Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG017078 | AES73439.1 | 85.323 | 511 | 43 | 7 | 1 | 492 | 1 | 498 | 0.0 | 856 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG017078 | tr|G7J8D2|G7J8D2_MEDTR | 85.323 | 511 | 43 | 7 | 1 | 492 | 1 | 498 | 0.0 | 856 |
Gene ID | Type | Classification |
---|---|---|
MsaG017078 | TF | RWP-RK |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000070 | MsaG017078 | 0.841589 | 8.045737e-58 | 3.302277e-55 |
MsaG000262 | MsaG017078 | 0.815400 | 1.632301e-51 | 3.187476e-49 |
MsaG000314 | MsaG017078 | 0.801493 | 1.470330e-48 | 2.056153e-46 |
MsaG000366 | MsaG017078 | 0.817959 | 4.384407e-52 | 9.141496e-50 |
MsaG000425 | MsaG017078 | 0.812889 | 5.814182e-51 | 1.065938e-48 |
MsaG000690 | MsaG017078 | 0.811458 | 1.189079e-50 | 2.104233e-48 |
MsaG000686 | MsaG017078 | 0.814584 | 2.472076e-51 | 4.728644e-49 |
MsaG000720 | MsaG017078 | 0.838743 | 4.415715e-57 | 1.657355e-54 |
MsaG000856 | MsaG017078 | 0.808017 | 6.477127e-50 | 1.054518e-47 |
MsaG000940 | MsaG017078 | 0.813152 | 5.095111e-51 | 9.402540e-49 |
MsaG001046 | MsaG017078 | 0.802382 | 9.673909e-49 | 1.380562e-46 |
MsaG001056 | MsaG017078 | 0.809812 | 2.686433e-50 | 4.566953e-48 |
MsaG001057 | MsaG017078 | 0.823843 | 1.969483e-53 | 4.800403e-51 |
MsaG001809 | MsaG017078 | 0.846666 | 3.545511e-59 | 1.716777e-56 |
MsaG002170 | MsaG017078 | 0.816179 | 1.096184e-51 | 2.183330e-49 |
MsaG002201 | MsaG017078 | 0.828704 | 1.388513e-54 | 3.872710e-52 |
MsaG002373 | MsaG017078 | 0.852284 | 9.785431e-61 | 5.741445e-58 |
MsaG002814 | MsaG017078 | 0.801527 | 1.447570e-48 | 2.025867e-46 |
MsaG003141 | MsaG017078 | 0.851027 | 2.212962e-60 | 1.242583e-57 |
MsaG003310 | MsaG017078 | 0.827077 | 3.405028e-54 | 9.073276e-52 |
MsaG003351 | MsaG017078 | 0.870894 | 2.107153e-66 | 2.536074e-63 |
MsaG003708 | MsaG017078 | 0.822435 | 4.181048e-53 | 9.809885e-51 |
MsaG003789 | MsaG017078 | 0.804189 | 4.105435e-49 | 6.108153e-47 |
MsaG003808 | MsaG017078 | 0.814357 | 2.772273e-51 | 5.273146e-49 |
MsaG003974 | MsaG017078 | 0.838878 | 4.075192e-57 | 1.536054e-54 |
MsaG004114 | MsaG017078 | 0.814161 | 3.062576e-51 | 5.796409e-49 |
MsaG004157 | MsaG017078 | 0.804575 | 3.414698e-49 | 5.125984e-47 |
MsaG004307 | MsaG017078 | 0.823531 | 2.328042e-53 | 5.626562e-51 |
MsaG004344 | MsaG017078 | 0.849057 | 7.830977e-60 | 4.110043e-57 |
MsaG004881 | MsaG017078 | 0.801510 | 1.458906e-48 | 2.040958e-46 |
MsaG005045 | MsaG017078 | 0.814645 | 2.396359e-51 | 4.590940e-49 |
MsaG005310 | MsaG017078 | 0.852178 | 1.048576e-60 | 6.129263e-58 |
MsaG005325 | MsaG017078 | 0.846386 | 4.223511e-59 | 2.026112e-56 |
MsaG005368 | MsaG017078 | 0.813261 | 4.821179e-51 | 8.921433e-49 |
MsaG005460 | MsaG017078 | 0.823026 | 3.051089e-53 | 7.273979e-51 |
MsaG005439 | MsaG017078 | 0.813861 | 3.564412e-51 | 6.695849e-49 |
MsaG005616 | MsaG017078 | 0.801331 | 1.586499e-48 | 2.210546e-46 |
MsaG005617 | MsaG017078 | 0.801912 | 1.207391e-48 | 1.704654e-46 |
MsaG006035 | MsaG017078 | 0.815570 | 1.496816e-51 | 2.935471e-49 |
MsaG005921 | MsaG017078 | 0.816257 | 1.053287e-51 | 2.102061e-49 |
MsaG005922 | MsaG017078 | 0.848898 | 8.668889e-60 | 4.525045e-57 |
MsaG006120 | MsaG017078 | 0.818449 | 3.399678e-52 | 7.178630e-50 |
MsaG006178 | MsaG017078 | 0.805743 | 1.949184e-49 | 3.006660e-47 |
MsaG006239 | MsaG017078 | 0.822426 | 4.200690e-53 | 9.853680e-51 |
MsaG006307 | MsaG017078 | 0.837342 | 1.008817e-56 | 3.625910e-54 |
MsaG006513 | MsaG017078 | 0.801501 | 1.465046e-48 | 2.049132e-46 |
MsaG006560 | MsaG017078 | 0.858420 | 1.630108e-62 | 1.194048e-59 |
MsaG006901 | MsaG017078 | 0.824108 | 1.707812e-53 | 4.192727e-51 |
MsaG006942 | MsaG017078 | 0.816886 | 7.628041e-52 | 1.547082e-49 |
MsaG007146 | MsaG017078 | 0.802517 | 9.080147e-49 | 1.299809e-46 |
MsaG007368 | MsaG017078 | 0.804908 | 2.910707e-49 | 4.403463e-47 |
MsaG007357 | MsaG017078 | 0.823383 | 2.520424e-53 | 6.067300e-51 |
MsaG007434 | MsaG017078 | 0.807787 | 7.247434e-50 | 1.173414e-47 |
MsaG007541 | MsaG017078 | 0.829673 | 8.103546e-55 | 2.323339e-52 |
MsaG007648 | MsaG017078 | 0.812167 | 8.345696e-51 | 1.502799e-48 |
MsaG007919 | MsaG017078 | 0.827906 | 2.158081e-54 | 5.886066e-52 |
MsaG008058 | MsaG017078 | 0.826634 | 4.339408e-54 | 1.142128e-51 |
MsaG008081 | MsaG017078 | 0.834761 | 4.525701e-56 | 1.505226e-53 |
MsaG008106 | MsaG017078 | 0.824950 | 1.084137e-53 | 2.723423e-51 |
MsaG008225 | MsaG017078 | 0.840106 | 1.961960e-57 | 7.684465e-55 |
MsaG008193 | MsaG017078 | 0.814145 | 3.086393e-51 | 5.839281e-49 |
MsaG008316 | MsaG017078 | 0.818628 | 3.097977e-52 | 6.572154e-50 |
MsaG008337 | MsaG017078 | 0.819488 | 1.978973e-52 | 4.293949e-50 |
MsaG008630 | MsaG017078 | 0.829397 | 9.452705e-55 | 2.688722e-52 |
MsaG009005 | MsaG017078 | 0.831843 | 2.395162e-55 | 7.310948e-53 |
MsaG009073 | MsaG017078 | 0.817466 | 5.657491e-52 | 1.164687e-49 |
MsaG009094 | MsaG017078 | 0.820974 | 9.067604e-53 | 2.046435e-50 |
MsaG009230 | MsaG017078 | 0.807206 | 9.611769e-50 | 1.534689e-47 |
MsaG009254 | MsaG017078 | 0.808454 | 5.232619e-50 | 8.608828e-48 |
MsaG009281 | MsaG017078 | 0.832658 | 1.508696e-55 | 4.715039e-53 |
MsaG010098 | MsaG017078 | 0.807809 | 7.169070e-50 | 1.161341e-47 |
MsaG010126 | MsaG017078 | 0.815272 | 1.742084e-51 | 3.390894e-49 |
MsaG010386 | MsaG017078 | 0.822234 | 4.651868e-53 | 1.085577e-50 |
MsaG010429 | MsaG017078 | 0.861715 | 1.667944e-63 | 1.384398e-60 |
MsaG010498 | MsaG017078 | 0.826621 | 4.369822e-54 | 1.149731e-51 |
MsaG010452 | MsaG017078 | 0.827123 | 3.320095e-54 | 8.858545e-52 |
MsaG011186 | MsaG017078 | 0.805975 | 1.743769e-49 | 2.704426e-47 |
MsaG011257 | MsaG017078 | 0.807250 | 9.411212e-50 | 1.504200e-47 |
MsaG011658 | MsaG017078 | 0.819133 | 2.381224e-52 | 5.119103e-50 |
MsaG011997 | MsaG017078 | 0.821412 | 7.196320e-53 | 1.642938e-50 |
MsaG012141 | MsaG017078 | 0.827418 | 2.823004e-54 | 7.594767e-52 |
MsaG012331 | MsaG017078 | 0.834002 | 7.002247e-56 | 2.276462e-53 |
MsaG012348 | MsaG017078 | 0.813608 | 4.049677e-51 | 7.559226e-49 |
MsaG012378 | MsaG017078 | 0.813711 | 3.843737e-51 | 7.193357e-49 |
MsaG012447 | MsaG017078 | 0.851095 | 2.118305e-60 | 1.192219e-57 |
MsaG012454 | MsaG017078 | 0.802161 | 1.073694e-48 | 1.524475e-46 |
MsaG012572 | MsaG017078 | 0.819586 | 1.879770e-52 | 4.089076e-50 |
MsaG012610 | MsaG017078 | 0.807257 | 9.379001e-50 | 1.499319e-47 |
MsaG013238 | MsaG017078 | 0.825694 | 7.241629e-54 | 1.856899e-51 |
MsaG014048 | MsaG017078 | 0.814309 | 2.841273e-51 | 5.397675e-49 |
MsaG015328 | MsaG017078 | 0.812488 | 7.108585e-51 | 1.290340e-48 |
MsaG016516 | MsaG017078 | 0.801000 | 1.852892e-48 | 2.562370e-46 |
MsaG016521 | MsaG017078 | 0.819005 | 2.546176e-52 | 5.455075e-50 |
MsaG017078 | MsaG017250 | 0.867270 | 3.118272e-65 | 3.228321e-62 |
MsaG017078 | MsaG017256 | 0.844080 | 1.763204e-58 | 7.838689e-56 |
MsaG017078 | MsaG017407 | 0.816502 | 9.288045e-52 | 1.865277e-49 |
MsaG017078 | MsaG017566 | 0.818575 | 3.184391e-52 | 6.746093e-50 |
MsaG017078 | MsaG017676 | 0.801740 | 1.309456e-48 | 1.841506e-46 |
MsaG017078 | MsaG017723 | 0.820856 | 9.650490e-53 | 2.171000e-50 |
MsaG017078 | MsaG017741 | 0.813754 | 3.760408e-51 | 7.045176e-49 |
MsaG017078 | MsaG017784 | 0.885195 | 2.158782e-71 | 4.993076e-68 |
MsaG017078 | MsaG017887 | 0.810746 | 1.693034e-50 | 2.944259e-48 |
MsaG017078 | MsaG018059 | 0.810699 | 1.733336e-50 | 3.010819e-48 |
MsaG017078 | MsaG018159 | 0.807565 | 8.073220e-50 | 1.300121e-47 |
MsaG017078 | MsaG018493 | 0.808075 | 6.298012e-50 | 1.026763e-47 |
MsaG017078 | MsaG018809 | 0.804907 | 2.912923e-49 | 4.406639e-47 |
MsaG017078 | MsaG018928 | 0.826168 | 5.597362e-54 | 1.454290e-51 |
MsaG017078 | MsaG018970 | 0.822401 | 4.257360e-53 | 9.979959e-51 |
MsaG017078 | MsaG019020 | 0.851386 | 1.754301e-60 | 9.973181e-58 |
MsaG017078 | MsaG019130 | 0.823200 | 2.779319e-53 | 6.657309e-51 |
MsaG017078 | MsaG019301 | 0.828306 | 1.730688e-54 | 4.773516e-52 |
MsaG017078 | MsaG019325 | 0.823388 | 2.513536e-53 | 6.051550e-51 |
MsaG017078 | MsaG019355 | 0.847634 | 1.930287e-59 | 9.655051e-57 |
MsaG017078 | MsaG019426 | 0.801920 | 1.203042e-48 | 1.698804e-46 |
MsaG017078 | MsaG019737 | 0.845839 | 5.939588e-59 | 2.798024e-56 |
MsaG017078 | MsaG019738 | 0.840273 | 1.775038e-57 | 6.989094e-55 |
MsaG017078 | MsaG020220 | 0.855298 | 1.340903e-61 | 8.756743e-59 |
MsaG017078 | MsaG020345 | 0.800248 | 2.633676e-48 | 3.580769e-46 |
MsaG017078 | MsaG020657 | 0.802201 | 1.053831e-48 | 1.497628e-46 |
MsaG017078 | MsaG020758 | 0.813197 | 4.978956e-51 | 9.198791e-49 |
MsaG017078 | MsaG020775 | 0.813715 | 3.836312e-51 | 7.180155e-49 |
MsaG017078 | MsaG020784 | 0.849659 | 5.333448e-60 | 2.857380e-57 |
MsaG017078 | MsaG020892 | 0.811468 | 1.183045e-50 | 2.094092e-48 |
MsaG017078 | MsaG020906 | 0.806003 | 1.720308e-49 | 2.669750e-47 |
MsaG017078 | MsaG020907 | 0.834202 | 6.241980e-56 | 2.041521e-53 |
MsaG017078 | MsaG020934 | 0.801289 | 1.618174e-48 | 2.252480e-46 |
MsaG017078 | MsaG020982 | 0.846200 | 4.743140e-59 | 2.261442e-56 |
MsaG017078 | MsaG021108 | 0.814967 | 2.034900e-51 | 3.930390e-49 |
MsaG017078 | MsaG021323 | 0.801031 | 1.826770e-48 | 2.528002e-46 |
MsaG017078 | MsaG021782 | 0.806043 | 1.687512e-49 | 2.621446e-47 |
MsaG017078 | MsaG022392 | 0.802040 | 1.136894e-48 | 1.609753e-46 |
MsaG017078 | MsaG022426 | 0.832703 | 1.470816e-55 | 4.602810e-53 |
MsaG017078 | MsaG022780 | 0.822635 | 3.757374e-53 | 8.863738e-51 |
MsaG017078 | MsaG023153 | 0.805531 | 2.158497e-49 | 3.312974e-47 |
MsaG017078 | MsaG023259 | 0.831960 | 2.242834e-55 | 6.869015e-53 |
MsaG017078 | MsaG023575 | 0.801639 | 1.373088e-48 | 1.926563e-46 |
MsaG017078 | MsaG023667 | 0.850316 | 3.500552e-60 | 1.917598e-57 |
MsaG017078 | MsaG023703 | 0.805429 | 2.267153e-49 | 3.471504e-47 |
MsaG017078 | MsaG023967 | 0.809194 | 3.641643e-50 | 6.098849e-48 |
MsaG017078 | MsaG024001 | 0.809902 | 2.570559e-50 | 4.379381e-48 |
MsaG017078 | MsaG024666 | 0.851377 | 1.764493e-60 | 1.002784e-57 |
MsaG017078 | MsaG024918 | 0.809963 | 2.493651e-50 | 4.254625e-48 |
MsaG017078 | MsaG025325 | 0.840103 | 1.964960e-57 | 7.695521e-55 |
MsaG017078 | MsaG025416 | 0.803379 | 6.035895e-49 | 8.813392e-47 |
MsaG017078 | MsaG025861 | 0.801896 | 1.216868e-48 | 1.717405e-46 |
MsaG017078 | MsaG026479 | 0.822469 | 4.104966e-53 | 9.640429e-51 |
MsaG017078 | MsaG027022 | 0.871783 | 1.074471e-66 | 1.343146e-63 |
MsaG017078 | MsaG027085 | 0.862492 | 9.658571e-64 | 8.263346e-61 |
MsaG017078 | MsaG027160 | 0.842190 | 5.593888e-58 | 2.340261e-55 |
MsaG017078 | MsaG027359 | 0.804640 | 3.309732e-49 | 4.975918e-47 |
MsaG017078 | MsaG027414 | 0.828431 | 1.614945e-54 | 4.470240e-52 |
MsaG017078 | MsaG027462 | 0.832145 | 2.019335e-55 | 6.218054e-53 |
MsaG017078 | MsaG027652 | 0.813091 | 5.251259e-51 | 9.676269e-49 |
MsaG017078 | MsaG027745 | 0.813245 | 4.861634e-51 | 8.992557e-49 |
MsaG017078 | MsaG028043 | 0.801930 | 1.197268e-48 | 1.691032e-46 |
MsaG017078 | MsaG028204 | 0.840452 | 1.594712e-57 | 6.314310e-55 |
MsaG017078 | MsaG028760 | 0.808045 | 6.388939e-50 | 1.040860e-47 |
MsaG017078 | MsaG029161 | 0.805429 | 2.267153e-49 | 3.471504e-47 |
MsaG017078 | MsaG029193 | 0.810985 | 1.504001e-50 | 2.630840e-48 |
MsaG017078 | MsaG029308 | 0.811223 | 1.336157e-50 | 2.350969e-48 |
MsaG017078 | MsaG029309 | 0.815514 | 1.540361e-51 | 3.016521e-49 |
MsaG017078 | MsaG029396 | 0.811860 | 9.730028e-51 | 1.738953e-48 |
MsaG017078 | MsaG029342 | 0.804990 | 2.798431e-49 | 4.241675e-47 |
MsaG017078 | MsaG029734 | 0.816994 | 7.213998e-52 | 1.467223e-49 |
MsaG017078 | MsaG029846 | 0.805647 | 2.042086e-49 | 3.142874e-47 |
MsaG017078 | MsaG029939 | 0.850040 | 4.176833e-60 | 2.266776e-57 |
MsaG017078 | MsaG029941 | 0.841503 | 8.474808e-58 | 3.468894e-55 |
MsaG017078 | MsaG029922 | 0.825004 | 1.053189e-53 | 2.649562e-51 |
MsaG017078 | MsaG030222 | 0.804975 | 2.819535e-49 | 4.272090e-47 |
MsaG017078 | MsaG031057 | 0.810380 | 2.029865e-50 | 3.498762e-48 |
MsaG017078 | MsaG031063 | 0.803021 | 7.151816e-49 | 1.035680e-46 |
MsaG017078 | MsaG031667 | 0.812193 | 8.239432e-51 | 1.484638e-48 |
MsaG017078 | MsaG031786 | 0.800317 | 2.550223e-48 | 3.472775e-46 |
MsaG017078 | MsaG031787 | 0.814622 | 2.423960e-51 | 4.641195e-49 |
MsaG017078 | MsaG031819 | 0.824999 | 1.056037e-53 | 2.656344e-51 |
MsaG017078 | MsaG032026 | 0.859010 | 1.088305e-62 | 8.149157e-60 |
MsaG017078 | MsaG032178 | 0.805172 | 2.565326e-49 | 3.904833e-47 |
MsaG017078 | MsaG032638 | 0.805864 | 1.839687e-49 | 2.845761e-47 |
MsaG017078 | MsaG033021 | 0.808986 | 4.033520e-50 | 6.721680e-48 |
MsaG017078 | MsaG033805 | 0.819504 | 1.961869e-52 | 4.258621e-50 |
MsaG017078 | MsaG033823 | 0.802043 | 1.135526e-48 | 1.607917e-46 |
MsaG017078 | MsaG033967 | 0.823976 | 1.833028e-53 | 4.484040e-51 |
MsaG017078 | MsaG033977 | 0.803266 | 6.366679e-49 | 9.272169e-47 |
MsaG017078 | MsaG034149 | 0.824096 | 1.719106e-53 | 4.219036e-51 |
MsaG017078 | MsaG034173 | 0.839402 | 2.985624e-57 | 1.143814e-54 |
MsaG017078 | MsaG034177 | 0.822066 | 5.087977e-53 | 1.181997e-50 |
MsaG017078 | MsaG034439 | 0.804044 | 4.397943e-49 | 6.521723e-47 |
MsaG017078 | MsaG034709 | 0.805910 | 1.799381e-49 | 2.786418e-47 |
MsaG017078 | MsaG034713 | 0.824231 | 1.598274e-53 | 3.936879e-51 |
MsaG017078 | MsaG034957 | 0.805731 | 1.961205e-49 | 3.024302e-47 |
MsaG017078 | MsaG035662 | 0.807177 | 9.748230e-50 | 1.555451e-47 |
MsaG017078 | MsaG035699 | 0.819355 | 2.120689e-52 | 4.585654e-50 |
MsaG017078 | MsaG036108 | 0.828741 | 1.360190e-54 | 3.797635e-52 |
MsaG017078 | MsaG036714 | 0.817438 | 5.738019e-52 | 1.180463e-49 |
MsaG017078 | MsaG036844 | 0.828861 | 1.273227e-54 | 3.566806e-52 |
MsaG017078 | MsaG038498 | 0.807754 | 7.363468e-50 | 1.191240e-47 |
MsaG017078 | MsaG039424 | 0.823106 | 2.922267e-53 | 6.981939e-51 |
MsaG017078 | MsaG039607 | 0.838052 | 6.643263e-57 | 2.440343e-54 |
MsaG017078 | MsaG039771 | 0.816929 | 7.459489e-52 | 1.514625e-49 |
MsaG017078 | MsaG039871 | 0.813644 | 3.975102e-51 | 7.426837e-49 |
MsaG017078 | MsaG039961 | 0.811742 | 1.031748e-50 | 1.838596e-48 |
MsaG017078 | MsaG040365 | 0.800082 | 2.845640e-48 | 3.854558e-46 |
MsaG017078 | MsaG040680 | 0.828896 | 1.248212e-54 | 3.500351e-52 |
MsaG017078 | MsaG040767 | 0.827821 | 2.262313e-54 | 6.155632e-52 |
MsaG017078 | MsaG041055 | 0.814490 | 2.591781e-51 | 4.946118e-49 |
MsaG017078 | MsaG041320 | 0.815492 | 1.557210e-51 | 3.047882e-49 |
MsaG017078 | MsaG041354 | 0.818785 | 2.854845e-52 | 6.081171e-50 |
MsaG017078 | MsaG041973 | 0.823017 | 3.064462e-53 | 7.304223e-51 |
MsaG017078 | MsaG042101 | 0.824751 | 1.207450e-53 | 3.016662e-51 |
MsaG017078 | MsaG042118 | 0.811615 | 1.099175e-50 | 1.952662e-48 |
MsaG017078 | MsaG042123 | 0.848090 | 1.446506e-59 | 7.347832e-57 |
MsaG017078 | MsaG043390 | 0.804067 | 4.350007e-49 | 6.454035e-47 |
MsaG017078 | MsaG044052 | 0.817675 | 5.077222e-52 | 1.050854e-49 |
MsaG017078 | MsaG044119 | 0.805786 | 1.910029e-49 | 2.949190e-47 |
MsaG017078 | MsaG044316 | 0.801842 | 1.247953e-48 | 1.759115e-46 |
MsaG017078 | MsaG044904 | 0.801989 | 1.164591e-48 | 1.647056e-46 |
MsaG017078 | MsaG045212 | 0.820867 | 9.592176e-53 | 2.158577e-50 |
MsaG017078 | MsaG045311 | 0.832870 | 1.337198e-55 | 4.205097e-53 |
MsaG017078 | MsaG045438 | 0.838533 | 5.000087e-57 | 1.864459e-54 |
MsaG017078 | MsaG045558 | 0.810301 | 2.109998e-50 | 3.629832e-48 |
MsaG017078 | MsaG045662 | 0.805871 | 1.833309e-49 | 2.836404e-47 |
MsaG017078 | MsaG045758 | 0.800870 | 1.969441e-48 | 2.715573e-46 |
MsaG017078 | MsaG045695 | 0.810630 | 1.793599e-50 | 3.110320e-48 |
MsaG017078 | MsaG045871 | 0.806566 | 1.310946e-49 | 2.061878e-47 |
MsaG017078 | MsaG046006 | 0.805432 | 2.264372e-49 | 3.467451e-47 |
MsaG017078 | MsaG046214 | 0.806838 | 1.148900e-49 | 1.818555e-47 |
MsaG017078 | MsaG046264 | 0.810395 | 2.014906e-50 | 3.474250e-48 |
MsaG017078 | MsaG046299 | 0.803480 | 5.753439e-49 | 8.420468e-47 |
MsaG017078 | MsaG046403 | 0.843342 | 2.772775e-58 | 1.203790e-55 |
MsaG017078 | MsaG046360 | 0.824106 | 1.709680e-53 | 4.197053e-51 |
MsaG017078 | MsaG046601 | 0.871234 | 1.629910e-66 | 1.990062e-63 |
MsaG017078 | MsaG046638 | 0.866422 | 5.791937e-65 | 5.792835e-62 |
MsaG017078 | MsaG047088 | 0.847191 | 2.550630e-59 | 1.257028e-56 |
MsaG017078 | MsaG002643 | 0.821381 | 7.313969e-53 | 1.668463e-50 |
MsaG017078 | MsaG004516 | 0.819958 | 1.547290e-52 | 3.399307e-50 |
MsaG017078 | MsaG002445 | 0.844038 | 1.809486e-58 | 8.032951e-56 |
MsaG017078 | MsaG006591 | 0.880534 | 1.072581e-69 | 1.985080e-66 |
MsaG017078 | MsaG008180 | 0.809451 | 3.209870e-50 | 5.409514e-48 |
MsaG017078 | MsaG013001 | 0.850336 | 3.455840e-60 | 1.894508e-57 |
MsaG017078 | MsaG011705 | 0.813175 | 5.036532e-51 | 9.299862e-49 |
MsaG017078 | MsaG012253 | 0.802961 | 7.358144e-49 | 1.064076e-46 |
MsaG017078 | MsaG016720 | 0.821269 | 7.761839e-53 | 1.765422e-50 |
MsaG017078 | MsaG016849 | 0.841478 | 8.604251e-58 | 3.519077e-55 |
MsaG017078 | MsaG023305 | 0.847599 | 1.972532e-59 | 9.855245e-57 |
MsaG017078 | MsaG020007 | 0.802628 | 8.614397e-49 | 1.236295e-46 |
MsaG017078 | MsaG023050 | 0.828369 | 1.671827e-54 | 4.619601e-52 |
MsaG017078 | MsaG019642 | 0.807428 | 8.628044e-50 | 1.384967e-47 |
MsaG017078 | MsaG021171 | 0.825586 | 7.679535e-54 | 1.963181e-51 |
MsaG017078 | MsaG028385 | 0.822411 | 4.235178e-53 | 9.930647e-51 |
MsaG017078 | MsaG025579 | 0.813226 | 4.908692e-51 | 9.075603e-49 |
MsaG017078 | MsaG029639 | 0.812783 | 6.129672e-51 | 1.120827e-48 |
MsaG017078 | MsaG033085 | 0.812573 | 6.812601e-51 | 1.239226e-48 |
MsaG017078 | MsaG032081 | 0.825336 | 8.797208e-54 | 2.233484e-51 |
MsaG017078 | MsaG031702 | 0.813272 | 4.796449e-51 | 8.877877e-49 |
MsaG017078 | MsaG031806 | 0.822624 | 3.780471e-53 | 8.915472e-51 |
MsaG017078 | MsaG031279 | 0.807891 | 6.889086e-50 | 1.118201e-47 |
MsaG017078 | MsaG035246 | 0.805491 | 2.201328e-49 | 3.375511e-47 |
MsaG017078 | MsaG037392 | 0.814014 | 3.298764e-51 | 6.220480e-49 |
MsaG017078 | MsaG036708 | 0.807601 | 7.933948e-50 | 1.278783e-47 |
MsaG017078 | MsaG039794 | 0.811300 | 1.285770e-50 | 2.266598e-48 |
MsaG017078 | MsaG037217 | 0.802687 | 8.379490e-49 | 1.204162e-46 |
MsaG017078 | MsaG042498 | 0.820862 | 9.620782e-53 | 2.164681e-50 |
MsaG017078 | MsaG043242 | 0.803800 | 4.939874e-49 | 7.283659e-47 |
MsaG017078 | MsaG046894 | 0.835350 | 3.220413e-56 | 1.090068e-53 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG017078 | MtrunA17_Chr3g0136081 | 81.579 | 532 | 45 | 7 | 1 | 492 | 1 | 519 | 0.0 | 843 |
MsaG017078 | MtrunA17_Chr3g0105711 | 51.434 | 558 | 180 | 15 | 2 | 491 | 7 | 541 | 4.09e-159 | 462 |
MsaG017078 | MtrunA17_Chr5g0406901 | 50.725 | 69 | 32 | 1 | 387 | 455 | 199 | 265 | 2.69e-12 | 67.8 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG017078 | AT5G16100.2 | 32.721 | 272 | 128 | 11 | 252 | 476 | 177 | 440 | 3.29e-33 | 131 |
Find 104 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
TACCTTTCTGTGGGGCCATC+TGG | 0.198703 | 3:+105501204 | None:intergenic |
GGCAATACATTGGAATTAAA+TGG | 0.208227 | 3:+105502657 | None:intergenic |
TTCCAACTCCATGAAGATTT+TGG | 0.209996 | 3:+105502778 | None:intergenic |
AATCTTATTCAAAATAATTC+AGG | 0.275363 | 3:-105501684 | MsaT017078.1:intron |
ACCACAATGTTTAATCATTT+CGG | 0.280881 | 3:+105500990 | None:intergenic |
CACCATCAGATACCTGTTAA+TGG | 0.281140 | 3:-105502006 | MsaT017078.1:CDS |
TTTGAAAAGCTTGAGATTCA+TGG | 0.294484 | 3:-105502057 | MsaT017078.1:CDS |
TTGGATTGATGATATTAATA+TGG | 0.313839 | 3:-105501709 | MsaT017078.1:CDS |
CTTGGTGGTAGTAATAATAA+TGG | 0.330532 | 3:-105502687 | MsaT017078.1:CDS |
ACCATCAGATACCTGTTAAT+GGG | 0.352749 | 3:-105502005 | MsaT017078.1:CDS |
ACTGATGGGGCCCCATTAAC+AGG | 0.356308 | 3:+105501994 | None:intergenic |
GGGGTCCATGCCGAGTTTGT+TGG | 0.357115 | 3:+105502802 | None:intergenic |
TGATCTGCTGCTTCATCAAT+AGG | 0.368145 | 3:+105501286 | None:intergenic |
TACTATGGACTTGGAATACT+TGG | 0.370161 | 3:-105502705 | MsaT017078.1:CDS |
CAAGAGCAAATGGGTGATAA+TGG | 0.372132 | 3:-105501500 | MsaT017078.1:CDS |
CCATCCCAAGAAAATTACTA+TGG | 0.379676 | 3:-105502720 | MsaT017078.1:CDS |
AGATCTTCATCTTCCATGCT+TGG | 0.390757 | 3:+105502945 | None:intergenic |
CTCTTTGCACTGGATTGGAT+TGG | 0.394071 | 3:-105501728 | MsaT017078.1:CDS |
GGGTCCATGCCGAGTTTGTT+GGG | 0.400094 | 3:+105502803 | None:intergenic |
AAAACGGGAATCTGAATTGC+AGG | 0.401372 | 3:+105502282 | None:intergenic |
GTTTAATCATTTCGGTTTGA+AGG | 0.403646 | 3:+105500998 | None:intergenic |
TCAAATTACTAGCAAATCAA+TGG | 0.407732 | 3:-105501071 | MsaT017078.1:CDS |
TCTTATGTTTACAGATGAAT+TGG | 0.410262 | 3:-105501528 | MsaT017078.1:intron |
TCGGTTTGGTTCAACAAAAC+GGG | 0.413527 | 3:+105502267 | None:intergenic |
TTGATTAAGTGCCCGCAGTT+CGG | 0.413996 | 3:+105502248 | None:intergenic |
TTCGGTTTGGTTCAACAAAA+CGG | 0.419751 | 3:+105502266 | None:intergenic |
GATTCTAAATTGTAAGCAAA+TGG | 0.423137 | 3:+105502606 | None:intergenic |
GTAATTTGATCTGCTTCAAA+AGG | 0.424097 | 3:+105501085 | None:intergenic |
TGAGACTCTTTGCACTGGAT+TGG | 0.424222 | 3:-105501733 | MsaT017078.1:CDS |
CAAGAAAATTACTATGGACT+TGG | 0.426462 | 3:-105502714 | MsaT017078.1:CDS |
GATAAATCTGCTAGTGTTGT+TGG | 0.428775 | 3:+105502867 | None:intergenic |
ACCTTTCTGTGGGGCCATCT+GGG | 0.433450 | 3:+105501205 | None:intergenic |
GGACCCCACCAAAATCTTCA+TGG | 0.435855 | 3:-105502786 | MsaT017078.1:CDS |
CCATGATATTCAACAAGGTC+AGG | 0.445114 | 3:-105502523 | MsaT017078.1:CDS |
ATGAACTACCATCCACTTCA+AGG | 0.454887 | 3:+105502337 | None:intergenic |
TCATATTGATCTTGAACCAT+TGG | 0.458294 | 3:+105502396 | None:intergenic |
AAGAAAACTTGTCGTAAAGC+AGG | 0.469657 | 3:-105501232 | MsaT017078.1:CDS |
CCTGACCTTGTTGAATATCA+TGG | 0.476020 | 3:+105502523 | None:intergenic |
CACCAAAATCTTCATGGAGT+TGG | 0.477847 | 3:-105502780 | MsaT017078.1:CDS |
TTATTCATATTGAAGAAACT+TGG | 0.478548 | 3:+105502891 | None:intergenic |
TAAGTGCCCGCAGTTCGGTT+TGG | 0.482116 | 3:+105502253 | None:intergenic |
ACTTGTTCTGAGAGGTTCCT+AGG | 0.487950 | 3:+105501473 | None:intergenic |
AGGCAAGGGCAAGGACTGAA+GGG | 0.491007 | 3:-105501032 | MsaT017078.1:CDS |
AGCAAATCAATGGGAAGGAC+AGG | 0.496313 | 3:-105501061 | MsaT017078.1:CDS |
ATTGGTGGAGCAAGAGCAAA+TGG | 0.500485 | 3:-105501510 | MsaT017078.1:CDS |
CAAATTACTAGCAAATCAAT+GGG | 0.500638 | 3:-105501070 | MsaT017078.1:CDS |
TATCGCTGCTGCGGCTAAAG+TGG | 0.502806 | 3:+105500925 | None:intergenic |
TATGTTTACAGATGAATTGG+TGG | 0.515772 | 3:-105501525 | MsaT017078.1:intron |
AACTGCGGGCACTTAATCAA+TGG | 0.515958 | 3:-105502245 | MsaT017078.1:CDS |
GAGGCAAGGGCAAGGACTGA+AGG | 0.520542 | 3:-105501033 | MsaT017078.1:CDS |
TATTCATATTGAAGAAACTT+GGG | 0.521262 | 3:+105502892 | None:intergenic |
TCAATCATTTGATAAACTGA+TGG | 0.522363 | 3:+105501979 | None:intergenic |
GTCTCATAAAATTCAGACAT+TGG | 0.526543 | 3:+105501750 | None:intergenic |
CAATCATTTGATAAACTGAT+GGG | 0.528489 | 3:+105501980 | None:intergenic |
TTACCACTCTGATTCTGTTG+TGG | 0.528506 | 3:+105502636 | None:intergenic |
GCTTGAGATTCATGGAAGGT+TGG | 0.532570 | 3:-105502049 | MsaT017078.1:CDS |
ATTGAAGAAACTTGGGTCAA+CGG | 0.535851 | 3:+105502899 | None:intergenic |
TGGAATAAATAGCCTTGAAG+TGG | 0.539422 | 3:-105502349 | MsaT017078.1:CDS |
GTTGAACCAAACCGAACTGC+GGG | 0.542214 | 3:-105502259 | MsaT017078.1:CDS |
ATAAATCTGCTAGTGTTGTT+GGG | 0.542463 | 3:+105502868 | None:intergenic |
TATGGACTTGGAATACTTGG+TGG | 0.542573 | 3:-105502702 | MsaT017078.1:CDS |
CTGCGGCTAAAGTGGCAAGA+AGG | 0.552292 | 3:+105500933 | None:intergenic |
AGTTTGTTGGGACAGTGCAG+TGG | 0.563322 | 3:+105502815 | None:intergenic |
ACCCAGATGGCCCCACAGAA+AGG | 0.563782 | 3:-105501206 | MsaT017078.1:intron |
CCCCATTAACAGGTATCTGA+TGG | 0.567348 | 3:+105502004 | None:intergenic |
GTAAAGCAGGGTTACCCAGA+TGG | 0.568095 | 3:-105501219 | MsaT017078.1:CDS |
TGTGTGGAACGTCATTTAGC+AGG | 0.571153 | 3:-105501792 | MsaT017078.1:CDS |
GTCCATGTTGTTGTACATCA+TGG | 0.572620 | 3:+105502454 | None:intergenic |
AGAAAACTTGTCGTAAAGCA+GGG | 0.586540 | 3:-105501231 | MsaT017078.1:CDS |
CGGCTAAAGTGGCAAGAAGG+CGG | 0.587716 | 3:+105500936 | None:intergenic |
ATAAAATATGAATCCAAGCA+TGG | 0.591295 | 3:-105502958 | None:intergenic |
ATTCTGTTGTGGCAATACAT+TGG | 0.591773 | 3:+105502647 | None:intergenic |
CACCATGATGTACAACAACA+TGG | 0.591982 | 3:-105502456 | MsaT017078.1:CDS |
AGGACAGGATACAGAGGCAA+GGG | 0.593438 | 3:-105501046 | MsaT017078.1:CDS |
CTGTCCCAACAAACTCGGCA+TGG | 0.594201 | 3:-105502807 | MsaT017078.1:CDS |
GTTTGTTGGGACAGTGCAGT+GGG | 0.598692 | 3:+105502816 | None:intergenic |
GATATTCAACAAGGTCAGGA+TGG | 0.598749 | 3:-105502519 | MsaT017078.1:CDS |
ATAAATAGCCTTGAAGTGGA+TGG | 0.603975 | 3:-105502345 | MsaT017078.1:CDS |
CTGCACTGTCCCAACAAACT+CGG | 0.604462 | 3:-105502812 | MsaT017078.1:CDS |
GAAATGATTAAACATTGTGG+TGG | 0.607415 | 3:-105500988 | MsaT017078.1:CDS |
TGAATATCATGGTAAATGAA+CGG | 0.610177 | 3:+105502534 | None:intergenic |
ACCGAAATGATTAAACATTG+TGG | 0.612061 | 3:-105500991 | MsaT017078.1:CDS |
CCATCAGATACCTGTTAATG+GGG | 0.617286 | 3:-105502004 | MsaT017078.1:CDS |
AAAAGCTTGAGATTCATGGA+AGG | 0.617730 | 3:-105502053 | MsaT017078.1:CDS |
GGCAAGGGCAAGGACTGAAG+GGG | 0.618518 | 3:-105501031 | MsaT017078.1:CDS |
TTACTAGCAAATCAATGGGA+AGG | 0.619972 | 3:-105501066 | MsaT017078.1:CDS |
TGTTGAACCAAACCGAACTG+CGG | 0.627319 | 3:-105502260 | MsaT017078.1:CDS |
CAACAACATGGACATGGACA+TGG | 0.630152 | 3:-105502444 | MsaT017078.1:CDS |
CATCATATTCAACAACTGCA+TGG | 0.630346 | 3:-105502570 | MsaT017078.1:CDS |
AGAGAAATCATACACACTGA+TGG | 0.630751 | 3:-105502177 | MsaT017078.1:intron |
AAATACGGGGTTACTGTGGG+TGG | 0.632071 | 3:+105502222 | None:intergenic |
GCGATGTCATACAACGCGGT+TGG | 0.634750 | 3:+105500958 | None:intergenic |
AGGATACAGAGGCAAGGGCA+AGG | 0.638191 | 3:-105501041 | MsaT017078.1:CDS |
AAGGACAGGATACAGAGGCA+AGG | 0.639471 | 3:-105501047 | MsaT017078.1:CDS |
ATTTACCATGATATTCAACA+AGG | 0.642604 | 3:-105502528 | MsaT017078.1:CDS |
ATATTATTACTTGTTCTGAG+AGG | 0.643167 | 3:+105501465 | None:intergenic |
GATGTACAACAACATGGACA+TGG | 0.659086 | 3:-105502450 | MsaT017078.1:CDS |
AATCATTTGATAAACTGATG+GGG | 0.687280 | 3:+105501981 | None:intergenic |
TTGGTGGAGCAAGAGCAAAT+GGG | 0.694143 | 3:-105501509 | MsaT017078.1:CDS |
ATGGGAAGGACAGGATACAG+AGG | 0.708986 | 3:-105501052 | MsaT017078.1:CDS |
TGGGTGATAATGGAACGCCT+AGG | 0.709329 | 3:-105501490 | MsaT017078.1:CDS |
CATATTCAACAACTGCATGG+TGG | 0.712817 | 3:-105502567 | MsaT017078.1:CDS |
TTGCCACAACAGAATCAGAG+TGG | 0.727563 | 3:-105502639 | MsaT017078.1:CDS |
GGCGGCGATGTCATACAACG+CGG | 0.812023 | 3:+105500954 | None:intergenic |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr3 | gene | 105500939 | 105502973 | 105500939 | ID=MsaG017078 |
Chr3 | mRNA | 105500939 | 105502973 | 105500939 | ID=MsaT017078.1;Parent=MsaG017078 |
Chr3 | exon | 105500939 | 105501115 | 105500939 | ID=MsaT017078.1.exon6;Parent=MsaT017078.1 |
Chr3 | CDS | 105500939 | 105501115 | 105500939 | ID=cds.MsaT017078.1;Parent=MsaT017078.1 |
Chr3 | exon | 105501207 | 105501362 | 105501207 | ID=MsaT017078.1.exon5;Parent=MsaT017078.1 |
Chr3 | CDS | 105501207 | 105501362 | 105501207 | ID=cds.MsaT017078.1;Parent=MsaT017078.1 |
Chr3 | exon | 105501475 | 105501536 | 105501475 | ID=MsaT017078.1.exon4;Parent=MsaT017078.1 |
Chr3 | CDS | 105501475 | 105501536 | 105501475 | ID=cds.MsaT017078.1;Parent=MsaT017078.1 |
Chr3 | exon | 105501685 | 105501863 | 105501685 | ID=MsaT017078.1.exon3;Parent=MsaT017078.1 |
Chr3 | CDS | 105501685 | 105501863 | 105501685 | ID=cds.MsaT017078.1;Parent=MsaT017078.1 |
Chr3 | exon | 105501979 | 105502087 | 105501979 | ID=MsaT017078.1.exon2;Parent=MsaT017078.1 |
Chr3 | CDS | 105501979 | 105502087 | 105501979 | ID=cds.MsaT017078.1;Parent=MsaT017078.1 |
Chr3 | exon | 105502178 | 105502973 | 105502178 | ID=MsaT017078.1.exon1;Parent=MsaT017078.1 |
Chr3 | CDS | 105502178 | 105502973 | 105502178 | ID=cds.MsaT017078.1;Parent=MsaT017078.1 |
Gene Sequence |
Protein sequence |