Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG017261 | XP_003603465.1 | 95.771 | 1206 | 44 | 1 | 1 | 1199 | 1 | 1206 | 0.0 | 2407 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG017261 | sp|Q9C5X9|HAC1_ARATH | 46.420 | 866 | 420 | 12 | 356 | 1191 | 832 | 1683 | 0.0 | 800 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG017261 | tr|G7JBQ0|G7JBQ0_MEDTR | 95.771 | 1206 | 44 | 1 | 1 | 1199 | 1 | 1206 | 0.0 | 2407 |
Gene ID | Type | Classification |
---|---|---|
MsaG017261 | TR | TAZ |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000005 | MsaG017261 | 0.880175 | 1.439144e-69 | 2.618488e-66 |
MsaG000219 | MsaG017261 | 0.818065 | 4.150121e-52 | 8.676623e-50 |
MsaG000216 | MsaG017261 | 0.815885 | 1.274359e-51 | 2.519280e-49 |
MsaG000234 | MsaG017261 | 0.857999 | 2.171127e-62 | 1.565587e-59 |
MsaG000364 | MsaG017261 | 0.838342 | 5.598921e-57 | 2.075224e-54 |
MsaG000377 | MsaG017261 | 0.811304 | 1.283322e-50 | 2.262514e-48 |
MsaG000379 | MsaG017261 | 0.854401 | 2.434393e-61 | 1.539560e-58 |
MsaG000413 | MsaG017261 | 0.849636 | 5.412480e-60 | 2.897561e-57 |
MsaG000479 | MsaG017261 | 0.822699 | 3.631574e-53 | 8.581749e-51 |
MsaG000553 | MsaG017261 | 0.853764 | 3.706581e-61 | 2.291303e-58 |
MsaG000520 | MsaG017261 | 0.849490 | 5.942579e-60 | 3.165450e-57 |
MsaG000545 | MsaG017261 | 0.806656 | 1.254947e-49 | 1.977976e-47 |
MsaG000801 | MsaG017261 | 0.846010 | 5.338952e-59 | 2.529528e-56 |
MsaG000944 | MsaG017261 | 0.801747 | 1.305131e-48 | 1.835723e-46 |
MsaG001223 | MsaG017261 | 0.805096 | 2.660199e-49 | 4.042038e-47 |
MsaG001283 | MsaG017261 | 0.828955 | 1.208167e-54 | 3.393513e-52 |
MsaG001307 | MsaG017261 | 0.826149 | 5.654008e-54 | 1.468295e-51 |
MsaG001771 | MsaG017261 | 0.852173 | 1.052073e-60 | 6.148629e-58 |
MsaG001772 | MsaG017261 | 0.814267 | 2.902517e-51 | 5.508302e-49 |
MsaG001828 | MsaG017261 | 0.885274 | 2.018289e-71 | 4.685856e-68 |
MsaG001875 | MsaG017261 | 0.826777 | 4.012741e-54 | 1.060357e-51 |
MsaG002061 | MsaG017261 | 0.863160 | 6.023132e-64 | 5.289919e-61 |
MsaG002123 | MsaG017261 | 0.801836 | 1.251745e-48 | 1.764189e-46 |
MsaG002167 | MsaG017261 | 0.805398 | 2.301926e-49 | 3.522208e-47 |
MsaG002405 | MsaG017261 | 0.825593 | 7.652941e-54 | 1.956741e-51 |
MsaG002484 | MsaG017261 | 0.813458 | 4.366528e-51 | 8.120168e-49 |
MsaG002530 | MsaG017261 | 0.811659 | 1.075351e-50 | 1.912393e-48 |
MsaG002717 | MsaG017261 | 0.886022 | 1.061170e-71 | 2.555816e-68 |
MsaG002731 | MsaG017261 | 0.821277 | 7.725242e-53 | 1.757516e-50 |
MsaG002975 | MsaG017261 | 0.879338 | 2.845278e-69 | 4.980865e-66 |
MsaG003042 | MsaG017261 | 0.818769 | 2.878313e-52 | 6.128693e-50 |
MsaG003089 | MsaG017261 | 0.879317 | 2.895865e-69 | 5.064682e-66 |
MsaG003252 | MsaG017261 | 0.848370 | 1.211894e-59 | 6.213091e-57 |
MsaG003292 | MsaG017261 | 0.808419 | 5.324021e-50 | 8.751795e-48 |
MsaG003306 | MsaG017261 | 0.827672 | 2.454667e-54 | 6.651043e-52 |
MsaG003460 | MsaG017261 | 0.865059 | 1.551997e-64 | 1.469777e-61 |
MsaG003435 | MsaG017261 | 0.880223 | 1.383730e-69 | 2.523097e-66 |
MsaG003512 | MsaG017261 | 0.816421 | 9.685919e-52 | 1.941078e-49 |
MsaG003590 | MsaG017261 | 0.819464 | 2.004089e-52 | 4.345741e-50 |
MsaG003616 | MsaG017261 | 0.814469 | 2.619789e-51 | 4.997009e-49 |
MsaG003743 | MsaG017261 | 0.831417 | 3.047837e-55 | 9.187257e-53 |
MsaG003740 | MsaG017261 | 0.871548 | 1.284724e-66 | 1.590051e-63 |
MsaG003745 | MsaG017261 | 0.828742 | 1.359919e-54 | 3.796898e-52 |
MsaG003750 | MsaG017261 | 0.840463 | 1.584183e-57 | 6.274890e-55 |
MsaG003769 | MsaG017261 | 0.822192 | 4.758415e-53 | 1.109176e-50 |
MsaG003986 | MsaG017261 | 0.873824 | 2.247115e-67 | 3.069324e-64 |
MsaG004004 | MsaG017261 | 0.818950 | 2.620103e-52 | 5.605458e-50 |
MsaG003896 | MsaG017261 | 0.840908 | 1.212781e-57 | 4.871378e-55 |
MsaG003930 | MsaG017261 | 0.851101 | 2.109481e-60 | 1.187532e-57 |
MsaG003934 | MsaG017261 | 0.849825 | 4.795557e-60 | 2.583556e-57 |
MsaG003938 | MsaG017261 | 0.877503 | 1.246805e-68 | 2.005959e-65 |
MsaG003976 | MsaG017261 | 0.879429 | 2.643281e-69 | 4.646909e-66 |
MsaG003977 | MsaG017261 | 0.809563 | 3.037140e-50 | 5.132308e-48 |
MsaG004227 | MsaG017261 | 0.875078 | 8.469649e-68 | 1.222219e-64 |
MsaG004186 | MsaG017261 | 0.823826 | 1.987007e-53 | 4.841025e-51 |
MsaG004193 | MsaG017261 | 0.841181 | 1.029464e-57 | 4.171086e-55 |
MsaG004199 | MsaG017261 | 0.862286 | 1.117282e-63 | 9.481588e-61 |
MsaG004306 | MsaG017261 | 0.823099 | 2.933567e-53 | 7.007581e-51 |
MsaG004367 | MsaG017261 | 0.854020 | 3.130967e-61 | 1.953318e-58 |
MsaG004418 | MsaG017261 | 0.848317 | 1.253622e-59 | 6.415751e-57 |
MsaG004420 | MsaG017261 | 0.850535 | 3.039109e-60 | 1.677705e-57 |
MsaG004444 | MsaG017261 | 0.808163 | 6.032830e-50 | 9.856207e-48 |
MsaG004465 | MsaG017261 | 0.867382 | 2.871680e-65 | 2.986834e-62 |
MsaG004510 | MsaG017261 | 0.855401 | 1.251445e-61 | 8.203065e-59 |
MsaG004584 | MsaG017261 | 0.822657 | 3.715222e-53 | 8.769282e-51 |
MsaG004686 | MsaG017261 | 0.809226 | 3.584963e-50 | 6.008466e-48 |
MsaG004782 | MsaG017261 | 0.847786 | 1.753166e-59 | 8.815271e-57 |
MsaG004820 | MsaG017261 | 0.803766 | 5.021623e-49 | 7.398278e-47 |
MsaG004921 | MsaG017261 | 0.863282 | 5.526506e-64 | 4.876948e-61 |
MsaG005152 | MsaG017261 | 0.814935 | 2.068206e-51 | 3.991434e-49 |
MsaG005348 | MsaG017261 | 0.881424 | 5.151840e-70 | 9.937798e-67 |
MsaG005351 | MsaG017261 | 0.853986 | 3.203121e-61 | 1.995841e-58 |
MsaG005403 | MsaG017261 | 0.824772 | 1.193616e-53 | 2.983850e-51 |
MsaG005574 | MsaG017261 | 0.861604 | 1.802230e-63 | 1.489533e-60 |
MsaG005579 | MsaG017261 | 0.823548 | 2.307125e-53 | 5.578608e-51 |
MsaG005598 | MsaG017261 | 0.846938 | 2.989649e-59 | 1.460897e-56 |
MsaG005636 | MsaG017261 | 0.877726 | 1.043148e-68 | 1.695447e-65 |
MsaG005664 | MsaG017261 | 0.824788 | 1.183522e-53 | 2.959901e-51 |
MsaG005831 | MsaG017261 | 0.835736 | 2.575065e-56 | 8.817417e-54 |
MsaG006027 | MsaG017261 | 0.819031 | 2.511761e-52 | 5.385163e-50 |
MsaG005941 | MsaG017261 | 0.803511 | 5.669447e-49 | 8.303603e-47 |
MsaG005942 | MsaG017261 | 0.816668 | 8.528919e-52 | 1.720076e-49 |
MsaG005948 | MsaG017261 | 0.810526 | 1.888036e-50 | 3.265901e-48 |
MsaG006131 | MsaG017261 | 0.802114 | 1.097885e-48 | 1.557127e-46 |
MsaG006140 | MsaG017261 | 0.823628 | 2.209942e-53 | 5.355515e-51 |
MsaG006231 | MsaG017261 | 0.833237 | 1.084968e-55 | 3.449135e-53 |
MsaG006293 | MsaG017261 | 0.817707 | 4.994092e-52 | 1.034490e-49 |
MsaG006357 | MsaG017261 | 0.834817 | 4.381338e-56 | 1.459604e-53 |
MsaG006425 | MsaG017261 | 0.843187 | 3.047510e-58 | 1.316430e-55 |
MsaG006491 | MsaG017261 | 0.812363 | 7.566215e-51 | 1.369135e-48 |
MsaG006526 | MsaG017261 | 0.855877 | 9.104700e-62 | 6.071374e-59 |
MsaG006586 | MsaG017261 | 0.824973 | 1.070736e-53 | 2.691468e-51 |
MsaG006549 | MsaG017261 | 0.846913 | 3.037112e-59 | 1.482873e-56 |
MsaG006552 | MsaG017261 | 0.822135 | 4.903560e-53 | 1.141303e-50 |
MsaG006563 | MsaG017261 | 0.813749 | 3.770118e-51 | 7.062474e-49 |
MsaG006640 | MsaG017261 | 0.825468 | 8.191177e-54 | 2.087141e-51 |
MsaG006701 | MsaG017261 | 0.836139 | 2.036537e-56 | 7.058879e-54 |
MsaG006743 | MsaG017261 | 0.833652 | 8.559921e-56 | 2.754471e-53 |
MsaG006813 | MsaG017261 | 0.834604 | 4.954677e-56 | 1.640132e-53 |
MsaG006909 | MsaG017261 | 0.838876 | 4.081370e-57 | 1.538284e-54 |
MsaG006910 | MsaG017261 | 0.820213 | 1.353195e-52 | 2.993190e-50 |
MsaG007015 | MsaG017261 | 0.877325 | 1.437110e-68 | 2.293331e-65 |
MsaG007026 | MsaG017261 | 0.810609 | 1.812336e-50 | 3.141245e-48 |
MsaG007317 | MsaG017261 | 0.802100 | 1.105180e-48 | 1.566974e-46 |
MsaG007375 | MsaG017261 | 0.811101 | 1.419643e-50 | 2.490398e-48 |
MsaG007525 | MsaG017261 | 0.813592 | 4.082396e-51 | 7.617445e-49 |
MsaG007546 | MsaG017261 | 0.883438 | 9.601478e-71 | 2.039015e-67 |
MsaG007610 | MsaG017261 | 0.866769 | 4.496533e-65 | 4.562137e-62 |
MsaG007686 | MsaG017261 | 0.877243 | 1.534656e-68 | 2.439990e-65 |
MsaG007663 | MsaG017261 | 0.807469 | 8.458281e-50 | 1.359034e-47 |
MsaG007665 | MsaG017261 | 0.858614 | 1.427497e-62 | 1.053186e-59 |
MsaG007759 | MsaG017261 | 0.881246 | 5.972209e-70 | 1.142273e-66 |
MsaG008049 | MsaG017261 | 0.811425 | 1.208461e-50 | 2.136821e-48 |
MsaG008019 | MsaG017261 | 0.843693 | 2.236102e-58 | 9.818297e-56 |
MsaG008148 | MsaG017261 | 0.824825 | 1.160181e-53 | 2.904476e-51 |
MsaG008168 | MsaG017261 | 0.816321 | 1.019366e-51 | 2.037686e-49 |
MsaG008432 | MsaG017261 | 0.808274 | 5.714145e-50 | 9.360584e-48 |
MsaG008647 | MsaG017261 | 0.837050 | 1.196630e-56 | 4.263165e-54 |
MsaG008998 | MsaG017261 | 0.834683 | 4.734543e-56 | 1.570993e-53 |
MsaG009000 | MsaG017261 | 0.800318 | 2.548918e-48 | 3.471049e-46 |
MsaG009372 | MsaG017261 | 0.880776 | 8.790111e-70 | 1.645469e-66 |
MsaG009891 | MsaG017261 | 0.867028 | 3.723536e-65 | 3.817838e-62 |
MsaG009880 | MsaG017261 | 0.850337 | 3.453003e-60 | 1.893042e-57 |
MsaG010004 | MsaG017261 | 0.876137 | 3.688231e-68 | 5.579889e-65 |
MsaG010148 | MsaG017261 | 0.870349 | 3.177425e-66 | 3.736311e-63 |
MsaG010302 | MsaG017261 | 0.845944 | 5.564549e-59 | 2.630443e-56 |
MsaG010314 | MsaG017261 | 0.801516 | 1.454535e-48 | 2.035149e-46 |
MsaG010377 | MsaG017261 | 0.805795 | 1.901330e-49 | 2.936400e-47 |
MsaG010418 | MsaG017261 | 0.833261 | 1.070038e-55 | 3.404006e-53 |
MsaG010633 | MsaG017261 | 0.807336 | 9.025456e-50 | 1.445557e-47 |
MsaG010631 | MsaG017261 | 0.827242 | 3.109995e-54 | 8.325608e-52 |
MsaG010597 | MsaG017261 | 0.829658 | 8.173107e-55 | 2.342307e-52 |
MsaG010621 | MsaG017261 | 0.864621 | 2.127071e-64 | 1.979318e-61 |
MsaG010622 | MsaG017261 | 0.867555 | 2.531118e-65 | 2.651194e-62 |
MsaG010702 | MsaG017261 | 0.824387 | 1.469565e-53 | 3.635397e-51 |
MsaG010703 | MsaG017261 | 0.800432 | 2.417059e-48 | 3.300048e-46 |
MsaG010707 | MsaG017261 | 0.808387 | 5.408724e-50 | 8.883964e-48 |
MsaG010796 | MsaG017261 | 0.804840 | 3.007671e-49 | 4.542975e-47 |
MsaG010994 | MsaG017261 | 0.835352 | 3.215973e-56 | 1.088645e-53 |
MsaG011043 | MsaG017261 | 0.818256 | 3.757672e-52 | 7.894993e-50 |
MsaG011199 | MsaG017261 | 0.840468 | 1.580126e-57 | 6.259657e-55 |
MsaG011230 | MsaG017261 | 0.839021 | 3.743714e-57 | 1.417424e-54 |
MsaG011407 | MsaG017261 | 0.816942 | 7.407874e-52 | 1.504658e-49 |
MsaG011428 | MsaG017261 | 0.830321 | 5.642419e-55 | 1.648007e-52 |
MsaG011587 | MsaG017261 | 0.813641 | 3.981536e-51 | 7.438303e-49 |
MsaG011657 | MsaG017261 | 0.833914 | 7.365359e-56 | 2.388332e-53 |
MsaG011749 | MsaG017261 | 0.803608 | 5.412306e-49 | 7.944739e-47 |
MsaG011805 | MsaG017261 | 0.814116 | 3.132526e-51 | 5.922294e-49 |
MsaG012083 | MsaG017261 | 0.810143 | 2.282227e-50 | 3.910905e-48 |
MsaG012301 | MsaG017261 | 0.851365 | 1.778872e-60 | 1.010534e-57 |
MsaG012438 | MsaG017261 | 0.873447 | 3.005357e-67 | 4.037104e-64 |
MsaG012440 | MsaG017261 | 0.825739 | 7.067565e-54 | 1.814527e-51 |
MsaG012442 | MsaG017261 | 0.847741 | 1.803335e-59 | 9.053709e-57 |
MsaG012443 | MsaG017261 | 0.892982 | 2.138889e-74 | 7.385256e-71 |
MsaG012461 | MsaG017261 | 0.810071 | 2.364526e-50 | 4.044928e-48 |
MsaG012521 | MsaG017261 | 0.811865 | 9.705250e-51 | 1.734740e-48 |
MsaG012595 | MsaG017261 | 0.854075 | 3.019420e-61 | 1.887328e-58 |
MsaG012747 | MsaG017261 | 0.854380 | 2.467060e-61 | 1.559093e-58 |
MsaG012774 | MsaG017261 | 0.895617 | 1.822035e-75 | 7.256655e-72 |
MsaG012782 | MsaG017261 | 0.804035 | 4.418219e-49 | 6.550376e-47 |
MsaG012891 | MsaG017261 | 0.813160 | 5.074319e-51 | 9.366159e-49 |
MsaG012982 | MsaG017261 | 0.837799 | 7.710671e-57 | 2.810483e-54 |
MsaG013231 | MsaG017261 | 0.865402 | 1.212189e-64 | 1.163735e-61 |
MsaG013708 | MsaG017261 | 0.849294 | 6.734551e-60 | 3.563199e-57 |
MsaG013633 | MsaG017261 | 0.805605 | 2.083974e-49 | 3.204149e-47 |
MsaG013827 | MsaG017261 | 0.815970 | 1.220262e-51 | 2.417554e-49 |
MsaG013810 | MsaG017261 | 0.806806 | 1.166809e-49 | 1.845543e-47 |
MsaG013895 | MsaG017261 | 0.846030 | 5.275573e-59 | 2.501003e-56 |
MsaG014043 | MsaG017261 | 0.805514 | 2.177134e-49 | 3.340173e-47 |
MsaG014300 | MsaG017261 | 0.838225 | 5.996498e-57 | 2.214626e-54 |
MsaG014560 | MsaG017261 | 0.879328 | 2.869576e-69 | 5.021297e-66 |
MsaG014726 | MsaG017261 | 0.845553 | 7.096462e-59 | 3.311493e-56 |
MsaG014844 | MsaG017261 | 0.842862 | 3.717655e-58 | 1.589277e-55 |
MsaG014945 | MsaG017261 | 0.840328 | 1.717497e-57 | 6.774346e-55 |
MsaG015088 | MsaG017261 | 0.852716 | 7.377605e-61 | 4.394799e-58 |
MsaG015096 | MsaG017261 | 0.820954 | 9.162698e-53 | 2.066791e-50 |
MsaG015329 | MsaG017261 | 0.817147 | 6.665993e-52 | 1.361160e-49 |
MsaG015349 | MsaG017261 | 0.818446 | 3.404697e-52 | 7.188718e-50 |
MsaG015353 | MsaG017261 | 0.870198 | 3.557695e-66 | 4.157123e-63 |
MsaG015358 | MsaG017261 | 0.855253 | 1.381487e-61 | 9.006629e-59 |
MsaG015397 | MsaG017261 | 0.848360 | 1.219541e-59 | 6.250080e-57 |
MsaG015865 | MsaG017261 | 0.817431 | 5.759376e-52 | 1.184641e-49 |
MsaG015898 | MsaG017261 | 0.857982 | 2.197723e-62 | 1.583637e-59 |
MsaG015939 | MsaG017261 | 0.850614 | 2.887984e-60 | 1.598765e-57 |
MsaG016229 | MsaG017261 | 0.818493 | 3.323618e-52 | 7.026020e-50 |
MsaG016375 | MsaG017261 | 0.838154 | 6.254665e-57 | 2.304909e-54 |
MsaG016387 | MsaG017261 | 0.836219 | 1.944884e-56 | 6.757238e-54 |
MsaG016460 | MsaG017261 | 0.883487 | 9.213212e-71 | 1.961334e-67 |
MsaG016474 | MsaG017261 | 0.802202 | 1.053197e-48 | 1.496769e-46 |
MsaG016682 | MsaG017261 | 0.877805 | 9.794855e-69 | 1.597669e-65 |
MsaG016688 | MsaG017261 | 0.870160 | 3.661961e-66 | 4.272066e-63 |
MsaG016706 | MsaG017261 | 0.814912 | 2.092700e-51 | 4.036349e-49 |
MsaG016707 | MsaG017261 | 0.812644 | 6.572655e-51 | 1.197657e-48 |
MsaG016827 | MsaG017261 | 0.818813 | 2.813651e-52 | 5.997779e-50 |
MsaG016906 | MsaG017261 | 0.856590 | 5.637342e-62 | 3.858966e-59 |
MsaG016972 | MsaG017261 | 0.811025 | 1.474722e-50 | 2.582139e-48 |
MsaG017085 | MsaG017261 | 0.858820 | 1.240016e-62 | 9.218765e-60 |
MsaG017107 | MsaG017261 | 0.861800 | 1.571259e-63 | 1.308437e-60 |
MsaG017152 | MsaG017261 | 0.827969 | 2.084870e-54 | 5.696358e-52 |
MsaG017147 | MsaG017261 | 0.825903 | 6.466105e-54 | 1.667742e-51 |
MsaG017181 | MsaG017261 | 0.828596 | 1.474179e-54 | 4.099398e-52 |
MsaG017261 | MsaG017267 | 0.820437 | 1.203233e-52 | 2.677227e-50 |
MsaG017261 | MsaG017323 | 0.867694 | 2.284875e-65 | 2.406961e-62 |
MsaG017261 | MsaG017372 | 0.804598 | 3.376595e-49 | 5.071495e-47 |
MsaG017261 | MsaG017380 | 0.885041 | 2.463485e-71 | 5.654128e-68 |
MsaG017261 | MsaG017406 | 0.817058 | 6.980896e-52 | 1.422172e-49 |
MsaG017261 | MsaG017418 | 0.840462 | 1.584974e-57 | 6.277836e-55 |
MsaG017261 | MsaG017469 | 0.819096 | 2.427648e-52 | 5.213783e-50 |
MsaG017261 | MsaG017571 | 0.836279 | 1.877575e-56 | 6.535423e-54 |
MsaG017261 | MsaG017710 | 0.866276 | 6.439876e-65 | 6.403040e-62 |
MsaG017261 | MsaG017724 | 0.807509 | 8.296970e-50 | 1.334396e-47 |
MsaG017261 | MsaG017825 | 0.817969 | 4.361267e-52 | 9.095650e-50 |
MsaG017261 | MsaG017802 | 0.890060 | 3.046824e-73 | 9.006574e-70 |
MsaG017261 | MsaG017849 | 0.800516 | 2.324388e-48 | 3.179502e-46 |
MsaG017261 | MsaG017867 | 0.804588 | 3.392251e-49 | 5.093869e-47 |
MsaG017261 | MsaG017905 | 0.876509 | 2.748608e-68 | 4.227637e-65 |
MsaG017261 | MsaG017958 | 0.892772 | 2.594325e-74 | 8.855244e-71 |
MsaG017261 | MsaG018062 | 0.859479 | 7.884896e-63 | 6.010236e-60 |
MsaG017261 | MsaG018063 | 0.864193 | 2.888148e-64 | 2.642292e-61 |
MsaG017261 | MsaG018097 | 0.860629 | 3.559802e-63 | 2.835311e-60 |
MsaG017261 | MsaG018234 | 0.856936 | 4.464580e-62 | 3.094674e-59 |
MsaG017261 | MsaG018260 | 0.815685 | 1.411502e-51 | 2.776265e-49 |
MsaG017261 | MsaG018266 | 0.805967 | 1.750155e-49 | 2.713876e-47 |
MsaG017261 | MsaG018268 | 0.809402 | 3.287601e-50 | 5.533769e-48 |
MsaG017261 | MsaG018305 | 0.867910 | 1.948880e-65 | 2.071206e-62 |
MsaG017261 | MsaG018340 | 0.839536 | 2.756504e-57 | 1.060473e-54 |
MsaG017261 | MsaG018368 | 0.848861 | 8.875570e-60 | 4.627067e-57 |
MsaG017261 | MsaG018384 | 0.880408 | 1.189756e-69 | 2.188538e-66 |
MsaG017261 | MsaG018426 | 0.854379 | 2.469149e-61 | 1.560345e-58 |
MsaG017261 | MsaG018427 | 0.801621 | 1.384679e-48 | 1.942028e-46 |
MsaG017261 | MsaG018504 | 0.816475 | 9.419266e-52 | 1.890261e-49 |
MsaG017261 | MsaG018501 | 0.818270 | 3.731447e-52 | 7.842649e-50 |
MsaG017261 | MsaG018538 | 0.816430 | 9.641205e-52 | 1.932554e-49 |
MsaG017261 | MsaG018592 | 0.814032 | 3.269075e-51 | 6.167225e-49 |
MsaG017261 | MsaG018726 | 0.845956 | 5.524840e-59 | 2.612689e-56 |
MsaG017261 | MsaG018806 | 0.838201 | 6.082286e-57 | 2.244719e-54 |
MsaG017261 | MsaG018847 | 0.812400 | 7.427206e-51 | 1.345229e-48 |
MsaG017261 | MsaG018860 | 0.886740 | 5.700834e-72 | 1.422871e-68 |
MsaG017261 | MsaG018863 | 0.845060 | 9.632281e-59 | 4.422894e-56 |
MsaG017261 | MsaG018919 | 0.817229 | 6.390976e-52 | 1.307758e-49 |
MsaG017261 | MsaG018920 | 0.809221 | 3.594125e-50 | 6.023118e-48 |
MsaG017261 | MsaG018922 | 0.860128 | 5.037701e-63 | 3.936412e-60 |
MsaG017261 | MsaG019031 | 0.872615 | 5.695930e-67 | 7.380005e-64 |
MsaG017261 | MsaG019034 | 0.801026 | 1.830852e-48 | 2.533365e-46 |
MsaG017261 | MsaG019059 | 0.852913 | 6.488532e-61 | 3.891895e-58 |
MsaG017261 | MsaG019019 | 0.801474 | 1.483621e-48 | 2.073843e-46 |
MsaG017261 | MsaG019214 | 0.837686 | 8.240419e-57 | 2.993160e-54 |
MsaG017261 | MsaG019268 | 0.806229 | 1.542554e-49 | 2.406914e-47 |
MsaG017261 | MsaG019290 | 0.870355 | 3.162214e-66 | 3.719352e-63 |
MsaG017261 | MsaG019292 | 0.848067 | 1.468002e-59 | 7.451368e-57 |
MsaG017261 | MsaG019300 | 0.802589 | 8.773048e-49 | 1.257944e-46 |
MsaG017261 | MsaG019456 | 0.891556 | 7.895268e-74 | 2.523958e-70 |
MsaG017261 | MsaG019501 | 0.839167 | 3.433453e-57 | 1.305760e-54 |
MsaG017261 | MsaG019492 | 0.831297 | 3.261318e-55 | 9.795855e-53 |
MsaG017261 | MsaG019493 | 0.839232 | 3.303069e-57 | 1.258732e-54 |
MsaG017261 | MsaG019547 | 0.800317 | 2.550285e-48 | 3.472821e-46 |
MsaG017261 | MsaG019616 | 0.850192 | 3.790655e-60 | 2.067802e-57 |
MsaG017261 | MsaG019629 | 0.836203 | 1.962204e-56 | 6.814159e-54 |
MsaG017261 | MsaG019740 | 0.857336 | 3.406680e-62 | 2.396700e-59 |
MsaG017261 | MsaG019835 | 0.834901 | 4.173677e-56 | 1.393918e-53 |
MsaG017261 | MsaG019937 | 0.859577 | 7.368309e-63 | 5.637487e-60 |
MsaG017261 | MsaG019939 | 0.847739 | 1.806245e-59 | 9.067378e-57 |
MsaG017261 | MsaG019945 | 0.817741 | 4.907170e-52 | 1.017395e-49 |
MsaG017261 | MsaG020015 | 0.834313 | 5.856623e-56 | 1.921919e-53 |
MsaG017261 | MsaG020075 | 0.811989 | 9.123121e-51 | 1.635656e-48 |
MsaG017261 | MsaG020133 | 0.826734 | 4.107161e-54 | 1.084068e-51 |
MsaG017261 | MsaG020206 | 0.813493 | 4.291301e-51 | 7.986980e-49 |
MsaG017261 | MsaG020312 | 0.858213 | 1.877392e-62 | 1.364520e-59 |
MsaG017261 | MsaG020335 | 0.818379 | 3.525992e-52 | 7.431855e-50 |
MsaG017261 | MsaG020337 | 0.842598 | 4.363769e-58 | 1.849850e-55 |
MsaG017261 | MsaG020365 | 0.839014 | 3.760650e-57 | 1.423517e-54 |
MsaG017261 | MsaG020370 | 0.843428 | 2.630317e-58 | 1.145063e-55 |
MsaG017261 | MsaG020405 | 0.829112 | 1.107505e-54 | 3.124680e-52 |
MsaG017261 | MsaG020498 | 0.804448 | 3.628092e-49 | 5.430329e-47 |
MsaG017261 | MsaG020558 | 0.849644 | 5.386008e-60 | 2.884087e-57 |
MsaG017261 | MsaG020552 | 0.823062 | 2.992108e-53 | 7.140394e-51 |
MsaG017261 | MsaG020578 | 0.860649 | 3.509603e-63 | 2.797469e-60 |
MsaG017261 | MsaG020567 | 0.806677 | 1.242014e-49 | 1.958583e-47 |
MsaG017261 | MsaG020607 | 0.834488 | 5.297685e-56 | 1.747563e-53 |
MsaG017261 | MsaG020593 | 0.860023 | 5.416323e-63 | 4.214731e-60 |
MsaG017261 | MsaG020670 | 0.875722 | 5.114505e-68 | 7.594538e-65 |
MsaG017261 | MsaG020667 | 0.866622 | 5.005047e-65 | 5.047806e-62 |
MsaG017261 | MsaG020679 | 0.872463 | 6.399398e-67 | 8.237251e-64 |
MsaG017261 | MsaG020778 | 0.813636 | 3.992688e-51 | 7.458012e-49 |
MsaG017261 | MsaG020780 | 0.865053 | 1.559534e-64 | 1.476525e-61 |
MsaG017261 | MsaG020894 | 0.806412 | 1.412302e-49 | 2.213243e-47 |
MsaG017261 | MsaG021001 | 0.866483 | 5.539193e-65 | 5.553996e-62 |
MsaG017261 | MsaG021077 | 0.823637 | 2.199367e-53 | 5.331149e-51 |
MsaG017261 | MsaG021079 | 0.800206 | 2.685957e-48 | 3.648343e-46 |
MsaG017261 | MsaG021083 | 0.829447 | 9.191589e-55 | 2.618290e-52 |
MsaG017261 | MsaG021094 | 0.811584 | 1.116514e-50 | 1.981945e-48 |
MsaG017261 | MsaG021095 | 0.842383 | 4.973686e-58 | 2.093952e-55 |
MsaG017261 | MsaG021274 | 0.800400 | 2.453361e-48 | 3.347217e-46 |
MsaG017261 | MsaG021317 | 0.852050 | 1.139560e-60 | 6.631932e-58 |
MsaG017261 | MsaG022009 | 0.838196 | 6.102841e-57 | 2.251851e-54 |
MsaG017261 | MsaG022191 | 0.819999 | 1.514482e-52 | 3.330839e-50 |
MsaG017261 | MsaG022192 | 0.865881 | 8.573773e-65 | 8.390560e-62 |
MsaG017261 | MsaG022216 | 0.824885 | 1.123040e-53 | 2.816140e-51 |
MsaG017261 | MsaG022478 | 0.832784 | 1.404987e-55 | 4.407201e-53 |
MsaG017261 | MsaG022584 | 0.833955 | 7.193653e-56 | 2.335455e-53 |
MsaG017261 | MsaG022820 | 0.805871 | 1.832838e-49 | 2.835731e-47 |
MsaG017261 | MsaG022824 | 0.814476 | 2.610715e-51 | 4.980494e-49 |
MsaG017261 | MsaG022925 | 0.815260 | 1.752555e-51 | 3.410298e-49 |
MsaG017261 | MsaG023378 | 0.836570 | 1.584597e-56 | 5.563760e-54 |
MsaG017261 | MsaG023442 | 0.873861 | 2.182543e-67 | 2.986007e-64 |
MsaG017261 | MsaG023666 | 0.815603 | 1.471660e-51 | 2.888627e-49 |
MsaG017261 | MsaG023746 | 0.801064 | 1.798191e-48 | 2.490293e-46 |
MsaG017261 | MsaG023817 | 0.872357 | 6.939626e-67 | 8.891859e-64 |
MsaG017261 | MsaG023897 | 0.839077 | 3.621963e-57 | 1.373708e-54 |
MsaG017261 | MsaG023972 | 0.835049 | 3.833845e-56 | 1.286069e-53 |
MsaG017261 | MsaG023987 | 0.814235 | 2.949875e-51 | 5.593684e-49 |
MsaG017261 | MsaG023993 | 0.845373 | 7.938290e-59 | 3.682509e-56 |
MsaG017261 | MsaG024118 | 0.802549 | 8.940967e-49 | 1.280860e-46 |
MsaG017261 | MsaG024122 | 0.879016 | 3.694648e-69 | 6.372400e-66 |
MsaG017261 | MsaG024144 | 0.820537 | 1.141801e-52 | 2.547153e-50 |
MsaG017261 | MsaG024143 | 0.809088 | 3.836549e-50 | 6.409158e-48 |
MsaG017261 | MsaG024136 | 0.827614 | 2.535026e-54 | 6.857755e-52 |
MsaG017261 | MsaG024150 | 0.841736 | 7.362127e-58 | 3.035725e-55 |
MsaG017261 | MsaG024360 | 0.836476 | 1.673992e-56 | 5.861253e-54 |
MsaG017261 | MsaG024652 | 0.844968 | 1.020041e-58 | 4.669772e-56 |
MsaG017261 | MsaG025160 | 0.833662 | 8.510759e-56 | 2.739539e-53 |
MsaG017261 | MsaG025252 | 0.840173 | 1.885046e-57 | 7.398628e-55 |
MsaG017261 | MsaG025262 | 0.805517 | 2.173276e-49 | 3.334547e-47 |
MsaG017261 | MsaG025395 | 0.818489 | 3.330149e-52 | 7.039144e-50 |
MsaG017261 | MsaG025396 | 0.826075 | 5.885724e-54 | 1.525332e-51 |
MsaG017261 | MsaG025451 | 0.887891 | 2.086162e-72 | 5.518045e-69 |
MsaG017261 | MsaG025779 | 0.834510 | 5.229161e-56 | 1.726137e-53 |
MsaG017261 | MsaG025864 | 0.810183 | 2.237178e-50 | 3.837487e-48 |
MsaG017261 | MsaG026603 | 0.821120 | 8.393849e-53 | 1.901654e-50 |
MsaG017261 | MsaG026722 | 0.834932 | 4.100077e-56 | 1.370603e-53 |
MsaG017261 | MsaG026756 | 0.861056 | 2.642902e-63 | 2.139186e-60 |
MsaG017261 | MsaG026770 | 0.850575 | 2.962588e-60 | 1.637801e-57 |
MsaG017261 | MsaG026822 | 0.839225 | 3.317789e-57 | 1.264061e-54 |
MsaG017261 | MsaG026926 | 0.878183 | 7.232454e-69 | 1.200501e-65 |
MsaG017261 | MsaG026966 | 0.900063 | 2.449890e-77 | 1.258130e-73 |
MsaG017261 | MsaG027028 | 0.858139 | 1.974114e-62 | 1.430867e-59 |
MsaG017261 | MsaG027046 | 0.807268 | 9.329836e-50 | 1.491828e-47 |
MsaG017261 | MsaG027054 | 0.897616 | 2.689156e-76 | 1.199532e-72 |
MsaG017261 | MsaG027255 | 0.833454 | 9.583870e-56 | 3.066105e-53 |
MsaG017261 | MsaG027285 | 0.887759 | 2.342210e-72 | 6.152950e-69 |
MsaG017261 | MsaG027309 | 0.859380 | 8.437266e-63 | 6.407630e-60 |
MsaG017261 | MsaG027322 | 0.806513 | 1.345067e-49 | 2.112894e-47 |
MsaG017261 | MsaG027342 | 0.828590 | 1.479402e-54 | 4.113205e-52 |
MsaG017261 | MsaG027367 | 0.824389 | 1.468103e-53 | 3.631993e-51 |
MsaG017261 | MsaG027500 | 0.811599 | 1.108009e-50 | 1.967602e-48 |
MsaG017261 | MsaG027773 | 0.839134 | 3.501479e-57 | 1.330314e-54 |
MsaG017261 | MsaG027802 | 0.854239 | 2.709426e-61 | 1.703625e-58 |
MsaG017261 | MsaG027813 | 0.806533 | 1.331840e-49 | 2.093112e-47 |
MsaG017261 | MsaG027816 | 0.804995 | 2.792473e-49 | 4.233049e-47 |
MsaG017261 | MsaG027830 | 0.822601 | 3.827087e-53 | 9.019812e-51 |
MsaG017261 | MsaG027929 | 0.827579 | 2.583913e-54 | 6.983363e-52 |
MsaG017261 | MsaG027935 | 0.804466 | 3.596573e-49 | 5.385399e-47 |
MsaG017261 | MsaG028003 | 0.853312 | 4.992567e-61 | 3.037026e-58 |
MsaG017261 | MsaG027999 | 0.809312 | 3.436847e-50 | 5.772117e-48 |
MsaG017261 | MsaG028236 | 0.827249 | 3.097652e-54 | 8.294322e-52 |
MsaG017261 | MsaG028282 | 0.833703 | 8.310868e-56 | 2.678448e-53 |
MsaG017261 | MsaG028342 | 0.836317 | 1.836467e-56 | 6.399515e-54 |
MsaG017261 | MsaG028348 | 0.843337 | 2.781467e-58 | 1.207354e-55 |
MsaG017261 | MsaG028353 | 0.804137 | 4.207953e-49 | 6.253228e-47 |
MsaG017261 | MsaG028553 | 0.866168 | 6.967173e-65 | 6.897444e-62 |
MsaG017261 | MsaG028607 | 0.827938 | 2.120416e-54 | 5.788485e-52 |
MsaG017261 | MsaG028625 | 0.832578 | 1.579325e-55 | 4.924234e-53 |
MsaG017261 | MsaG028657 | 0.816456 | 9.509418e-52 | 1.907476e-49 |
MsaG017261 | MsaG028668 | 0.851759 | 1.377220e-60 | 7.932622e-58 |
MsaG017261 | MsaG028787 | 0.835933 | 2.296965e-56 | 7.912069e-54 |
MsaG017261 | MsaG028773 | 0.804000 | 4.492042e-49 | 6.654169e-47 |
MsaG017261 | MsaG028801 | 0.815649 | 1.437516e-51 | 2.824938e-49 |
MsaG017261 | MsaG028813 | 0.835139 | 3.638058e-56 | 1.223691e-53 |
MsaG017261 | MsaG028842 | 0.814877 | 2.129519e-51 | 4.103843e-49 |
MsaG017261 | MsaG028830 | 0.866347 | 6.114779e-65 | 6.097062e-62 |
MsaG017261 | MsaG028950 | 0.835654 | 2.700173e-56 | 9.223305e-54 |
MsaG017261 | MsaG028927 | 0.829524 | 8.807487e-55 | 2.514376e-52 |
MsaG017261 | MsaG028985 | 0.842041 | 6.119758e-58 | 2.548336e-55 |
MsaG017261 | MsaG029174 | 0.806658 | 1.253584e-49 | 1.975912e-47 |
MsaG017261 | MsaG029236 | 0.848247 | 1.309854e-59 | 6.688319e-57 |
MsaG017261 | MsaG029313 | 0.816356 | 1.001312e-51 | 2.003397e-49 |
MsaG017261 | MsaG029314 | 0.827943 | 2.114450e-54 | 5.773057e-52 |
MsaG017261 | MsaG029332 | 0.810773 | 1.670483e-50 | 2.907020e-48 |
MsaG017261 | MsaG029443 | 0.855070 | 1.560306e-61 | 1.010533e-58 |
MsaG017261 | MsaG029650 | 0.831596 | 2.755239e-55 | 8.348945e-53 |
MsaG017261 | MsaG029700 | 0.860302 | 4.465865e-63 | 3.513290e-60 |
MsaG017261 | MsaG029743 | 0.801923 | 1.201596e-48 | 1.696857e-46 |
MsaG017261 | MsaG029819 | 0.875256 | 7.368222e-68 | 1.071593e-64 |
MsaG017261 | MsaG029813 | 0.887197 | 3.829045e-72 | 9.778489e-69 |
MsaG017261 | MsaG029892 | 0.871046 | 1.878621e-66 | 2.275603e-63 |
MsaG017261 | MsaG029873 | 0.809654 | 2.904500e-50 | 4.918779e-48 |
MsaG017261 | MsaG029875 | 0.814506 | 2.571718e-51 | 4.909729e-49 |
MsaG017261 | MsaG029916 | 0.856856 | 4.712703e-62 | 3.257479e-59 |
MsaG017261 | MsaG030015 | 0.856335 | 6.694814e-62 | 4.540345e-59 |
MsaG017261 | MsaG030080 | 0.847755 | 1.787417e-59 | 8.978105e-57 |
MsaG017261 | MsaG030113 | 0.818775 | 2.870068e-52 | 6.111962e-50 |
MsaG017261 | MsaG030788 | 0.883020 | 1.364318e-70 | 2.839713e-67 |
MsaG017261 | MsaG030993 | 0.850174 | 3.835011e-60 | 2.090686e-57 |
MsaG017261 | MsaG031482 | 0.854284 | 2.630082e-61 | 1.656426e-58 |
MsaG017261 | MsaG031491 | 0.833572 | 8.960086e-56 | 2.876447e-53 |
MsaG017261 | MsaG031593 | 0.814899 | 2.106078e-51 | 4.060922e-49 |
MsaG017261 | MsaG031612 | 0.830181 | 6.100251e-55 | 1.774634e-52 |
MsaG017261 | MsaG031586 | 0.844816 | 1.120344e-58 | 5.102969e-56 |
MsaG017261 | MsaG031750 | 0.844013 | 1.837932e-58 | 8.152325e-56 |
MsaG017261 | MsaG032331 | 0.823559 | 2.293228e-53 | 5.546803e-51 |
MsaG017261 | MsaG032424 | 0.832578 | 1.579185e-55 | 4.923848e-53 |
MsaG017261 | MsaG033702 | 0.828859 | 1.274483e-54 | 3.570157e-52 |
MsaG017261 | MsaG033966 | 0.807529 | 8.218083e-50 | 1.322323e-47 |
MsaG017261 | MsaG034202 | 0.813170 | 5.046814e-51 | 9.317853e-49 |
MsaG017261 | MsaG034342 | 0.834780 | 4.477103e-56 | 1.489860e-53 |
MsaG017261 | MsaG034529 | 0.827061 | 3.435397e-54 | 9.149958e-52 |
MsaG017261 | MsaG034740 | 0.804089 | 4.305208e-49 | 6.390794e-47 |
MsaG017261 | MsaG034949 | 0.832283 | 1.867398e-55 | 5.772828e-53 |
MsaG017261 | MsaG034956 | 0.807096 | 1.014117e-49 | 1.615017e-47 |
MsaG017261 | MsaG034999 | 0.822989 | 3.112083e-53 | 7.411928e-51 |
MsaG017261 | MsaG035122 | 0.803070 | 6.989184e-49 | 1.013268e-46 |
MsaG017261 | MsaG035269 | 0.822518 | 4.000200e-53 | 9.406679e-51 |
MsaG017261 | MsaG035300 | 0.858817 | 1.242188e-62 | 9.234061e-60 |
MsaG017261 | MsaG035323 | 0.835669 | 2.677217e-56 | 9.148993e-54 |
MsaG017261 | MsaG035395 | 0.858606 | 1.435001e-62 | 1.058431e-59 |
MsaG017261 | MsaG035406 | 0.804293 | 3.906849e-49 | 5.826893e-47 |
MsaG017261 | MsaG035514 | 0.835228 | 3.455231e-56 | 1.165264e-53 |
MsaG017261 | MsaG035523 | 0.822138 | 4.894911e-53 | 1.139391e-50 |
MsaG017261 | MsaG036060 | 0.819775 | 1.702693e-52 | 3.722397e-50 |
MsaG017261 | MsaG036111 | 0.827374 | 2.893213e-54 | 7.774079e-52 |
MsaG017261 | MsaG036130 | 0.832789 | 1.400907e-55 | 4.394976e-53 |
MsaG017261 | MsaG036131 | 0.818645 | 3.071342e-52 | 6.518409e-50 |
MsaG017261 | MsaG036128 | 0.820653 | 1.073925e-52 | 2.403054e-50 |
MsaG017261 | MsaG036211 | 0.851984 | 1.189720e-60 | 6.908125e-58 |
MsaG017261 | MsaG036294 | 0.816122 | 1.128932e-51 | 2.245244e-49 |
MsaG017261 | MsaG036485 | 0.821390 | 7.280562e-53 | 1.661229e-50 |
MsaG017261 | MsaG036511 | 0.822865 | 3.323642e-53 | 7.889660e-51 |
MsaG017261 | MsaG036510 | 0.810987 | 1.502206e-50 | 2.627852e-48 |
MsaG017261 | MsaG036529 | 0.861976 | 1.389046e-63 | 1.164711e-60 |
MsaG017261 | MsaG036704 | 0.887768 | 2.323943e-72 | 6.107523e-69 |
MsaG017261 | MsaG037325 | 0.806390 | 1.427198e-49 | 2.235416e-47 |
MsaG017261 | MsaG037763 | 0.839754 | 2.420373e-57 | 9.375794e-55 |
MsaG017261 | MsaG037805 | 0.841580 | 8.091974e-58 | 3.320317e-55 |
MsaG017261 | MsaG038022 | 0.824130 | 1.687497e-53 | 4.145335e-51 |
MsaG017261 | MsaG038100 | 0.808440 | 5.268697e-50 | 8.665314e-48 |
MsaG017261 | MsaG039280 | 0.864841 | 1.815575e-64 | 1.704536e-61 |
MsaG017261 | MsaG039325 | 0.817106 | 6.809562e-52 | 1.388992e-49 |
MsaG017261 | MsaG039591 | 0.807570 | 8.053177e-50 | 1.297049e-47 |
MsaG017261 | MsaG040443 | 0.811643 | 1.084015e-50 | 1.927036e-48 |
MsaG017261 | MsaG040482 | 0.835096 | 3.730450e-56 | 1.253170e-53 |
MsaG017261 | MsaG040599 | 0.834318 | 5.841626e-56 | 1.917239e-53 |
MsaG017261 | MsaG040696 | 0.838546 | 4.961111e-57 | 1.850703e-54 |
MsaG017261 | MsaG040755 | 0.820769 | 1.010255e-52 | 2.267503e-50 |
MsaG017261 | MsaG041015 | 0.817473 | 5.634652e-52 | 1.160255e-49 |
MsaG017261 | MsaG041017 | 0.839543 | 2.745779e-57 | 1.056588e-54 |
MsaG017261 | MsaG041019 | 0.806139 | 1.611258e-49 | 2.508692e-47 |
MsaG017261 | MsaG041044 | 0.809940 | 2.522640e-50 | 4.301643e-48 |
MsaG017261 | MsaG041117 | 0.848080 | 1.456136e-59 | 7.394158e-57 |
MsaG017261 | MsaG041171 | 0.804641 | 3.307419e-49 | 4.972611e-47 |
MsaG017261 | MsaG041230 | 0.810994 | 1.497400e-50 | 2.619836e-48 |
MsaG017261 | MsaG041280 | 0.835810 | 2.466876e-56 | 8.465712e-54 |
MsaG017261 | MsaG041392 | 0.838037 | 6.700514e-57 | 2.460296e-54 |
MsaG017261 | MsaG041770 | 0.833234 | 1.086660e-55 | 3.454240e-53 |
MsaG017261 | MsaG041807 | 0.814889 | 2.116863e-51 | 4.080669e-49 |
MsaG017261 | MsaG042225 | 0.864426 | 2.445410e-64 | 2.258042e-61 |
MsaG017261 | MsaG042323 | 0.881124 | 6.601447e-70 | 1.255401e-66 |
MsaG017261 | MsaG042972 | 0.894909 | 3.552356e-75 | 1.361433e-71 |
MsaG017261 | MsaG042981 | 0.871472 | 1.361401e-66 | 1.679256e-63 |
MsaG017261 | MsaG043344 | 0.822643 | 3.743159e-53 | 8.831946e-51 |
MsaG017261 | MsaG044108 | 0.818528 | 3.262644e-52 | 6.903509e-50 |
MsaG017261 | MsaG044219 | 0.815011 | 1.989869e-51 | 3.847702e-49 |
MsaG017261 | MsaG044317 | 0.862253 | 1.142865e-63 | 9.686348e-61 |
MsaG017261 | MsaG044324 | 0.838388 | 5.446514e-57 | 2.021623e-54 |
MsaG017261 | MsaG044331 | 0.820623 | 1.090746e-52 | 2.438789e-50 |
MsaG017261 | MsaG044473 | 0.826183 | 5.550619e-54 | 1.442752e-51 |
MsaG017261 | MsaG044570 | 0.801497 | 1.467681e-48 | 2.052645e-46 |
MsaG017261 | MsaG044707 | 0.824149 | 1.670761e-53 | 4.106218e-51 |
MsaG017261 | MsaG044867 | 0.826683 | 4.223587e-54 | 1.113205e-51 |
MsaG017261 | MsaG044884 | 0.858927 | 1.152088e-62 | 8.599844e-60 |
MsaG017261 | MsaG045111 | 0.831733 | 2.549599e-55 | 7.757521e-53 |
MsaG017261 | MsaG045116 | 0.860135 | 5.011575e-63 | 3.917066e-60 |
MsaG017261 | MsaG045242 | 0.801446 | 1.503330e-48 | 2.100093e-46 |
MsaG017261 | MsaG045254 | 0.827443 | 2.785598e-54 | 7.499234e-52 |
MsaG017261 | MsaG045309 | 0.841750 | 7.302569e-58 | 3.012471e-55 |
MsaG017261 | MsaG045261 | 0.830474 | 5.178479e-55 | 1.519029e-52 |
MsaG017261 | MsaG045283 | 0.859592 | 7.293051e-63 | 5.583139e-60 |
MsaG017261 | MsaG045320 | 0.854888 | 1.761450e-61 | 1.133401e-58 |
MsaG017261 | MsaG045359 | 0.803039 | 7.091921e-49 | 1.027432e-46 |
MsaG017261 | MsaG045515 | 0.871841 | 1.028508e-66 | 1.288994e-63 |
MsaG017261 | MsaG045521 | 0.811844 | 9.806021e-51 | 1.751858e-48 |
MsaG017261 | MsaG045550 | 0.844614 | 1.269534e-58 | 5.743856e-56 |
MsaG017261 | MsaG045551 | 0.839569 | 2.702481e-57 | 1.040783e-54 |
MsaG017261 | MsaG045582 | 0.808429 | 5.297485e-50 | 8.710366e-48 |
MsaG017261 | MsaG045589 | 0.874879 | 9.893995e-68 | 1.415435e-64 |
MsaG017261 | MsaG045753 | 0.812119 | 8.548186e-51 | 1.537447e-48 |
MsaG017261 | MsaG045748 | 0.822141 | 4.888507e-53 | 1.137978e-50 |
MsaG017261 | MsaG045766 | 0.833781 | 7.948102e-56 | 2.567276e-53 |
MsaG017261 | MsaG045806 | 0.834331 | 5.796853e-56 | 1.903368e-53 |
MsaG017261 | MsaG045861 | 0.839569 | 2.702481e-57 | 1.040783e-54 |
MsaG017261 | MsaG045868 | 0.835182 | 3.548798e-56 | 1.195176e-53 |
MsaG017261 | MsaG045883 | 0.834149 | 6.435979e-56 | 2.101531e-53 |
MsaG017261 | MsaG045903 | 0.828975 | 1.195068e-54 | 3.358594e-52 |
MsaG017261 | MsaG046223 | 0.853573 | 4.204113e-61 | 2.581116e-58 |
MsaG017261 | MsaG046177 | 0.868914 | 9.276278e-66 | 1.027291e-62 |
MsaG017261 | MsaG046181 | 0.842237 | 5.435745e-58 | 2.277441e-55 |
MsaG017261 | MsaG046263 | 0.877278 | 1.492189e-68 | 2.376161e-65 |
MsaG017261 | MsaG046380 | 0.803113 | 6.845827e-49 | 9.935106e-47 |
MsaG017261 | MsaG046526 | 0.818033 | 4.217713e-52 | 8.810989e-50 |
MsaG017261 | MsaG046532 | 0.812547 | 6.900377e-51 | 1.254400e-48 |
MsaG017261 | MsaG046480 | 0.859240 | 9.293328e-63 | 7.020367e-60 |
MsaG017261 | MsaG046492 | 0.864144 | 2.991410e-64 | 2.731373e-61 |
MsaG017261 | MsaG046804 | 0.804985 | 2.806182e-49 | 4.252796e-47 |
MsaG017261 | MsaG046948 | 0.826188 | 5.535531e-54 | 1.439023e-51 |
MsaG017261 | MsaG046955 | 0.831155 | 3.531277e-55 | 1.056368e-52 |
MsaG017261 | MsaG047001 | 0.828232 | 1.803012e-54 | 4.962730e-52 |
MsaG017261 | MsaG002505 | 0.897559 | 2.842937e-76 | 1.263872e-72 |
MsaG017261 | MsaG003008 | 0.872855 | 4.738914e-67 | 6.203864e-64 |
MsaG017261 | MsaG001553 | 0.817790 | 4.784196e-52 | 9.931682e-50 |
MsaG017261 | MsaG001256 | 0.841953 | 6.455437e-58 | 2.680580e-55 |
MsaG017261 | MsaG001632 | 0.904257 | 3.481309e-79 | 2.293672e-75 |
MsaG017261 | MsaG002372 | 0.806859 | 1.137580e-49 | 1.801523e-47 |
MsaG017261 | MsaG002683 | 0.873889 | 2.135999e-67 | 2.925905e-64 |
MsaG017261 | MsaG001709 | 0.800691 | 2.141280e-48 | 2.940771e-46 |
MsaG017261 | MsaG001311 | 0.855799 | 9.591123e-62 | 6.377721e-59 |
MsaG017261 | MsaG004869 | 0.806279 | 1.505897e-49 | 2.352522e-47 |
MsaG017261 | MsaG003314 | 0.807995 | 6.549357e-50 | 1.065700e-47 |
MsaG017261 | MsaG001683 | 0.850674 | 2.779162e-60 | 1.541608e-57 |
MsaG017261 | MsaG002115 | 0.849088 | 7.679515e-60 | 4.034855e-57 |
MsaG017261 | MsaG002708 | 0.802644 | 8.550787e-49 | 1.227598e-46 |
MsaG017261 | MsaG002776 | 0.830195 | 6.054885e-55 | 1.762123e-52 |
MsaG017261 | MsaG002551 | 0.838260 | 5.875242e-57 | 2.172143e-54 |
MsaG017261 | MsaG002387 | 0.801264 | 1.637347e-48 | 2.277837e-46 |
MsaG017261 | MsaG001614 | 0.861837 | 1.531282e-63 | 1.276949e-60 |
MsaG017261 | MsaG007925 | 0.808415 | 5.334440e-50 | 8.768027e-48 |
MsaG017261 | MsaG006538 | 0.887842 | 2.177693e-72 | 5.745768e-69 |
MsaG017261 | MsaG008213 | 0.839064 | 3.651066e-57 | 1.384198e-54 |
MsaG017261 | MsaG007899 | 0.820310 | 1.285926e-52 | 2.851643e-50 |
MsaG017261 | MsaG011523 | 0.816788 | 8.018531e-52 | 1.622218e-49 |
MsaG017261 | MsaG014171 | 0.851082 | 2.135899e-60 | 1.201596e-57 |
MsaG017261 | MsaG013507 | 0.849947 | 4.433480e-60 | 2.398553e-57 |
MsaG017261 | MsaG013383 | 0.850320 | 3.491198e-60 | 1.912785e-57 |
MsaG017261 | MsaG012862 | 0.803721 | 5.129586e-49 | 7.549652e-47 |
MsaG017261 | MsaG013255 | 0.873863 | 2.180352e-67 | 2.983211e-64 |
MsaG017261 | MsaG013813 | 0.825261 | 9.161384e-54 | 2.321138e-51 |
MsaG017261 | MsaG013040 | 0.806122 | 1.624003e-49 | 2.527545e-47 |
MsaG017261 | MsaG011720 | 0.877938 | 8.803543e-69 | 1.444716e-65 |
MsaG017261 | MsaG014174 | 0.847731 | 1.815000e-59 | 9.109085e-57 |
MsaG017261 | MsaG018733 | 0.802436 | 9.430674e-49 | 1.347508e-46 |
MsaG017261 | MsaG019459 | 0.833900 | 7.424942e-56 | 2.406650e-53 |
MsaG017261 | MsaG019026 | 0.841909 | 6.632588e-58 | 2.750289e-55 |
MsaG017261 | MsaG019481 | 0.813214 | 4.937203e-51 | 9.125546e-49 |
MsaG017261 | MsaG019334 | 0.820837 | 9.748458e-53 | 2.191916e-50 |
MsaG017261 | MsaG020251 | 0.822370 | 4.328579e-53 | 1.013855e-50 |
MsaG017261 | MsaG019999 | 0.801982 | 1.168322e-48 | 1.652104e-46 |
MsaG017261 | MsaG027071 | 0.920801 | 2.074654e-87 | 4.144632e-83 |
MsaG017261 | MsaG026791 | 0.867608 | 2.433303e-65 | 2.554473e-62 |
MsaG017261 | MsaG026810 | 0.866179 | 6.908532e-65 | 6.843196e-62 |
MsaG017261 | MsaG028085 | 0.826483 | 4.712019e-54 | 1.235071e-51 |
MsaG017261 | MsaG027837 | 0.858314 | 1.752488e-62 | 1.278547e-59 |
MsaG017261 | MsaG026155 | 0.809302 | 3.454167e-50 | 5.799805e-48 |
MsaG017261 | MsaG027119 | 0.818389 | 3.507174e-52 | 7.394257e-50 |
MsaG017261 | MsaG027196 | 0.814660 | 2.377791e-51 | 4.557135e-49 |
MsaG017261 | MsaG026351 | 0.827138 | 3.293258e-54 | 8.790547e-52 |
MsaG017261 | MsaG032588 | 0.820847 | 9.696086e-53 | 2.180726e-50 |
MsaG017261 | MsaG031608 | 0.858130 | 1.986731e-62 | 1.439438e-59 |
MsaG017261 | MsaG034393 | 0.838979 | 3.838414e-57 | 1.451366e-54 |
MsaG017261 | MsaG032143 | 0.873074 | 4.007044e-67 | 5.296372e-64 |
MsaG017261 | MsaG032246 | 0.824474 | 1.402328e-53 | 3.477191e-51 |
MsaG017261 | MsaG032681 | 0.817890 | 4.543802e-52 | 9.456862e-50 |
MsaG017261 | MsaG034035 | 0.832458 | 1.690676e-55 | 5.253269e-53 |
MsaG017261 | MsaG033833 | 0.808414 | 5.336606e-50 | 8.771380e-48 |
MsaG017261 | MsaG031458 | 0.822299 | 4.493450e-53 | 1.050468e-50 |
MsaG017261 | MsaG031589 | 0.819010 | 2.539405e-52 | 5.441294e-50 |
MsaG017261 | MsaG030552 | 0.803943 | 4.615938e-49 | 6.828608e-47 |
MsaG017261 | MsaG033591 | 0.835193 | 3.527132e-56 | 1.188261e-53 |
MsaG017261 | MsaG033091 | 0.863252 | 5.642893e-64 | 4.973940e-61 |
MsaG017261 | MsaG034413 | 0.853858 | 3.484968e-61 | 2.161447e-58 |
MsaG017261 | MsaG031111 | 0.836136 | 2.041084e-56 | 7.073827e-54 |
MsaG017261 | MsaG033667 | 0.805373 | 2.329198e-49 | 3.561909e-47 |
MsaG017261 | MsaG034268 | 0.829738 | 7.814383e-55 | 2.244616e-52 |
MsaG017261 | MsaG030868 | 0.832398 | 1.749458e-55 | 5.426131e-53 |
MsaG017261 | MsaG034266 | 0.892976 | 2.148993e-74 | 7.418306e-71 |
MsaG017261 | MsaG031897 | 0.869478 | 6.099718e-66 | 6.915385e-63 |
MsaG017261 | MsaG031245 | 0.809759 | 2.757751e-50 | 4.682151e-48 |
MsaG017261 | MsaG030261 | 0.812580 | 6.786814e-51 | 1.234765e-48 |
MsaG017261 | MsaG032837 | 0.805282 | 2.432873e-49 | 3.712525e-47 |
MsaG017261 | MsaG030876 | 0.801898 | 1.215493e-48 | 1.715561e-46 |
MsaG017261 | MsaG036258 | 0.806570 | 1.308456e-49 | 2.058173e-47 |
MsaG017261 | MsaG039769 | 0.821692 | 6.202285e-53 | 1.426635e-50 |
MsaG017261 | MsaG040050 | 0.857279 | 3.542170e-62 | 2.486630e-59 |
MsaG017261 | MsaG037255 | 0.851558 | 1.569656e-60 | 8.976642e-58 |
MsaG017261 | MsaG037000 | 0.805672 | 2.017452e-49 | 3.106752e-47 |
MsaG017261 | MsaG036566 | 0.830222 | 5.962304e-55 | 1.736525e-52 |
MsaG017261 | MsaG034916 | 0.839267 | 3.236035e-57 | 1.234541e-54 |
MsaG017261 | MsaG037652 | 0.855939 | 8.735797e-62 | 5.838515e-59 |
MsaG017261 | MsaG039370 | 0.810560 | 1.857106e-50 | 3.214940e-48 |
MsaG017261 | MsaG035337 | 0.846400 | 4.187866e-59 | 2.009912e-56 |
MsaG017261 | MsaG037437 | 0.823527 | 2.332829e-53 | 5.637570e-51 |
MsaG017261 | MsaG036891 | 0.817361 | 5.971729e-52 | 1.226087e-49 |
MsaG017261 | MsaG037837 | 0.831758 | 2.513926e-55 | 7.654453e-53 |
MsaG017261 | MsaG037532 | 0.855496 | 1.174306e-61 | 7.724134e-59 |
MsaG017261 | MsaG036656 | 0.867671 | 2.323280e-65 | 2.445297e-62 |
MsaG017261 | MsaG037829 | 0.827550 | 2.626011e-54 | 7.091153e-52 |
MsaG017261 | MsaG038148 | 0.819292 | 2.192562e-52 | 4.733160e-50 |
MsaG017261 | MsaG036311 | 0.817907 | 4.504078e-52 | 9.378291e-50 |
MsaG017261 | MsaG041722 | 0.837026 | 1.213758e-56 | 4.320832e-54 |
MsaG017261 | MsaG043789 | 0.823106 | 2.923439e-53 | 6.984530e-51 |
MsaG017261 | MsaG043527 | 0.878668 | 4.893453e-69 | 8.304873e-66 |
MsaG017261 | MsaG042308 | 0.849463 | 6.043298e-60 | 3.216309e-57 |
MsaG017261 | MsaG042389 | 0.883030 | 1.352397e-70 | 2.816416e-67 |
MsaG017261 | MsaG042526 | 0.873328 | 3.295110e-67 | 4.403476e-64 |
MsaG017261 | MsaG045902 | 0.811228 | 1.333173e-50 | 2.345959e-48 |
MsaG017261 | MsaG041132 | 0.825370 | 8.634189e-54 | 2.194185e-51 |
MsaG017261 | MsaG042307 | 0.800701 | 2.131228e-48 | 2.927621e-46 |
MsaG017261 | MsaG044409 | 0.826422 | 4.873185e-54 | 1.275121e-51 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG017261 | MtrunA17_Chr3g0138411 | 95.771 | 1206 | 44 | 1 | 1 | 1199 | 1 | 1206 | 0.0 | 2407 |
MsaG017261 | MtrunA17_Chr3g0133461 | 67.028 | 1107 | 265 | 17 | 181 | 1199 | 249 | 1343 | 0.0 | 1436 |
MsaG017261 | MtrunA17_Chr3g0133461 | 38.889 | 432 | 192 | 10 | 69 | 454 | 16 | 421 | 5.59e-61 | 229 |
MsaG017261 | MtrunA17_Chr5g0438991 | 66.024 | 986 | 209 | 12 | 233 | 1183 | 64 | 958 | 0.0 | 1273 |
MsaG017261 | MtrunA17_Chr6g0456861 | 70.552 | 815 | 173 | 10 | 381 | 1192 | 22 | 772 | 0.0 | 1166 |
MsaG017261 | MtrunA17_Chr4g0000031 | 48.039 | 816 | 391 | 10 | 396 | 1191 | 893 | 1695 | 0.0 | 787 |
MsaG017261 | MtrunA17_Chr6g0456851 | 48.472 | 916 | 364 | 22 | 15 | 906 | 2 | 833 | 0.0 | 773 |
MsaG017261 | MtrunA17_Chr6g0456851 | 62.667 | 75 | 28 | 0 | 948 | 1022 | 807 | 881 | 1.35e-20 | 98.6 |
MsaG017261 | MtrunA17_Chr6g0456931 | 72.385 | 239 | 66 | 0 | 615 | 853 | 1 | 239 | 8.91e-124 | 381 |
MsaG017261 | MtrunA17_Chr5g0401991 | 58.781 | 279 | 53 | 6 | 844 | 1118 | 1 | 221 | 5.32e-91 | 291 |
MsaG017261 | MtrunA17_Chr5g0402001 | 91.089 | 101 | 9 | 0 | 693 | 793 | 1 | 101 | 4.93e-59 | 197 |
MsaG017261 | MtrunA17_Chr1g0169961 | 68.696 | 115 | 35 | 1 | 388 | 502 | 55 | 168 | 4.98e-46 | 163 |
MsaG017261 | MtrunA17_Chr5g0439001 | 68.687 | 99 | 26 | 2 | 795 | 893 | 1 | 94 | 1.07e-36 | 134 |
MsaG017261 | MtrunA17_Chr6g0456921 | 49.057 | 159 | 21 | 6 | 693 | 849 | 1 | 101 | 6.56e-32 | 127 |
MsaG017261 | MtrunA17_Chr6g0456911 | 78.182 | 55 | 12 | 0 | 960 | 1014 | 6 | 60 | 3.93e-23 | 94.4 |
MsaG017261 | MtrunA17_Chr0c02g0489811 | 77.193 | 57 | 13 | 0 | 958 | 1014 | 5 | 61 | 8.22e-23 | 93.6 |
MsaG017261 | MtrunA17_Chr7g0229221 | 73.684 | 57 | 15 | 0 | 958 | 1014 | 5 | 61 | 1.78e-21 | 89.7 |
MsaG017261 | MtrunA17_Chr0c02g0489721 | 78.723 | 47 | 10 | 0 | 888 | 934 | 1 | 47 | 8.50e-21 | 86.7 |
MsaG017261 | MtrunA17_Chr7g0229231 | 78.723 | 47 | 10 | 0 | 888 | 934 | 1 | 47 | 8.50e-21 | 86.7 |
MsaG017261 | MtrunA17_Chr0c02g0489731 | 70.175 | 57 | 17 | 0 | 958 | 1014 | 5 | 61 | 5.32e-20 | 85.5 |
MsaG017261 | MtrunA17_Chr0c02g0489821 | 80.000 | 45 | 9 | 0 | 890 | 934 | 1 | 45 | 6.98e-20 | 84.0 |
MsaG017261 | MtrunA17_Chr6g0456781 | 50.704 | 71 | 27 | 2 | 474 | 544 | 25 | 87 | 1.33e-13 | 69.3 |
MsaG017261 | MtrunA17_Chr5g0402011 | 90.323 | 31 | 3 | 0 | 539 | 569 | 21 | 51 | 1.70e-13 | 67.0 |
MsaG017261 | MtrunA17_Chr5g0401281 | 40.741 | 81 | 46 | 2 | 1112 | 1191 | 279 | 358 | 4.32e-12 | 69.3 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG017261 | AT1G79000.1 | 46.420 | 866 | 420 | 12 | 356 | 1191 | 832 | 1683 | 0.0 | 800 |
MsaG017261 | AT1G79000.2 | 46.420 | 866 | 420 | 12 | 356 | 1191 | 832 | 1683 | 0.0 | 800 |
MsaG017261 | AT1G79000.3 | 46.420 | 866 | 420 | 12 | 356 | 1191 | 808 | 1659 | 0.0 | 800 |
MsaG017261 | AT1G16710.2 | 47.741 | 819 | 393 | 10 | 393 | 1191 | 860 | 1663 | 0.0 | 783 |
MsaG017261 | AT1G16710.3 | 47.741 | 819 | 393 | 10 | 393 | 1191 | 863 | 1666 | 0.0 | 783 |
MsaG017261 | AT1G16710.10 | 47.741 | 819 | 393 | 10 | 393 | 1191 | 863 | 1666 | 0.0 | 783 |
MsaG017261 | AT1G16710.8 | 47.741 | 819 | 393 | 10 | 393 | 1191 | 863 | 1666 | 0.0 | 783 |
MsaG017261 | AT1G16710.7 | 47.741 | 819 | 393 | 10 | 393 | 1191 | 863 | 1666 | 0.0 | 783 |
MsaG017261 | AT1G16710.6 | 47.741 | 819 | 393 | 10 | 393 | 1191 | 824 | 1627 | 0.0 | 783 |
MsaG017261 | AT1G16710.4 | 47.741 | 819 | 393 | 10 | 393 | 1191 | 824 | 1627 | 0.0 | 783 |
MsaG017261 | AT1G16710.1 | 47.741 | 819 | 393 | 10 | 393 | 1191 | 889 | 1692 | 0.0 | 783 |
MsaG017261 | AT1G16710.5 | 47.741 | 819 | 393 | 10 | 393 | 1191 | 824 | 1627 | 0.0 | 783 |
MsaG017261 | AT3G12980.1 | 46.903 | 791 | 385 | 12 | 418 | 1191 | 883 | 1655 | 0.0 | 754 |
MsaG017261 | AT3G12980.2 | 46.903 | 791 | 385 | 12 | 418 | 1191 | 802 | 1574 | 0.0 | 753 |
MsaG017261 | AT1G55970.1 | 43.056 | 792 | 422 | 10 | 418 | 1191 | 677 | 1457 | 0.0 | 663 |
MsaG017261 | AT1G55970.2 | 43.434 | 792 | 405 | 12 | 418 | 1191 | 677 | 1443 | 0.0 | 660 |
MsaG017261 | AT1G67220.1 | 42.072 | 782 | 400 | 20 | 420 | 1172 | 604 | 1361 | 0.0 | 611 |
MsaG017261 | AT1G16710.9 | 50.089 | 561 | 266 | 5 | 393 | 944 | 863 | 1418 | 0.0 | 580 |
MsaG017261 | AT5G67480.1 | 42.308 | 78 | 43 | 2 | 1110 | 1185 | 271 | 348 | 4.93e-12 | 69.7 |
MsaG017261 | AT5G67480.3 | 42.308 | 78 | 43 | 2 | 1110 | 1185 | 271 | 348 | 4.93e-12 | 69.7 |
MsaG017261 | AT5G67480.2 | 42.308 | 78 | 43 | 2 | 1110 | 1185 | 282 | 359 | 5.06e-12 | 69.7 |
Find 233 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
ACAGCCTCAATTATTGTATT+TGG | 0.083119 | 3:-107410801 | None:intergenic |
TTCTTTGTTCCTACTGAAAA+AGG | 0.108559 | 3:+107412912 | MsaT017261.1:CDS |
CTGAACTTGGTGGGAATATT+TGG | 0.140434 | 3:+107409148 | MsaT017261.1:CDS |
TTACCAAAAGCTGCTAATTT+TGG | 0.160765 | 3:+107411771 | MsaT017261.1:CDS |
TCAACACCACTATGTCAATT+TGG | 0.177074 | 3:+107414111 | MsaT017261.1:CDS |
GAAAGTGAATAAGCTGTTTC+TGG | 0.192097 | 3:+107412073 | MsaT017261.1:CDS |
GGCAGGTCATGAACAATAAA+AGG | 0.212094 | 3:-107409763 | None:intergenic |
CACTGAATGCAAGAAATTTC+AGG | 0.225944 | 3:+107413446 | MsaT017261.1:CDS |
CAGCCTCAATTATTGTATTT+GGG | 0.232255 | 3:-107410800 | None:intergenic |
CCCTGGTAGGCAATATCTTT+TGG | 0.238306 | 3:-107413344 | None:intergenic |
CCAGAGTAGGGTTGTTTAAA+TGG | 0.239132 | 3:-107413918 | None:intergenic |
AGAGTGGATTATTTGAAAAT+AGG | 0.257666 | 3:+107413809 | MsaT017261.1:CDS |
TGACGGTTGTATGTCATTTC+GGG | 0.258908 | 3:-107409294 | None:intergenic |
TTCCGAGTCTTTGCAATTCC+TGG | 0.259668 | 3:-107414430 | None:intergenic |
AACTCATAGACTCGTTATTC+TGG | 0.278374 | 3:-107410140 | None:intergenic |
GTGACGGTTGTATGTCATTT+CGG | 0.290972 | 3:-107409295 | None:intergenic |
TTTGAGTCAACTTGTGTTCA+TGG | 0.292920 | 3:-107414062 | None:intergenic |
GTCAAAACAGAGAGATTGTT+TGG | 0.293545 | 3:+107410110 | MsaT017261.1:intron |
ATGGTCTTTAAAGCTCTATT+TGG | 0.306293 | 3:-107413068 | None:intergenic |
CTACAACAACAAAAGAGATT+TGG | 0.312602 | 3:+107411680 | MsaT017261.1:CDS |
ACAACTGATGAAGAATTTCT+TGG | 0.316401 | 3:-107409180 | None:intergenic |
GCACCAAAATTAGCAGCTTT+TGG | 0.316485 | 3:-107411774 | None:intergenic |
CTTTGTTTACCATGAGATAT+TGG | 0.319700 | 3:+107412427 | MsaT017261.1:CDS |
TCTGATGCCGCTGGTTATTA+TGG | 0.320032 | 3:+107409715 | MsaT017261.1:CDS |
ATATCCGCTGAAACAAGTTT+AGG | 0.321167 | 3:-107410216 | None:intergenic |
ACTTGTTTCAGCGGATATTT+CGG | 0.322049 | 3:+107410221 | MsaT017261.1:CDS |
CCACTCTTTGTTCTTCTCTC+AGG | 0.324213 | 3:-107412389 | None:intergenic |
TCTCGTTTGCCATACTTTGA+TGG | 0.326312 | 3:+107412954 | MsaT017261.1:CDS |
TTGCATCACCAGAATGTCTT+TGG | 0.327789 | 3:-107413120 | None:intergenic |
GTTTCTCAACTTGCTACATA+TGG | 0.336552 | 3:+107412569 | MsaT017261.1:CDS |
CATTTGCTCTGCTTGCTATA+AGG | 0.336680 | 3:+107414023 | MsaT017261.1:CDS |
CACGAGTTCATGCTTAGAAT+TGG | 0.340621 | 3:+107410266 | MsaT017261.1:CDS |
CGCATTCGGAGCCGAACTCC+TGG | 0.358494 | 3:-107412307 | None:intergenic |
GGGTCAGATAGTCTCCCTTC+TGG | 0.359944 | 3:-107409742 | None:intergenic |
GGAATGTACGCCCAGGAGTT+CGG | 0.366380 | 3:+107412296 | MsaT017261.1:CDS |
TCTTTGGCAGTGTCTTTAGA+AGG | 0.367904 | 3:-107413104 | None:intergenic |
CAACACCACTATGTCAATTT+GGG | 0.370714 | 3:+107414112 | MsaT017261.1:CDS |
GGTGGGAAAATTACATTCAA+TGG | 0.372058 | 3:+107411460 | MsaT017261.1:CDS |
CTTGCGAAGGGTTCTGAACT+TGG | 0.374398 | 3:+107409135 | MsaT017261.1:CDS |
CAAACTGAAATTGATACTTC+TGG | 0.380328 | 3:-107413852 | None:intergenic |
ATGTGTACACAACGCTGATT+TGG | 0.380704 | 3:-107412335 | None:intergenic |
AGACACTGCCAAAGACATTC+TGG | 0.381560 | 3:+107413112 | MsaT017261.1:CDS |
ACTGAAGAAAATATTATTGT+TGG | 0.383324 | 3:+107412867 | MsaT017261.1:CDS |
TGCTTAGAATTGGAAGATAC+AGG | 0.390600 | 3:+107410276 | MsaT017261.1:CDS |
CATGTTGTGGCGTACGCATC+AGG | 0.393034 | 3:+107411359 | MsaT017261.1:CDS |
TCTTGATCTATAAGAGAATT+CGG | 0.393830 | 3:-107412123 | None:intergenic |
TGCCATGAAGTGATAGCATC+TGG | 0.393848 | 3:+107413408 | MsaT017261.1:CDS |
GGCAGTGTCTTTAGAAGGAT+TGG | 0.396884 | 3:-107413099 | None:intergenic |
TATCCGCTGAAACAAGTTTA+GGG | 0.397186 | 3:-107410215 | None:intergenic |
CTTCTGTTTCAGCAGATTGA+AGG | 0.398990 | 3:+107412254 | MsaT017261.1:CDS |
CTGATTTGGATTGCCGCATT+CGG | 0.399351 | 3:-107412321 | None:intergenic |
AAAATAGTTGCTACTTGATC+TGG | 0.400825 | 3:-107409887 | None:intergenic |
GGTGCAAAATTCGAGTAAAT+CGG | 0.403532 | 3:+107414361 | MsaT017261.1:CDS |
TCCCAGATGCTATCACTTCA+TGG | 0.404024 | 3:-107413410 | None:intergenic |
GAGGACATACAAGGCAGAAC+TGG | 0.410877 | 3:+107410621 | MsaT017261.1:CDS |
GTGGGAAAATTACATTCAAT+GGG | 0.411726 | 3:+107411461 | MsaT017261.1:CDS |
CGTAACTTACCCGTTTCATA+TGG | 0.413182 | 3:+107409841 | MsaT017261.1:CDS |
CTGCCTTGCTCTCCTGATGA+TGG | 0.413683 | 3:+107409781 | MsaT017261.1:CDS |
AATGTAGAATACCACGTTGC+AGG | 0.414844 | 3:+107414451 | MsaT017261.1:CDS |
TTCATATGGTGGAAGCAATC+TGG | 0.416270 | 3:+107409855 | MsaT017261.1:CDS |
TCTGAGAAAGGAATCTGTTC+AGG | 0.416816 | 3:+107410875 | MsaT017261.1:CDS |
CAGTAGTCTCCATCAAAGTA+TGG | 0.418646 | 3:-107412963 | None:intergenic |
CCCTCGAAAGGCTTAGAATC+TGG | 0.419221 | 3:+107410516 | MsaT017261.1:CDS |
TCAAAACAGAGAGATTGTTT+GGG | 0.419623 | 3:+107410111 | MsaT017261.1:intron |
GCCTGTGCTCCTTCAAGAAA+AGG | 0.420899 | 3:+107412592 | MsaT017261.1:CDS |
CATGGTTCTTGGCAAGTCCT+TGG | 0.422145 | 3:-107411796 | None:intergenic |
AAGCAACGCATTCCGAATCT+TGG | 0.427714 | 3:+107414681 | MsaT017261.1:CDS |
GTGCAAAATTCGAGTAAATC+GGG | 0.429183 | 3:+107414362 | MsaT017261.1:CDS |
ATGTAAATCTTCAAATTGAA+TGG | 0.432375 | 3:-107410184 | None:intergenic |
CGGCGTAGCTTATCATTCTT+CGG | 0.442591 | 3:-107412658 | None:intergenic |
TATCCCATCCTGGTTGAATC+CGG | 0.446469 | 3:-107410721 | None:intergenic |
TGGTCACTGAGCATGGTTCT+TGG | 0.450291 | 3:-107411807 | None:intergenic |
TGCAGCTCCACGCCAAGATT+CGG | 0.450882 | 3:-107414693 | None:intergenic |
ACAATATATTTCAAAAGTGC+TGG | 0.451731 | 3:+107413974 | MsaT017261.1:CDS |
AAATGTGTGCATCAGAACTA+TGG | 0.452913 | 3:-107413617 | None:intergenic |
GTCTTTGCAATTCCTGGAGT+GGG | 0.453840 | 3:-107414424 | None:intergenic |
GGAAGAAGAATTTGATGCAC+AGG | 0.454851 | 3:+107411402 | MsaT017261.1:CDS |
CCTGTGCTCCTTCAAGAAAA+GGG | 0.454880 | 3:+107412593 | MsaT017261.1:CDS |
CAGTTAGAGACTATCGAGTC+TGG | 0.455443 | 3:+107410486 | MsaT017261.1:CDS |
GCAGAGCAAATGGTACATTC+TGG | 0.456546 | 3:-107414012 | None:intergenic |
AAATGACATACAACCGTCAC+TGG | 0.459682 | 3:+107409298 | MsaT017261.1:CDS |
TTCTTGATTTGAGAACAGTT+TGG | 0.463384 | 3:-107414318 | None:intergenic |
CACACACATATCAGCAAGTA+GGG | 0.463928 | 3:-107409815 | None:intergenic |
TTCTAAGTGGTCACTGAGCA+TGG | 0.465266 | 3:-107411814 | None:intergenic |
CTACTGGTGTGGTTATGTTA+TGG | 0.465543 | 3:+107412980 | MsaT017261.1:CDS |
TGTTCTGAAAATCCAACTCC+TGG | 0.467769 | 3:-107410311 | None:intergenic |
GTAGTAATAATTCCAGCATA+GGG | 0.468557 | 3:-107409470 | None:intergenic |
ATGGACTTTCCCATTGAAGT+AGG | 0.469146 | 3:-107410165 | None:intergenic |
ACTTACCACTGCTGCTTCAA+AGG | 0.469361 | 3:+107409491 | MsaT017261.1:CDS |
CATCATCAGGAGAGCAAGGC+AGG | 0.473198 | 3:-107409780 | None:intergenic |
TGAGCAATTTGCCCCTATGC+TGG | 0.473268 | 3:+107409458 | MsaT017261.1:CDS |
TAGGGTTGTTTAAATGGTAG+AGG | 0.474232 | 3:-107413912 | None:intergenic |
AACCCTACTCTGGTGACTGT+TGG | 0.474451 | 3:+107413928 | MsaT017261.1:CDS |
GATGCACACATTTCAAAGAA+TGG | 0.475962 | 3:+107413627 | MsaT017261.1:CDS |
ATCATTATGCTTAGTGTTGG+AGG | 0.477828 | 3:-107413776 | None:intergenic |
GAAATACAGCAGAAACTCAA+TGG | 0.479828 | 3:+107410542 | MsaT017261.1:CDS |
GCGAAATAAACCCCAGGAGT+TGG | 0.480620 | 3:+107410299 | MsaT017261.1:CDS |
GAGGACATTCAAGGCAGAAC+CGG | 0.485084 | 3:+107410702 | MsaT017261.1:CDS |
TTATGGAAGAGAGAGCAAAC+TGG | 0.486815 | 3:+107411856 | MsaT017261.1:CDS |
TTTCTCAACTTGCTACATAT+GGG | 0.487718 | 3:+107412570 | MsaT017261.1:CDS |
TACGCTGATTCAACGTCTCC+AGG | 0.490165 | 3:-107409666 | None:intergenic |
TCATTATTTGCGTGTTTCAA+AGG | 0.492280 | 3:-107409910 | None:intergenic |
GATATCATTATGCTTAGTGT+TGG | 0.494216 | 3:-107413779 | None:intergenic |
GCCAAAAGATATTGCCTACC+AGG | 0.497791 | 3:+107413343 | MsaT017261.1:CDS |
CGAGGTGCATACACTATGTC+AGG | 0.500355 | 3:+107413650 | MsaT017261.1:CDS |
GATCTATAAGAGAATTCGGC+AGG | 0.501906 | 3:-107412119 | None:intergenic |
CTTATAGCAAGCAGAGCAAA+TGG | 0.504219 | 3:-107414022 | None:intergenic |
AGAACTGGATTCATCCAGGC+GGG | 0.506173 | 3:+107410636 | MsaT017261.1:CDS |
TCGTGAGTCAAATGAGAAAA+CGG | 0.506997 | 3:+107414137 | MsaT017261.1:CDS |
TTATACTAACTGCCCACTCC+AGG | 0.508191 | 3:+107414412 | MsaT017261.1:CDS |
CACGCAGATGCTGAAACTGC+TGG | 0.511708 | 3:+107414239 | MsaT017261.1:intron |
AGAACTTATTATTGTTCATG+AGG | 0.512614 | 3:+107410674 | MsaT017261.1:CDS |
GGGGTTGATGAACCATCATC+AGG | 0.513452 | 3:-107409793 | None:intergenic |
CGAAGGGTTCTGAACTTGGT+GGG | 0.514839 | 3:+107409139 | MsaT017261.1:CDS |
AGTAGTAATAATTCCAGCAT+AGG | 0.515149 | 3:-107409471 | None:intergenic |
GTTATAAGAATTCTAAAGGT+GGG | 0.515230 | 3:+107411443 | MsaT017261.1:CDS |
GGTTATTATGGCGTTCCAGA+AGG | 0.515241 | 3:+107409727 | MsaT017261.1:CDS |
GCCAGATTCTAAGCCTTTCG+AGG | 0.516084 | 3:-107410517 | None:intergenic |
GATCATCATTGATGAATACT+TGG | 0.516147 | 3:-107413890 | None:intergenic |
TTGCTTCCACCATATGAAAC+GGG | 0.517072 | 3:-107409850 | None:intergenic |
ACATATTAGTAGTCTGAGAA+AGG | 0.521580 | 3:+107410863 | MsaT017261.1:CDS |
CAGTCCGTGGAGAATCCTAC+TGG | 0.523094 | 3:-107409261 | None:intergenic |
ATTGCTTCCACCATATGAAA+CGG | 0.523926 | 3:-107409851 | None:intergenic |
AGCCTCAATTATTGTATTTG+GGG | 0.527381 | 3:-107410799 | None:intergenic |
ATCCCCAAATACAATAATTG+AGG | 0.528154 | 3:+107410797 | MsaT017261.1:CDS |
CTCCAGGAATTGCAAAGACT+CGG | 0.528433 | 3:+107414428 | MsaT017261.1:CDS |
AGAAATTTCAGGAGTGTGAA+AGG | 0.528641 | 3:+107413457 | MsaT017261.1:CDS |
TTCCAACAGTCACCAGAGTA+GGG | 0.530507 | 3:-107413930 | None:intergenic |
GAACTTATTATTGTTCATGA+GGG | 0.530986 | 3:+107410675 | MsaT017261.1:CDS |
TGGATTACTTACATGTGGAC+TGG | 0.532864 | 3:-107409241 | None:intergenic |
GTTTCTAAGTCTGATGCCGC+TGG | 0.533231 | 3:+107409706 | MsaT017261.1:CDS |
AACTTACCCGTTTCATATGG+TGG | 0.534858 | 3:+107409844 | MsaT017261.1:CDS |
ATTACATCTGAGGAGGAAGC+AGG | 0.535806 | 3:+107411265 | MsaT017261.1:CDS |
TTTCCAACAGTCACCAGAGT+AGG | 0.537493 | 3:-107413931 | None:intergenic |
ACGTGTGAACAAATCAATCA+AGG | 0.540321 | 3:-107410826 | None:intergenic |
TATTGTTCATGAGGGTGAAG+AGG | 0.540740 | 3:+107410683 | MsaT017261.1:CDS |
TCTAAGCATGAACTCGTGCT+AGG | 0.543758 | 3:-107410261 | None:intergenic |
AATGCAATAAATGCAAAAGA+TGG | 0.545817 | 3:+107411637 | MsaT017261.1:CDS |
CCATTTAAACAACCCTACTC+TGG | 0.546250 | 3:+107413918 | MsaT017261.1:CDS |
AGTCTTTGCAATTCCTGGAG+TGG | 0.547250 | 3:-107414425 | None:intergenic |
TCTGCTTGCTATAAGGATAG+AGG | 0.547525 | 3:+107414030 | MsaT017261.1:CDS |
TTTCAAATAATCCACTCTCA+AGG | 0.548304 | 3:-107413804 | None:intergenic |
GCGAAGGGTTCTGAACTTGG+TGG | 0.548679 | 3:+107409138 | MsaT017261.1:CDS |
AGAAGGATTGGCATGTCCCA+TGG | 0.548735 | 3:-107413087 | None:intergenic |
GCACACACATATCAGCAAGT+AGG | 0.548931 | 3:-107409816 | None:intergenic |
TCAGCGTATGCAAGCTCTAG+TGG | 0.552958 | 3:+107409681 | MsaT017261.1:CDS |
GTTCTGAAAATCCAACTCCT+GGG | 0.553233 | 3:-107410310 | None:intergenic |
AGGGAACGAGAATCTTGATA+AGG | 0.553771 | 3:+107411890 | MsaT017261.1:CDS |
GAGGGTGAAGAGGACATTCA+AGG | 0.555916 | 3:+107410693 | MsaT017261.1:CDS |
TCAACAGTAGGCCTACTCTC+AGG | 0.556868 | 3:+107410568 | MsaT017261.1:CDS |
GTGTGTTATAAGAATTCTAA+AGG | 0.558028 | 3:+107411439 | MsaT017261.1:CDS |
TTAAGTTCCTTCCTGAGAGT+AGG | 0.559411 | 3:-107410579 | None:intergenic |
ACACATGCCAATTATGTCAA+AGG | 0.562566 | 3:+107411299 | MsaT017261.1:CDS |
GCATTCGGAGCCGAACTCCT+GGG | 0.563589 | 3:-107412306 | None:intergenic |
ATTAACACAGATTACATCTG+AGG | 0.565214 | 3:+107411255 | MsaT017261.1:intron |
CATACTTTGATGGAGACTAC+TGG | 0.567433 | 3:+107412964 | MsaT017261.1:CDS |
TATGGAAGAGAGAGCAAACT+GGG | 0.568310 | 3:+107411857 | MsaT017261.1:CDS |
AGCTGAAAAGATGCTTGCGA+AGG | 0.568364 | 3:+107409122 | None:intergenic |
GCAGGTCATGAACAATAAAA+GGG | 0.568506 | 3:-107409762 | None:intergenic |
AGATATTGATGACGATGAAG+AGG | 0.569424 | 3:+107410602 | MsaT017261.1:CDS |
AGGCAGAACTGGATTCATCC+AGG | 0.569909 | 3:+107410632 | MsaT017261.1:CDS |
GTTGCTACTTGATCTGGTGT+TGG | 0.574954 | 3:-107409881 | None:intergenic |
CGATTCCCAAATTGACATAG+TGG | 0.580947 | 3:-107414117 | None:intergenic |
CCTGAGAGAAGAACAAAGAG+TGG | 0.581788 | 3:+107412389 | MsaT017261.1:CDS |
TCATTATGCTTAGTGTTGGA+GGG | 0.581798 | 3:-107413775 | None:intergenic |
AACTGGATTCATCCAGGCGG+GGG | 0.582008 | 3:+107410638 | MsaT017261.1:CDS |
CAAAACAGAGAGATTGTTTG+GGG | 0.582814 | 3:+107410112 | MsaT017261.1:intron |
GAACCGGATTCAACCAGGAT+GGG | 0.586122 | 3:+107410718 | MsaT017261.1:CDS |
AGGCAGAACCGGATTCAACC+AGG | 0.589059 | 3:+107410713 | MsaT017261.1:CDS |
GAACCATCATCAGGAGAGCA+AGG | 0.589504 | 3:-107409784 | None:intergenic |
CAGGAGTTCGGCTCCGAATG+CGG | 0.589631 | 3:+107412308 | MsaT017261.1:CDS |
TGATAGCATCTGGGAAGCGA+TGG | 0.590031 | 3:+107413418 | MsaT017261.1:CDS |
CAGTAGGATTCTCCACGGAC+TGG | 0.590312 | 3:+107409262 | MsaT017261.1:CDS |
CCAGATTCTAAGCCTTTCGA+GGG | 0.591619 | 3:-107410516 | None:intergenic |
GAACAGTTTGGATAAGAGCA+TGG | 0.592137 | 3:-107414306 | None:intergenic |
CAAACGAGAAGTTGTCACCT+TGG | 0.592914 | 3:-107412940 | None:intergenic |
AAATAGAGCTTTAAAGACCA+TGG | 0.593540 | 3:+107413070 | MsaT017261.1:CDS |
ATTCCCTAAACTTGTTTCAG+CGG | 0.593760 | 3:+107410212 | MsaT017261.1:CDS |
GTTATTATGGCGTTCCAGAA+GGG | 0.598014 | 3:+107409728 | MsaT017261.1:CDS |
TACAGGGCGAAATAAACCCC+AGG | 0.598885 | 3:+107410293 | MsaT017261.1:CDS |
GTTATGTTATGGAAGCAGCC+AGG | 0.598981 | 3:+107412991 | MsaT017261.1:CDS |
TACGAAAAGACGGAAAATGA+CGG | 0.604361 | 3:+107410359 | MsaT017261.1:CDS |
GAAAGTGTTTCAAAAGAACA+AGG | 0.604473 | 3:-107410450 | None:intergenic |
CAGCGTATGCAAGCTCTAGT+GGG | 0.605184 | 3:+107409682 | MsaT017261.1:CDS |
AATGATATCATCCTTGAGAG+TGG | 0.608883 | 3:+107413793 | MsaT017261.1:CDS |
CTGTGCTCCTTCAAGAAAAG+GGG | 0.610873 | 3:+107412594 | MsaT017261.1:CDS |
TCTGGAATGATTCCCTCGAA+AGG | 0.612821 | 3:+107410504 | MsaT017261.1:CDS |
TGTTATAAGAATTCTAAAGG+TGG | 0.613504 | 3:+107411442 | MsaT017261.1:CDS |
TTCTGAAAATCCAACTCCTG+GGG | 0.615940 | 3:-107410309 | None:intergenic |
GCCATGAAGTGATAGCATCT+GGG | 0.616414 | 3:+107413409 | MsaT017261.1:CDS |
GACGATGAAGAGGACATACA+AGG | 0.617846 | 3:+107410612 | MsaT017261.1:CDS |
TGATCAATCGACTTACAAGA+AGG | 0.618959 | 3:+107410422 | MsaT017261.1:CDS |
AGAACCGGATTCAACCAGGA+TGG | 0.619756 | 3:+107410717 | MsaT017261.1:CDS |
AATAGAGCTTTAAAGACCAT+GGG | 0.619881 | 3:+107413071 | MsaT017261.1:CDS |
GCTGAAAAGATGCTTGCGAA+GGG | 0.620277 | 3:+107409123 | None:intergenic |
TGCTACAACCTACGAAAAGA+CGG | 0.621114 | 3:+107410349 | MsaT017261.1:CDS |
ATGGTAAACAAAGGTACGAA+GGG | 0.622204 | 3:-107412417 | None:intergenic |
CCTACTGGATTACTTACATG+TGG | 0.622783 | 3:-107409246 | None:intergenic |
ACAAACCTTTGAAGCAGCAG+TGG | 0.625425 | 3:-107409496 | None:intergenic |
GCAGGAGGAATATATGAACC+TGG | 0.625899 | 3:+107409648 | MsaT017261.1:intron |
AGAATGATAAGCTACGCCGT+TGG | 0.627014 | 3:+107412662 | MsaT017261.1:CDS |
CCAAAAGATATTGCCTACCA+GGG | 0.627033 | 3:+107413344 | MsaT017261.1:CDS |
CACACATATCAGCAAGTAGG+GGG | 0.627930 | 3:-107409813 | None:intergenic |
CAATATCTCATGGTAAACAA+AGG | 0.628488 | 3:-107412426 | None:intergenic |
ACTCAATGGAAATCAACAGT+AGG | 0.634159 | 3:+107410556 | MsaT017261.1:CDS |
GCATGGTTCAGCATTAGTTG+CGG | 0.636133 | 3:-107414289 | None:intergenic |
GGGATGATAACGCCAGTCCG+TGG | 0.637062 | 3:-107409274 | None:intergenic |
CAGTAGGCCTACTCTCAGGA+AGG | 0.640031 | 3:+107410572 | MsaT017261.1:CDS |
AAAGAAATGATCATATACGT+TGG | 0.641068 | 3:-107412895 | None:intergenic |
CATGGTAAACAAAGGTACGA+AGG | 0.641848 | 3:-107412418 | None:intergenic |
GTTTCTGGACATCATTCCAG+AGG | 0.650501 | 3:+107412088 | MsaT017261.1:CDS |
TCATTGATGAATACTTGGCA+CGG | 0.650719 | 3:-107413885 | None:intergenic |
TGCAAAATTCGAGTAAATCG+GGG | 0.651340 | 3:+107414363 | MsaT017261.1:CDS |
GAAGAAGAATTTGATGCACA+GGG | 0.652467 | 3:+107411403 | MsaT017261.1:CDS |
AACACAGATTACATCTGAGG+AGG | 0.653744 | 3:+107411258 | MsaT017261.1:intron |
ATCTATAAGAGAATTCGGCA+GGG | 0.656485 | 3:-107412118 | None:intergenic |
GCTTAGAATTGGAAGATACA+GGG | 0.658280 | 3:+107410277 | MsaT017261.1:CDS |
GAACTGGATTCATCCAGGCG+GGG | 0.658515 | 3:+107410637 | MsaT017261.1:CDS |
CCACATGTAAGTAATCCAGT+AGG | 0.658631 | 3:+107409246 | MsaT017261.1:CDS |
TTTAGAATTCTTATAACACA+CGG | 0.658685 | 3:-107411437 | None:intergenic |
TAGTAATAATTCCAGCATAG+GGG | 0.660364 | 3:-107409469 | None:intergenic |
AGCTATTCTCTCATGCTCGT+AGG | 0.662256 | 3:+107414340 | MsaT017261.1:CDS |
ACGCATTCCGAATCTTGGCG+TGG | 0.671085 | 3:+107414686 | MsaT017261.1:CDS |
TAATCCAGTAGGATTCTCCA+CGG | 0.679485 | 3:+107409257 | MsaT017261.1:CDS |
TTTGATGGAGACTACTGGTG+TGG | 0.693838 | 3:+107412969 | MsaT017261.1:CDS |
ACACATTTCAAAGAATGGCG+AGG | 0.706634 | 3:+107413632 | MsaT017261.1:CDS |
TGGAACGCCATAATAACCAG+CGG | 0.726670 | 3:-107409722 | None:intergenic |
ACACATATCAGCAAGTAGGG+GGG | 0.728095 | 3:-107409812 | None:intergenic |
ACACACATATCAGCAAGTAG+GGG | 0.734890 | 3:-107409814 | None:intergenic |
CAGAACTGGATTCATCCAGG+CGG | 0.736162 | 3:+107410635 | MsaT017261.1:CDS |
TGGGAAAATTACATTCAATG+GGG | 0.742909 | 3:+107411462 | MsaT017261.1:CDS |
TTGATGAATACTTGGCACGG+CGG | 0.746659 | 3:-107413882 | None:intergenic |
ACAGTCACACACCTGCAACG+TGG | 0.756031 | 3:-107414462 | None:intergenic |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr3 | gene | 107409132 | 107414751 | 107409132 | ID=MsaG017261 |
Chr3 | mRNA | 107409132 | 107414751 | 107409132 | ID=MsaT017261.1;Parent=MsaG017261 |
Chr3 | exon | 107409132 | 107409334 | 107409132 | ID=MsaT017261.1.exon1;Parent=MsaT017261.1 |
Chr3 | CDS | 107409132 | 107409334 | 107409132 | ID=cds.MsaT017261.1;Parent=MsaT017261.1 |
Chr3 | exon | 107409440 | 107409512 | 107409440 | ID=MsaT017261.1.exon2;Parent=MsaT017261.1 |
Chr3 | CDS | 107409440 | 107409512 | 107409440 | ID=cds.MsaT017261.1;Parent=MsaT017261.1 |
Chr3 | exon | 107409652 | 107409935 | 107409652 | ID=MsaT017261.1.exon3;Parent=MsaT017261.1 |
Chr3 | CDS | 107409652 | 107409935 | 107409652 | ID=cds.MsaT017261.1;Parent=MsaT017261.1 |
Chr3 | exon | 107410122 | 107410896 | 107410122 | ID=MsaT017261.1.exon4;Parent=MsaT017261.1 |
Chr3 | CDS | 107410122 | 107410896 | 107410122 | ID=cds.MsaT017261.1;Parent=MsaT017261.1 |
Chr3 | exon | 107411265 | 107411543 | 107411265 | ID=MsaT017261.1.exon5;Parent=MsaT017261.1 |
Chr3 | CDS | 107411265 | 107411543 | 107411265 | ID=cds.MsaT017261.1;Parent=MsaT017261.1 |
Chr3 | exon | 107411630 | 107411911 | 107411630 | ID=MsaT017261.1.exon6;Parent=MsaT017261.1 |
Chr3 | CDS | 107411630 | 107411911 | 107411630 | ID=cds.MsaT017261.1;Parent=MsaT017261.1 |
Chr3 | exon | 107412017 | 107412145 | 107412017 | ID=MsaT017261.1.exon7;Parent=MsaT017261.1 |
Chr3 | CDS | 107412017 | 107412145 | 107412017 | ID=cds.MsaT017261.1;Parent=MsaT017261.1 |
Chr3 | exon | 107412248 | 107412448 | 107412248 | ID=MsaT017261.1.exon8;Parent=MsaT017261.1 |
Chr3 | CDS | 107412248 | 107412448 | 107412248 | ID=cds.MsaT017261.1;Parent=MsaT017261.1 |
Chr3 | exon | 107412538 | 107412683 | 107412538 | ID=MsaT017261.1.exon9;Parent=MsaT017261.1 |
Chr3 | CDS | 107412538 | 107412683 | 107412538 | ID=cds.MsaT017261.1;Parent=MsaT017261.1 |
Chr3 | exon | 107412842 | 107413145 | 107412842 | ID=MsaT017261.1.exon10;Parent=MsaT017261.1 |
Chr3 | CDS | 107412842 | 107413145 | 107412842 | ID=cds.MsaT017261.1;Parent=MsaT017261.1 |
Chr3 | exon | 107413339 | 107413478 | 107413339 | ID=MsaT017261.1.exon11;Parent=MsaT017261.1 |
Chr3 | CDS | 107413339 | 107413478 | 107413339 | ID=cds.MsaT017261.1;Parent=MsaT017261.1 |
Chr3 | exon | 107413614 | 107413671 | 107413614 | ID=MsaT017261.1.exon12;Parent=MsaT017261.1 |
Chr3 | CDS | 107413614 | 107413671 | 107413614 | ID=cds.MsaT017261.1;Parent=MsaT017261.1 |
Chr3 | exon | 107413757 | 107414158 | 107413757 | ID=MsaT017261.1.exon13;Parent=MsaT017261.1 |
Chr3 | CDS | 107413757 | 107414158 | 107413757 | ID=cds.MsaT017261.1;Parent=MsaT017261.1 |
Chr3 | exon | 107414246 | 107414472 | 107414246 | ID=MsaT017261.1.exon14;Parent=MsaT017261.1 |
Chr3 | CDS | 107414246 | 107414472 | 107414246 | ID=cds.MsaT017261.1;Parent=MsaT017261.1 |
Chr3 | exon | 107414655 | 107414751 | 107414655 | ID=MsaT017261.1.exon15;Parent=MsaT017261.1 |
Chr3 | CDS | 107414655 | 107414751 | 107414655 | ID=cds.MsaT017261.1;Parent=MsaT017261.1 |
Gene Sequence |
Protein sequence |