Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG019113 | XP_013455085.1 | 99.548 | 221 | 1 | 0 | 1 | 221 | 1 | 221 | 1.06e-164 | 463 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG019113 | sp|O22152|YAB1_ARATH | 67.431 | 218 | 49 | 6 | 19 | 221 | 19 | 229 | 1.43e-95 | 281 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG019113 | tr|A0A072UJ49|A0A072UJ49_MEDTR | 99.548 | 221 | 1 | 0 | 1 | 221 | 1 | 221 | 5.07e-165 | 463 |
| Gene ID | Type | Classification |
|---|---|---|
| MsaG019113 | TF | C2C2-YABBY |
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| MsaG000127 | MsaG019113 | 0.830821 | 4.262256e-55 | 1.262819e-52 |
| MsaG000128 | MsaG019113 | 0.811127 | 1.401824e-50 | 2.460623e-48 |
| MsaG000140 | MsaG019113 | 0.809315 | 3.431205e-50 | 5.763066e-48 |
| MsaG000198 | MsaG019113 | 0.805332 | 2.375819e-49 | 3.629721e-47 |
| MsaG000237 | MsaG019113 | 0.827595 | 2.561312e-54 | 6.925245e-52 |
| MsaG000530 | MsaG019113 | 0.823042 | 3.024100e-53 | 7.212926e-51 |
| MsaG000550 | MsaG019113 | 0.810561 | 1.855482e-50 | 3.212282e-48 |
| MsaG000641 | MsaG019113 | 0.802466 | 9.301416e-49 | 1.329917e-46 |
| MsaG000690 | MsaG019113 | 0.844415 | 1.434848e-58 | 6.449263e-56 |
| MsaG000856 | MsaG019113 | 0.820607 | 1.100174e-52 | 2.458806e-50 |
| MsaG001558 | MsaG019113 | 0.800447 | 2.399799e-48 | 3.277662e-46 |
| MsaG001809 | MsaG019113 | 0.814024 | 3.281747e-51 | 6.190012e-49 |
| MsaG001930 | MsaG019113 | 0.872000 | 9.111350e-67 | 1.149704e-63 |
| MsaG001991 | MsaG019113 | 0.805285 | 2.429368e-49 | 3.707477e-47 |
| MsaG002117 | MsaG019113 | 0.821254 | 7.820902e-53 | 1.778173e-50 |
| MsaG002184 | MsaG019113 | 0.806367 | 1.443379e-49 | 2.259510e-47 |
| MsaG002353 | MsaG019113 | 0.812023 | 8.967680e-51 | 1.609133e-48 |
| MsaG002732 | MsaG019113 | 0.811408 | 1.218999e-50 | 2.154537e-48 |
| MsaG003016 | MsaG019113 | 0.825675 | 7.318272e-54 | 1.875499e-51 |
| MsaG003181 | MsaG019113 | 0.832478 | 1.671702e-55 | 5.197218e-53 |
| MsaG003190 | MsaG019113 | 0.804716 | 3.191451e-49 | 4.806564e-47 |
| MsaG003472 | MsaG019113 | 0.805603 | 2.085896e-49 | 3.206945e-47 |
| MsaG003901 | MsaG019113 | 0.832033 | 2.151865e-55 | 6.604606e-53 |
| MsaG003906 | MsaG019113 | 0.864350 | 2.582786e-64 | 2.377731e-61 |
| MsaG003967 | MsaG019113 | 0.821649 | 6.346690e-53 | 1.458156e-50 |
| MsaG004017 | MsaG019113 | 0.809696 | 2.845079e-50 | 4.822989e-48 |
| MsaG004157 | MsaG019113 | 0.811480 | 1.175982e-50 | 2.082210e-48 |
| MsaG004544 | MsaG019113 | 0.828924 | 1.228856e-54 | 3.448717e-52 |
| MsaG004745 | MsaG019113 | 0.843658 | 2.284661e-58 | 1.001988e-55 |
| MsaG004801 | MsaG019113 | 0.802344 | 9.852951e-49 | 1.404888e-46 |
| MsaG004937 | MsaG019113 | 0.848029 | 1.504270e-59 | 7.625801e-57 |
| MsaG004939 | MsaG019113 | 0.848688 | 9.901797e-60 | 5.131869e-57 |
| MsaG004990 | MsaG019113 | 0.817778 | 4.813859e-52 | 9.990264e-50 |
| MsaG005120 | MsaG019113 | 0.844300 | 1.540246e-58 | 6.897187e-56 |
| MsaG005565 | MsaG019113 | 0.833896 | 7.442723e-56 | 2.412071e-53 |
| MsaG005646 | MsaG019113 | 0.810812 | 1.638741e-50 | 2.854471e-48 |
| MsaG006039 | MsaG019113 | 0.868746 | 1.051255e-65 | 1.156148e-62 |
| MsaG006120 | MsaG019113 | 0.813287 | 4.759644e-51 | 8.813066e-49 |
| MsaG006323 | MsaG019113 | 0.828297 | 1.739844e-54 | 4.797492e-52 |
| MsaG006423 | MsaG019113 | 0.803173 | 6.654151e-49 | 9.670213e-47 |
| MsaG006590 | MsaG019113 | 0.825894 | 6.496295e-54 | 1.675115e-51 |
| MsaG007071 | MsaG019113 | 0.807085 | 1.019556e-49 | 1.623251e-47 |
| MsaG007191 | MsaG019113 | 0.826087 | 5.848547e-54 | 1.516195e-51 |
| MsaG007434 | MsaG019113 | 0.800285 | 2.588544e-48 | 3.522380e-46 |
| MsaG007407 | MsaG019113 | 0.826221 | 5.438074e-54 | 1.414951e-51 |
| MsaG007541 | MsaG019113 | 0.811375 | 1.238920e-50 | 2.187994e-48 |
| MsaG007565 | MsaG019113 | 0.869349 | 6.715458e-66 | 7.572577e-63 |
| MsaG007950 | MsaG019113 | 0.828151 | 1.885594e-54 | 5.178321e-52 |
| MsaG007951 | MsaG019113 | 0.823628 | 2.209402e-53 | 5.354287e-51 |
| MsaG008022 | MsaG019113 | 0.847335 | 2.328909e-59 | 1.153338e-56 |
| MsaG008100 | MsaG019113 | 0.806363 | 1.446054e-49 | 2.263496e-47 |
| MsaG008106 | MsaG019113 | 0.816984 | 7.251027e-52 | 1.474391e-49 |
| MsaG008166 | MsaG019113 | 0.815753 | 1.363019e-51 | 2.685534e-49 |
| MsaG008248 | MsaG019113 | 0.826719 | 4.141052e-54 | 1.092564e-51 |
| MsaG008285 | MsaG019113 | 0.806312 | 1.482187e-49 | 2.317271e-47 |
| MsaG008372 | MsaG019113 | 0.805302 | 2.410312e-49 | 3.679855e-47 |
| MsaG008712 | MsaG019113 | 0.802619 | 8.651557e-49 | 1.241371e-46 |
| MsaG009281 | MsaG019113 | 0.833363 | 1.009954e-55 | 3.222319e-53 |
| MsaG011079 | MsaG019113 | 0.810613 | 1.808545e-50 | 3.134962e-48 |
| MsaG011477 | MsaG019113 | 0.805845 | 1.856500e-49 | 2.870531e-47 |
| MsaG011833 | MsaG019113 | 0.809337 | 3.394772e-50 | 5.704897e-48 |
| MsaG011783 | MsaG019113 | 0.825132 | 9.824779e-54 | 2.480422e-51 |
| MsaG011951 | MsaG019113 | 0.829723 | 7.881051e-55 | 2.262825e-52 |
| MsaG012023 | MsaG019113 | 0.844405 | 1.443344e-58 | 6.485394e-56 |
| MsaG012049 | MsaG019113 | 0.808520 | 5.066860e-50 | 8.349505e-48 |
| MsaG012262 | MsaG019113 | 0.823516 | 2.346541e-53 | 5.669091e-51 |
| MsaG012454 | MsaG019113 | 0.821342 | 7.464844e-53 | 1.701121e-50 |
| MsaG012630 | MsaG019113 | 0.814442 | 2.655441e-51 | 5.061687e-49 |
| MsaG012673 | MsaG019113 | 0.802247 | 1.031320e-48 | 1.467176e-46 |
| MsaG012707 | MsaG019113 | 0.800145 | 2.763004e-48 | 3.747919e-46 |
| MsaG012778 | MsaG019113 | 0.818944 | 2.627633e-52 | 5.620795e-50 |
| MsaG013148 | MsaG019113 | 0.805402 | 2.296987e-49 | 3.514999e-47 |
| MsaG013786 | MsaG019113 | 0.802051 | 1.131036e-48 | 1.601872e-46 |
| MsaG014078 | MsaG019113 | 0.822849 | 3.352860e-53 | 7.955416e-51 |
| MsaG014289 | MsaG019113 | 0.835618 | 2.757205e-56 | 9.408150e-54 |
| MsaG014368 | MsaG019113 | 0.836132 | 2.045169e-56 | 7.087319e-54 |
| MsaG014542 | MsaG019113 | 0.854877 | 1.774006e-61 | 1.141042e-58 |
| MsaG015807 | MsaG019113 | 0.821300 | 7.633088e-53 | 1.737568e-50 |
| MsaG016540 | MsaG019113 | 0.837005 | 1.228515e-56 | 4.370563e-54 |
| MsaG017232 | MsaG019113 | 0.818270 | 3.731214e-52 | 7.842206e-50 |
| MsaG017256 | MsaG019113 | 0.802566 | 8.871077e-49 | 1.271337e-46 |
| MsaG017284 | MsaG019113 | 0.840038 | 2.043073e-57 | 7.985383e-55 |
| MsaG017398 | MsaG019113 | 0.837020 | 1.217993e-56 | 4.335153e-54 |
| MsaG017464 | MsaG019113 | 0.812996 | 5.510377e-51 | 1.012945e-48 |
| MsaG017509 | MsaG019113 | 0.849559 | 5.685316e-60 | 3.035698e-57 |
| MsaG018059 | MsaG019113 | 0.811121 | 1.405388e-50 | 2.466591e-48 |
| MsaG018069 | MsaG019113 | 0.812252 | 7.999131e-51 | 1.443418e-48 |
| MsaG018103 | MsaG019113 | 0.828006 | 2.042889e-54 | 5.587435e-52 |
| MsaG018190 | MsaG019113 | 0.860383 | 4.221658e-63 | 3.331260e-60 |
| MsaG018245 | MsaG019113 | 0.831955 | 2.248116e-55 | 6.884428e-53 |
| MsaG018397 | MsaG019113 | 0.838531 | 5.006146e-57 | 1.866604e-54 |
| MsaG018548 | MsaG019113 | 0.805555 | 2.134503e-49 | 3.277932e-47 |
| MsaG018671 | MsaG019113 | 0.825200 | 9.470987e-54 | 2.395529e-51 |
| MsaG019084 | MsaG019113 | 0.838074 | 6.556856e-57 | 2.410308e-54 |
| MsaG019110 | MsaG019113 | 0.849198 | 7.158521e-60 | 3.775405e-57 |
| MsaG019112 | MsaG019113 | 0.897948 | 1.950033e-76 | 8.859180e-73 |
| MsaG019113 | MsaG019215 | 0.825300 | 8.969988e-54 | 2.275078e-51 |
| MsaG019113 | MsaG019422 | 0.802794 | 7.964285e-49 | 1.147308e-46 |
| MsaG019113 | MsaG019572 | 0.817521 | 5.498804e-52 | 1.133646e-49 |
| MsaG019113 | MsaG019576 | 0.810923 | 1.551266e-50 | 2.709379e-48 |
| MsaG019113 | MsaG019640 | 0.806475 | 1.369467e-49 | 2.149374e-47 |
| MsaG019113 | MsaG020566 | 0.823105 | 2.923761e-53 | 6.985288e-51 |
| MsaG019113 | MsaG020603 | 0.827239 | 3.114385e-54 | 8.336691e-52 |
| MsaG019113 | MsaG020718 | 0.806024 | 1.702687e-49 | 2.643798e-47 |
| MsaG019113 | MsaG021322 | 0.803937 | 4.628232e-49 | 6.845906e-47 |
| MsaG019113 | MsaG021432 | 0.800599 | 2.235640e-48 | 3.063919e-46 |
| MsaG019113 | MsaG022227 | 0.804241 | 4.004970e-49 | 5.965913e-47 |
| MsaG019113 | MsaG022300 | 0.810948 | 1.531525e-50 | 2.676599e-48 |
| MsaG019113 | MsaG022746 | 0.806051 | 1.680805e-49 | 2.611544e-47 |
| MsaG019113 | MsaG023153 | 0.814290 | 2.868941e-51 | 5.447761e-49 |
| MsaG019113 | MsaG023432 | 0.830882 | 4.119372e-55 | 1.222660e-52 |
| MsaG019113 | MsaG023474 | 0.850458 | 3.193254e-60 | 1.758089e-57 |
| MsaG019113 | MsaG023753 | 0.820709 | 1.042540e-52 | 2.336238e-50 |
| MsaG019113 | MsaG024001 | 0.816370 | 9.939225e-52 | 1.989341e-49 |
| MsaG019113 | MsaG024546 | 0.810004 | 2.443609e-50 | 4.173438e-48 |
| MsaG019113 | MsaG024668 | 0.833812 | 7.811269e-56 | 2.525295e-53 |
| MsaG019113 | MsaG025247 | 0.824309 | 1.532142e-53 | 3.782245e-51 |
| MsaG019113 | MsaG025349 | 0.807704 | 7.547484e-50 | 1.219551e-47 |
| MsaG019113 | MsaG025418 | 0.822033 | 5.177471e-53 | 1.201763e-50 |
| MsaG019113 | MsaG025552 | 0.842911 | 3.607028e-58 | 1.544416e-55 |
| MsaG019113 | MsaG025760 | 0.824846 | 1.147000e-53 | 2.873161e-51 |
| MsaG019113 | MsaG027022 | 0.803388 | 6.009874e-49 | 8.777325e-47 |
| MsaG019113 | MsaG027243 | 0.858615 | 1.426094e-62 | 1.052233e-59 |
| MsaG019113 | MsaG027272 | 0.807552 | 8.124682e-50 | 1.308023e-47 |
| MsaG019113 | MsaG027651 | 0.812837 | 5.966613e-51 | 1.092473e-48 |
| MsaG019113 | MsaG027689 | 0.851578 | 1.548572e-60 | 8.862124e-58 |
| MsaG019113 | MsaG027839 | 0.806794 | 1.174034e-49 | 1.856448e-47 |
| MsaG019113 | MsaG028088 | 0.807603 | 7.927657e-50 | 1.277830e-47 |
| MsaG019113 | MsaG028419 | 0.814640 | 2.402532e-51 | 4.602217e-49 |
| MsaG019113 | MsaG028621 | 0.844942 | 1.036582e-58 | 4.741630e-56 |
| MsaG019113 | MsaG028645 | 0.832116 | 2.052249e-55 | 6.314210e-53 |
| MsaG019113 | MsaG028862 | 0.841369 | 9.186889e-58 | 3.744418e-55 |
| MsaG019113 | MsaG028990 | 0.811053 | 1.454377e-50 | 2.548285e-48 |
| MsaG019113 | MsaG029046 | 0.851567 | 1.559826e-60 | 8.923071e-58 |
| MsaG019113 | MsaG029164 | 0.821485 | 6.920698e-53 | 1.583137e-50 |
| MsaG019113 | MsaG029396 | 0.842758 | 3.959418e-58 | 1.687084e-55 |
| MsaG019113 | MsaG029361 | 0.843008 | 3.400259e-58 | 1.460451e-55 |
| MsaG019113 | MsaG029442 | 0.837370 | 9.923972e-57 | 3.569987e-54 |
| MsaG019113 | MsaG029478 | 0.828296 | 1.740458e-54 | 4.799114e-52 |
| MsaG019113 | MsaG029613 | 0.800708 | 2.124608e-48 | 2.918991e-46 |
| MsaG019113 | MsaG029932 | 0.808861 | 4.288022e-50 | 7.124460e-48 |
| MsaG019113 | MsaG030226 | 0.834045 | 6.831215e-56 | 2.223743e-53 |
| MsaG019113 | MsaG030331 | 0.807383 | 8.818847e-50 | 1.414070e-47 |
| MsaG019113 | MsaG032674 | 0.800374 | 2.482742e-48 | 3.385315e-46 |
| MsaG019113 | MsaG032815 | 0.832058 | 2.121257e-55 | 6.515469e-53 |
| MsaG019113 | MsaG033646 | 0.835514 | 2.928767e-56 | 9.962529e-54 |
| MsaG019113 | MsaG033734 | 0.840919 | 1.205225e-57 | 4.842666e-55 |
| MsaG019113 | MsaG034130 | 0.807148 | 9.888255e-50 | 1.576688e-47 |
| MsaG019113 | MsaG034173 | 0.817738 | 4.913464e-52 | 1.018639e-49 |
| MsaG019113 | MsaG034177 | 0.856750 | 5.064088e-62 | 3.486749e-59 |
| MsaG019113 | MsaG034256 | 0.815722 | 1.384533e-51 | 2.725859e-49 |
| MsaG019113 | MsaG035051 | 0.823064 | 2.988358e-53 | 7.131931e-51 |
| MsaG019113 | MsaG035198 | 0.806586 | 1.297937e-49 | 2.042424e-47 |
| MsaG019113 | MsaG035642 | 0.804992 | 2.796439e-49 | 4.238801e-47 |
| MsaG019113 | MsaG036293 | 0.805518 | 2.172859e-49 | 3.333959e-47 |
| MsaG019113 | MsaG036444 | 0.834358 | 5.706978e-56 | 1.875400e-53 |
| MsaG019113 | MsaG036642 | 0.811793 | 1.005834e-50 | 1.794665e-48 |
| MsaG019113 | MsaG039867 | 0.803576 | 5.495683e-49 | 8.061211e-47 |
| MsaG019113 | MsaG039881 | 0.817084 | 6.885819e-52 | 1.403779e-49 |
| MsaG019113 | MsaG039961 | 0.807477 | 8.428014e-50 | 1.354409e-47 |
| MsaG019113 | MsaG040435 | 0.804053 | 4.380806e-49 | 6.497582e-47 |
| MsaG019113 | MsaG040449 | 0.804580 | 3.405943e-49 | 5.113489e-47 |
| MsaG019113 | MsaG040451 | 0.828904 | 1.242873e-54 | 3.486079e-52 |
| MsaG019113 | MsaG041076 | 0.816622 | 8.734674e-52 | 1.759501e-49 |
| MsaG019113 | MsaG041793 | 0.819103 | 2.419406e-52 | 5.196987e-50 |
| MsaG019113 | MsaG041873 | 0.838255 | 5.891272e-57 | 2.177763e-54 |
| MsaG019113 | MsaG042082 | 0.855008 | 1.626014e-61 | 1.050766e-58 |
| MsaG019113 | MsaG042241 | 0.830810 | 4.288337e-55 | 1.270166e-52 |
| MsaG019113 | MsaG042321 | 0.800942 | 1.904545e-48 | 2.630350e-46 |
| MsaG019113 | MsaG042700 | 0.835782 | 2.506889e-56 | 8.596008e-54 |
| MsaG019113 | MsaG043133 | 0.836682 | 1.484629e-56 | 5.230393e-54 |
| MsaG019113 | MsaG043272 | 0.813132 | 5.145181e-51 | 9.490303e-49 |
| MsaG019113 | MsaG044863 | 0.809642 | 2.921267e-50 | 4.945754e-48 |
| MsaG019113 | MsaG045148 | 0.845499 | 7.338710e-59 | 3.418314e-56 |
| MsaG019113 | MsaG045149 | 0.851944 | 1.221597e-60 | 7.082644e-58 |
| MsaG019113 | MsaG045285 | 0.832086 | 2.087453e-55 | 6.416924e-53 |
| MsaG019113 | MsaG045323 | 0.800641 | 2.191701e-48 | 3.006645e-46 |
| MsaG019113 | MsaG045701 | 0.832985 | 1.252703e-55 | 3.952691e-53 |
| MsaG019113 | MsaG045894 | 0.830293 | 5.731971e-55 | 1.672807e-52 |
| MsaG019113 | MsaG045984 | 0.818608 | 3.130707e-52 | 6.638229e-50 |
| MsaG019113 | MsaG046004 | 0.853705 | 3.855870e-61 | 2.378472e-58 |
| MsaG019113 | MsaG046214 | 0.828532 | 1.527201e-54 | 4.239382e-52 |
| MsaG019113 | MsaG046403 | 0.801284 | 1.622217e-48 | 2.257834e-46 |
| MsaG019113 | MsaG046431 | 0.862130 | 1.246095e-63 | 1.051080e-60 |
| MsaG019113 | MsaG046473 | 0.811927 | 9.410141e-51 | 1.684602e-48 |
| MsaG019113 | MsaG046936 | 0.800193 | 2.701989e-48 | 3.669107e-46 |
| MsaG019113 | MsaG047118 | 0.817806 | 4.745952e-52 | 9.856493e-50 |
| MsaG019113 | MsaG047160 | 0.811389 | 1.230497e-50 | 2.173876e-48 |
| MsaG019113 | MsaG004516 | 0.806996 | 1.064167e-49 | 1.690749e-47 |
| MsaG019113 | MsaG000819 | 0.823174 | 2.818832e-53 | 6.747135e-51 |
| MsaG019113 | MsaG009465 | 0.805631 | 2.057890e-49 | 3.166016e-47 |
| MsaG019113 | MsaG009633 | 0.843205 | 3.015414e-58 | 1.303305e-55 |
| MsaG019113 | MsaG011921 | 0.817680 | 5.065028e-52 | 1.048452e-49 |
| MsaG019113 | MsaG017401 | 0.828679 | 1.408375e-54 | 3.925339e-52 |
| MsaG019113 | MsaG012407 | 0.846355 | 4.306289e-59 | 2.063747e-56 |
| MsaG019113 | MsaG014865 | 0.803601 | 5.430591e-49 | 7.970293e-47 |
| MsaG019113 | MsaG012532 | 0.830976 | 3.906151e-55 | 1.162504e-52 |
| MsaG019113 | MsaG012697 | 0.812429 | 7.321324e-51 | 1.326999e-48 |
| MsaG019113 | MsaG019408 | 0.823220 | 2.749390e-53 | 6.589196e-51 |
| MsaG019113 | MsaG019886 | 0.809749 | 2.771728e-50 | 4.704754e-48 |
| MsaG019113 | MsaG019073 | 0.802293 | 1.009033e-48 | 1.437056e-46 |
| MsaG019113 | MsaG021171 | 0.840303 | 1.744138e-57 | 6.873782e-55 |
| MsaG019113 | MsaG027109 | 0.833016 | 1.231004e-55 | 3.887656e-53 |
| MsaG019113 | MsaG032460 | 0.833479 | 9.446873e-56 | 3.024512e-53 |
| MsaG019113 | MsaG032891 | 0.807588 | 7.984526e-50 | 1.286534e-47 |
| MsaG019113 | MsaG031629 | 0.807719 | 7.489206e-50 | 1.210588e-47 |
| MsaG019113 | MsaG034616 | 0.824420 | 1.443803e-53 | 3.574772e-51 |
| MsaG019113 | MsaG033278 | 0.835175 | 3.563178e-56 | 1.199790e-53 |
| MsaG019113 | MsaG033433 | 0.806371 | 1.440265e-49 | 2.254884e-47 |
| MsaG019113 | MsaG032451 | 0.857877 | 2.359890e-62 | 1.693928e-59 |
| MsaG019113 | MsaG031806 | 0.825767 | 6.961365e-54 | 1.788632e-51 |
| MsaG019113 | MsaG031429 | 0.876632 | 2.492208e-68 | 3.854926e-65 |
| MsaG019113 | MsaG034989 | 0.817333 | 6.058417e-52 | 1.243005e-49 |
| MsaG019113 | MsaG036787 | 0.800744 | 2.088819e-48 | 2.872126e-46 |
| MsaG019113 | MsaG037076 | 0.813021 | 5.441838e-51 | 1.000986e-48 |
| MsaG019113 | MsaG037376 | 0.824701 | 1.240473e-53 | 3.094932e-51 |
| MsaG019113 | MsaG036786 | 0.809676 | 2.872965e-50 | 4.867949e-48 |
| MsaG019113 | MsaG040778 | 0.801889 | 1.220481e-48 | 1.722281e-46 |
| MsaG019113 | MsaG043681 | 0.840230 | 1.821846e-57 | 7.163323e-55 |
| MsaG019113 | MsaG043534 | 0.819240 | 2.252891e-52 | 4.856612e-50 |
| MsaG019113 | MsaG042135 | 0.821384 | 7.300265e-53 | 1.665494e-50 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG019113 | MtrunA17_Chr4g0011841 | 99.548 | 221 | 1 | 0 | 1 | 221 | 1 | 221 | 9.76e-169 | 463 |
| MsaG019113 | MtrunA17_Chr4g0056521 | 71.770 | 209 | 51 | 6 | 18 | 221 | 13 | 218 | 1.52e-93 | 273 |
| MsaG019113 | MtrunA17_Chr4g0063931 | 53.368 | 193 | 64 | 4 | 20 | 206 | 11 | 183 | 3.05e-60 | 187 |
| MsaG019113 | MtrunA17_Chr2g0322221 | 52.041 | 196 | 83 | 5 | 19 | 211 | 8 | 195 | 4.01e-57 | 179 |
| MsaG019113 | MtrunA17_Chr4g0025361 | 54.601 | 163 | 61 | 3 | 22 | 184 | 8 | 157 | 2.97e-51 | 164 |
| MsaG019113 | MtrunA17_Chr5g0413381 | 50.000 | 158 | 71 | 2 | 23 | 179 | 12 | 162 | 1.23e-46 | 152 |
| MsaG019113 | MtrunA17_Chr5g0419871 | 46.875 | 160 | 65 | 5 | 21 | 178 | 14 | 155 | 2.32e-35 | 123 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG019113 | AT2G45190.1 | 67.431 | 218 | 49 | 6 | 19 | 221 | 19 | 229 | 1.45e-96 | 281 |
| MsaG019113 | AT4G00180.1 | 62.661 | 233 | 59 | 10 | 8 | 219 | 13 | 238 | 9.63e-81 | 241 |
| MsaG019113 | AT4G00180.2 | 61.722 | 209 | 57 | 9 | 32 | 219 | 1 | 207 | 4.42e-68 | 208 |
| MsaG019113 | AT2G45190.2 | 63.372 | 172 | 41 | 6 | 65 | 221 | 1 | 165 | 7.28e-66 | 201 |
| MsaG019113 | AT2G26580.2 | 57.485 | 167 | 49 | 5 | 22 | 186 | 8 | 154 | 1.74e-56 | 177 |
| MsaG019113 | AT2G26580.1 | 57.485 | 167 | 49 | 5 | 22 | 186 | 8 | 154 | 1.74e-56 | 177 |
| MsaG019113 | AT1G08465.1 | 56.322 | 174 | 52 | 5 | 22 | 188 | 7 | 163 | 1.42e-55 | 175 |
| MsaG019113 | AT1G23420.1 | 46.584 | 161 | 84 | 2 | 24 | 182 | 20 | 180 | 8.17e-40 | 137 |
| MsaG019113 | AT1G23420.2 | 46.584 | 161 | 84 | 2 | 24 | 182 | 51 | 211 | 4.45e-39 | 135 |
| MsaG019113 | AT1G69180.1 | 39.490 | 157 | 77 | 2 | 22 | 178 | 18 | 156 | 9.86e-31 | 112 |
Find 56 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| CTATTAGCAGGTGGAGGTTT+AGG | 0.195251 | 4:-23073692 | None:intergenic |
| ATCATCAAATCATTTGGATT+TGG | 0.277959 | 4:-23073635 | None:intergenic |
| CACTTTCCACACATTCATTT+CGG | 0.297543 | 4:+23075862 | MsaT019113.1:CDS |
| CTTCAACCCTCAAACTCTTA+TGG | 0.305185 | 4:+23073204 | MsaT019113.1:CDS |
| AGAGTTGTTGCTGTTGTTGC+TGG | 0.315337 | 4:-23072884 | None:intergenic |
| TATTAGCAGGTGGAGGTTTA+GGG | 0.330394 | 4:-23073691 | None:intergenic |
| GCCTCTCTGTGGCTTATATC+AGG | 0.334060 | 4:-23075630 | None:intergenic |
| TTCTTCACGGGTTGATGATC+AGG | 0.349751 | 4:-23075892 | None:intergenic |
| AACAAACACACTTCTTTAGT+AGG | 0.360387 | 4:-23076139 | None:intergenic |
| GTGTTCATCATCAAATCATT+TGG | 0.376681 | 4:-23073641 | None:intergenic |
| TTACTTGATGAAGCGGTTGT+AGG | 0.396976 | 4:-23074696 | None:intergenic |
| TGTCCAAGGTGAAGTTGATT+TGG | 0.407277 | 4:-23073175 | None:intergenic |
| TGTTGCTGTTGTTGCTGGTC+CGG | 0.423782 | 4:-23072879 | None:intergenic |
| GAGGACGTGCTTATGAAAGA+TGG | 0.432558 | 4:+23076084 | MsaT019113.1:CDS |
| TTCATCATCATGTTTGTTGA+AGG | 0.455442 | 4:-23073605 | None:intergenic |
| AATTTCTTACGTCTATTAGC+AGG | 0.457462 | 4:-23073704 | None:intergenic |
| GAGATCCAACGTATCAAAGC+TGG | 0.478771 | 4:+23075603 | MsaT019113.1:CDS |
| GAAGAAAGCTAATGTTCGTC+AGG | 0.494623 | 4:+23075909 | MsaT019113.1:CDS |
| CGAACATTAGCTTTCTTCAC+GGG | 0.494923 | 4:-23075904 | None:intergenic |
| ACAAACACACTTCTTTAGTA+GGG | 0.496640 | 4:-23076138 | None:intergenic |
| ACTCATACCATAAGAGTTTG+AGG | 0.497892 | 4:-23073211 | None:intergenic |
| GGAACTCTCTGTCTCTTCTC+CGG | 0.501243 | 4:-23074668 | None:intergenic |
| CGAAATGAATGTGTGGAAAG+TGG | 0.502844 | 4:-23075861 | None:intergenic |
| TTGTTGCTGGTCCGGTGAAA+AGG | 0.508490 | 4:-23072871 | None:intergenic |
| AGGTGAAGTTGATTTGGAGC+AGG | 0.517398 | 4:-23073169 | None:intergenic |
| ACAGCAACAACTCTCTCCTT+CGG | 0.518591 | 4:+23072893 | MsaT019113.1:CDS |
| TGCAATGGACATAACAAAGC+TGG | 0.526911 | 4:-23072917 | None:intergenic |
| CTCATACCATAAGAGTTTGA+GGG | 0.529909 | 4:-23073210 | None:intergenic |
| ATTAAACTTACTTGATGAAG+CGG | 0.531165 | 4:-23074703 | None:intergenic |
| ACGAACATTAGCTTTCTTCA+CGG | 0.533864 | 4:-23075905 | None:intergenic |
| TTACGTCTATTAGCAGGTGG+AGG | 0.545636 | 4:-23073698 | None:intergenic |
| CTGGTCCGGTGAAAAGGAAG+TGG | 0.549720 | 4:-23072865 | None:intergenic |
| AGGACGTGCTTATGAAAGAT+GGG | 0.553995 | 4:+23076085 | MsaT019113.1:CDS |
| TTTCATTGTGTAGGATTCAG+AGG | 0.560695 | 4:+23076065 | MsaT019113.1:intron |
| ATGAAGCGGTTGTAGGCAGA+TGG | 0.560728 | 4:-23074689 | None:intergenic |
| TTCTTACGTCTATTAGCAGG+TGG | 0.566691 | 4:-23073701 | None:intergenic |
| GATTCCCAGCTTTGATACGT+TGG | 0.580008 | 4:-23075608 | None:intergenic |
| GAAGTTGATTTGGAGCAGGA+AGG | 0.583401 | 4:-23073165 | None:intergenic |
| AAAGGAAGTGGATGATGAAG+AGG | 0.587043 | 4:-23072853 | None:intergenic |
| GCTCCAAATCAACTTCACCT+TGG | 0.591195 | 4:+23073172 | MsaT019113.1:CDS |
| AGATCCAACGTATCAAAGCT+GGG | 0.600203 | 4:+23075604 | MsaT019113.1:CDS |
| GAAATGAATGTGTGGAAAGT+GGG | 0.615090 | 4:-23075860 | None:intergenic |
| ATGATGAACACAATGAGAGG+AGG | 0.619560 | 4:+23073653 | MsaT019113.1:CDS |
| CACGCATGTTAACTGAGAGA+AGG | 0.621310 | 4:-23073135 | None:intergenic |
| CATGTTAACTGAGAGAAGGT+TGG | 0.622869 | 4:-23073131 | None:intergenic |
| TGATGAACACAATGAGAGGA+GGG | 0.625320 | 4:+23073654 | MsaT019113.1:CDS |
| ACATAACAAAGCTGGTCCGA+AGG | 0.642303 | 4:-23072909 | None:intergenic |
| GGTTGAAGTAAGTGTGTCCA+AGG | 0.648511 | 4:-23073189 | None:intergenic |
| GTCTTGAACAAACTTGTGCA+AGG | 0.649953 | 4:-23073082 | None:intergenic |
| CAGTGTCACAGAAATTGCAA+TGG | 0.650774 | 4:-23072932 | None:intergenic |
| TTTCTGTGACACTGTTCTCG+CGG | 0.670363 | 4:+23072941 | MsaT019113.1:CDS |
| CTGCACTAAAAGCCTCTCTG+TGG | 0.673003 | 4:-23075641 | None:intergenic |
| AAGACTGTGACAGTGAGATG+TGG | 0.685505 | 4:+23073100 | MsaT019113.1:CDS |
| TTGATGATGAACACAATGAG+AGG | 0.686722 | 4:+23073650 | MsaT019113.1:CDS |
| TCCTGATATAAGCCACAGAG+AGG | 0.691291 | 4:+23075629 | MsaT019113.1:CDS |
| ATAAGTCCGAAATGAATGTG+TGG | 0.723401 | 4:-23075868 | None:intergenic |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| Chr4 | gene | 23072849 | 23076146 | 23072849 | ID=MsaG019113 |
| Chr4 | mRNA | 23072849 | 23076146 | 23072849 | ID=MsaT019113.1;Parent=MsaG019113 |
| Chr4 | exon | 23072849 | 23072962 | 23072849 | ID=MsaT019113.1.exon1;Parent=MsaT019113.1 |
| Chr4 | CDS | 23072849 | 23072962 | 23072849 | ID=cds.MsaT019113.1;Parent=MsaT019113.1 |
| Chr4 | exon | 23073073 | 23073225 | 23073073 | ID=MsaT019113.1.exon2;Parent=MsaT019113.1 |
| Chr4 | CDS | 23073073 | 23073225 | 23073073 | ID=cds.MsaT019113.1;Parent=MsaT019113.1 |
| Chr4 | exon | 23073587 | 23073716 | 23073587 | ID=MsaT019113.1.exon3;Parent=MsaT019113.1 |
| Chr4 | CDS | 23073587 | 23073716 | 23073587 | ID=cds.MsaT019113.1;Parent=MsaT019113.1 |
| Chr4 | exon | 23074666 | 23074714 | 23074666 | ID=MsaT019113.1.exon4;Parent=MsaT019113.1 |
| Chr4 | CDS | 23074666 | 23074714 | 23074666 | ID=cds.MsaT019113.1;Parent=MsaT019113.1 |
| Chr4 | exon | 23075599 | 23075674 | 23075599 | ID=MsaT019113.1.exon5;Parent=MsaT019113.1 |
| Chr4 | CDS | 23075599 | 23075674 | 23075599 | ID=cds.MsaT019113.1;Parent=MsaT019113.1 |
| Chr4 | exon | 23075856 | 23075930 | 23075856 | ID=MsaT019113.1.exon6;Parent=MsaT019113.1 |
| Chr4 | CDS | 23075856 | 23075930 | 23075856 | ID=cds.MsaT019113.1;Parent=MsaT019113.1 |
| Chr4 | exon | 23076078 | 23076146 | 23076078 | ID=MsaT019113.1.exon7;Parent=MsaT019113.1 |
| Chr4 | CDS | 23076078 | 23076146 | 23076078 | ID=cds.MsaT019113.1;Parent=MsaT019113.1 |
| Gene Sequence |
| Protein sequence |