACAAGAACAAACCAG+TGG | 0.727874 | 3:+86073356 | MsaT015371.1:CDS |
AGGGACTCATGATTGCATCG+TGG | 0.769193 | 3:+86076486 | MsaT015371.1:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr3 | gene | 86073264 | 86076771 | 86073264 | ID=MsaG015371 |
Chr3 | mRNA | 86073264 | 86076771 | 86073264 | ID=MsaT015371.1;Parent=MsaG015371 |
Chr3 | exon | 86073264 | 86073491 | 86073264 | ID=MsaT015371.1.exon1;Parent=MsaT015371.1 |
Chr3 | CDS | 86073264 | 86073491 | 86073264 | ID=cds.MsaT015371.1;Parent=MsaT015371.1 |
Chr3 | exon | 86073776 | 86073955 | 86073776 | ID=MsaT015371.1.exon2;Parent=MsaT015371.1 |
Chr3 | CDS | 86073776 | 86073955 | 86073776 | ID=cds.MsaT015371.1;Parent=MsaT015371.1 |
Chr3 | exon | 86074534 | 86074696 | 86074534 | ID=MsaT015371.1.exon3;Parent=MsaT015371.1 |
Chr3 | CDS | 86074534 | 86074696 | 86074534 | ID=cds.MsaT015371.1;Parent=MsaT015371.1 |
Chr3 | exon | 86074822 | 86074939 | 86074822 | ID=MsaT015371.1.exon4;Parent=MsaT015371.1 |
Chr3 | CDS | 86074822 | 86074939 | 86074822 | ID=cds.MsaT015371.1;Parent=MsaT015371.1 |
Chr3 | exon | 86075274 | 86075343 | 86075274 | ID=MsaT015371.1.exon5;Parent=MsaT015371.1 |
Chr3 | CDS | 86075274 | 86075343 | 86075274 | ID=cds.MsaT015371.1;Parent=MsaT015371.1 |
Chr3 | exon | 86075433 | 86075513 | 86075433 | ID=MsaT015371.1.exon6;Parent=MsaT015371.1 |
Chr3 | CDS | 86075433 | 86075513 | 86075433 | ID=cds.MsaT015371.1;Parent=MsaT015371.1 |
Chr3 | exon | 86075688 | 86075744 | 86075688 | ID=MsaT015371.1.exon7;Parent=MsaT015371.1 |
Chr3 | CDS | 86075688 | 86075744 | 86075688 | ID=cds.MsaT015371.1;Parent=MsaT015371.1 |
Chr3 | exon | 86075848 | 86075959 | 86075848 | ID=MsaT015371.1.exon8;Parent=MsaT015371.1 |
Chr3 | CDS | 86075848 | 86075959 | 86075848 | ID=cds.MsaT015371.1;Parent=MsaT015371.1 |
Chr3 | exon | 86076296 | 86076771 | 86076296 | ID=MsaT015371.1.exon9;Parent=MsaT015371.1 |
Chr3 | CDS | 86076296 | 86076771 | 86076296 | ID=cds.MsaT015371.1;Parent=MsaT015371.1 |
Gene Sequence |
Protein sequence |