Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG019527 | XP_024636235.1 | 94.650 | 243 | 13 | 0 | 1 | 243 | 1 | 243 | 1.25e-171 | 482 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG019527 | sp|Q9M202|ZAT9_ARATH | 30.566 | 265 | 116 | 6 | 9 | 229 | 6 | 246 | 6.01e-18 | 84.0 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG019527 | tr|A0A396I2K7|A0A396I2K7_MEDTR | 67.347 | 245 | 74 | 1 | 1 | 239 | 1 | 245 | 1.12e-113 | 335 |
Gene ID | Type | Classification |
---|---|---|
MsaG019527 | TF | C2H2 |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000459 | MsaG019527 | 0.832257 | 1.895465e-55 | 5.855096e-53 |
MsaG000717 | MsaG019527 | 0.908603 | 3.423857e-81 | 2.957518e-77 |
MsaG000847 | MsaG019527 | 0.816669 | 8.527140e-52 | 1.719741e-49 |
MsaG001026 | MsaG019527 | 0.830661 | 4.661868e-55 | 1.374871e-52 |
MsaG001551 | MsaG019527 | 0.872205 | 7.795570e-67 | 9.923198e-64 |
MsaG001939 | MsaG019527 | 0.866315 | 6.261223e-65 | 6.235164e-62 |
MsaG002043 | MsaG019527 | 0.840179 | 1.878424e-57 | 7.373976e-55 |
MsaG002379 | MsaG019527 | 0.886807 | 5.379096e-72 | 1.346963e-68 |
MsaG002489 | MsaG019527 | 0.877820 | 9.677841e-69 | 1.579795e-65 |
MsaG002603 | MsaG019527 | 0.884308 | 4.598359e-71 | 1.018484e-67 |
MsaG003420 | MsaG019527 | 0.858422 | 1.627736e-62 | 1.192410e-59 |
MsaG003665 | MsaG019527 | 0.822617 | 3.794257e-53 | 8.946354e-51 |
MsaG003767 | MsaG019527 | 0.810491 | 1.921114e-50 | 3.320282e-48 |
MsaG003861 | MsaG019527 | 0.878791 | 4.433016e-69 | 7.567553e-66 |
MsaG004006 | MsaG019527 | 0.886359 | 7.927739e-72 | 1.941579e-68 |
MsaG003932 | MsaG019527 | 0.842157 | 5.705320e-58 | 2.384401e-55 |
MsaG003936 | MsaG019527 | 0.833831 | 7.726672e-56 | 2.499270e-53 |
MsaG004107 | MsaG019527 | 0.904482 | 2.754235e-79 | 1.839032e-75 |
MsaG004184 | MsaG019527 | 0.866518 | 5.399441e-65 | 5.421504e-62 |
MsaG004382 | MsaG019527 | 0.821575 | 6.599666e-53 | 1.513284e-50 |
MsaG004388 | MsaG019527 | 0.833202 | 1.106694e-55 | 3.514554e-53 |
MsaG004452 | MsaG019527 | 0.876576 | 2.606250e-68 | 4.021142e-65 |
MsaG004556 | MsaG019527 | 0.826584 | 4.459828e-54 | 1.172196e-51 |
MsaG005060 | MsaG019527 | 0.850271 | 3.601885e-60 | 1.970155e-57 |
MsaG005062 | MsaG019527 | 0.853569 | 4.215810e-61 | 2.587876e-58 |
MsaG005280 | MsaG019527 | 0.810196 | 2.222516e-50 | 3.813554e-48 |
MsaG005336 | MsaG019527 | 0.809985 | 2.466859e-50 | 4.211177e-48 |
MsaG005423 | MsaG019527 | 0.832865 | 1.341243e-55 | 4.217182e-53 |
MsaG005526 | MsaG019527 | 0.845393 | 7.838555e-59 | 3.638707e-56 |
MsaG005603 | MsaG019527 | 0.849827 | 4.788030e-60 | 2.579698e-57 |
MsaG005869 | MsaG019527 | 0.872662 | 5.494595e-67 | 7.133538e-64 |
MsaG006030 | MsaG019527 | 0.831359 | 3.148517e-55 | 9.474462e-53 |
MsaG005917 | MsaG019527 | 0.805377 | 2.324521e-49 | 3.555131e-47 |
MsaG006245 | MsaG019527 | 0.853653 | 3.990081e-61 | 2.456660e-58 |
MsaG006324 | MsaG019527 | 0.818656 | 3.052783e-52 | 6.481096e-50 |
MsaG006471 | MsaG019527 | 0.857805 | 2.478483e-62 | 1.774358e-59 |
MsaG006500 | MsaG019527 | 0.801961 | 1.180248e-48 | 1.668137e-46 |
MsaG006620 | MsaG019527 | 0.804777 | 3.099922e-49 | 4.675356e-47 |
MsaG006809 | MsaG019527 | 0.847687 | 1.866732e-59 | 9.354466e-57 |
MsaG007091 | MsaG019527 | 0.839899 | 2.220167e-57 | 8.640055e-55 |
MsaG007534 | MsaG019527 | 0.829033 | 1.157003e-54 | 3.257060e-52 |
MsaG007630 | MsaG019527 | 0.812711 | 6.355516e-51 | 1.160045e-48 |
MsaG007828 | MsaG019527 | 0.810885 | 1.580787e-50 | 2.758394e-48 |
MsaG007982 | MsaG019527 | 0.825069 | 1.016669e-53 | 2.562337e-51 |
MsaG008234 | MsaG019527 | 0.800589 | 2.246111e-48 | 3.077563e-46 |
MsaG008561 | MsaG019527 | 0.863584 | 4.458684e-64 | 3.982165e-61 |
MsaG008619 | MsaG019527 | 0.895238 | 2.605730e-75 | 1.016394e-71 |
MsaG009656 | MsaG019527 | 0.812018 | 8.993148e-51 | 1.613489e-48 |
MsaG011560 | MsaG019527 | 0.854983 | 1.654048e-61 | 1.067867e-58 |
MsaG011831 | MsaG019527 | 0.844823 | 1.115391e-58 | 5.081642e-56 |
MsaG011887 | MsaG019527 | 0.803130 | 6.792343e-49 | 9.861116e-47 |
MsaG012294 | MsaG019527 | 0.823533 | 2.325392e-53 | 5.620504e-51 |
MsaG012549 | MsaG019527 | 0.863915 | 3.522389e-64 | 3.186732e-61 |
MsaG012723 | MsaG019527 | 0.845351 | 8.045061e-59 | 3.729336e-56 |
MsaG013271 | MsaG019527 | 0.857860 | 2.387843e-62 | 1.712923e-59 |
MsaG013839 | MsaG019527 | 0.806932 | 1.098093e-49 | 1.741965e-47 |
MsaG014076 | MsaG019527 | 0.802259 | 1.025666e-48 | 1.459527e-46 |
MsaG014855 | MsaG019527 | 0.829639 | 8.257560e-55 | 2.365324e-52 |
MsaG015018 | MsaG019527 | 0.802502 | 9.143581e-49 | 1.308450e-46 |
MsaG015371 | MsaG019527 | 0.826517 | 4.624989e-54 | 1.213396e-51 |
MsaG015493 | MsaG019527 | 0.830129 | 6.280778e-55 | 1.824460e-52 |
MsaG015871 | MsaG019527 | 0.807449 | 8.543930e-50 | 1.372121e-47 |
MsaG016209 | MsaG019527 | 0.836952 | 1.267859e-56 | 4.503142e-54 |
MsaG016215 | MsaG019527 | 0.842431 | 4.831682e-58 | 2.037254e-55 |
MsaG016327 | MsaG019527 | 0.917327 | 1.529205e-85 | 2.377203e-81 |
MsaG016419 | MsaG019527 | 0.842399 | 4.927351e-58 | 2.075429e-55 |
MsaG016471 | MsaG019527 | 0.871039 | 1.889198e-66 | 2.287805e-63 |
MsaG016663 | MsaG019527 | 0.843380 | 2.709116e-58 | 1.177568e-55 |
MsaG016695 | MsaG019527 | 0.803748 | 5.065145e-49 | 7.459425e-47 |
MsaG016884 | MsaG019527 | 0.895809 | 1.518219e-75 | 6.111430e-72 |
MsaG017009 | MsaG019527 | 0.884044 | 5.755764e-71 | 1.258761e-67 |
MsaG017051 | MsaG019527 | 0.847959 | 1.572064e-59 | 7.950513e-57 |
MsaG017068 | MsaG019527 | 0.854136 | 2.900539e-61 | 1.817007e-58 |
MsaG017081 | MsaG019527 | 0.805169 | 2.569013e-49 | 3.910217e-47 |
MsaG017189 | MsaG019527 | 0.811198 | 1.352892e-50 | 2.378899e-48 |
MsaG017324 | MsaG019527 | 0.826230 | 5.410219e-54 | 1.408059e-51 |
MsaG017431 | MsaG019527 | 0.800552 | 2.284660e-48 | 3.127819e-46 |
MsaG017644 | MsaG019527 | 0.852156 | 1.063649e-60 | 6.212738e-58 |
MsaG017699 | MsaG019527 | 0.851429 | 1.706275e-60 | 9.714771e-58 |
MsaG017719 | MsaG019527 | 0.813249 | 4.850831e-51 | 8.973602e-49 |
MsaG017827 | MsaG019527 | 0.857029 | 4.194278e-62 | 2.917082e-59 |
MsaG017828 | MsaG019527 | 0.855412 | 1.242437e-61 | 8.146960e-59 |
MsaG017954 | MsaG019527 | 0.892899 | 2.307966e-74 | 7.935167e-71 |
MsaG017983 | MsaG019527 | 0.909140 | 1.903825e-81 | 1.702000e-77 |
MsaG018035 | MsaG019527 | 0.862889 | 7.298741e-64 | 6.342155e-61 |
MsaG018054 | MsaG019527 | 0.815240 | 1.770557e-51 | 3.443605e-49 |
MsaG018085 | MsaG019527 | 0.830317 | 5.654599e-55 | 1.651370e-52 |
MsaG018223 | MsaG019527 | 0.807803 | 7.190144e-50 | 1.164584e-47 |
MsaG018286 | MsaG019527 | 0.806639 | 1.265322e-49 | 1.993553e-47 |
MsaG018777 | MsaG019527 | 0.844137 | 1.702873e-58 | 7.585039e-56 |
MsaG019120 | MsaG019527 | 0.889001 | 7.834615e-73 | 2.192404e-69 |
MsaG019160 | MsaG019527 | 0.875851 | 4.618408e-68 | 6.898572e-65 |
MsaG019223 | MsaG019527 | 0.884554 | 3.732568e-71 | 8.364328e-68 |
MsaG019466 | MsaG019527 | 0.833398 | 9.894648e-56 | 3.160322e-53 |
MsaG019527 | MsaG019638 | 0.823712 | 2.112848e-53 | 5.131846e-51 |
MsaG019527 | MsaG019720 | 0.831824 | 2.421694e-55 | 7.387834e-53 |
MsaG019527 | MsaG019907 | 0.879682 | 2.152333e-69 | 3.827804e-66 |
MsaG019527 | MsaG019936 | 0.850297 | 3.541684e-60 | 1.938949e-57 |
MsaG019527 | MsaG020021 | 0.880943 | 7.663055e-70 | 1.445570e-66 |
MsaG019527 | MsaG020233 | 0.835468 | 3.008396e-56 | 1.021922e-53 |
MsaG019527 | MsaG020240 | 0.813046 | 5.372407e-51 | 9.888451e-49 |
MsaG019527 | MsaG020382 | 0.887059 | 4.320519e-72 | 1.095440e-68 |
MsaG019527 | MsaG020548 | 0.812170 | 8.332793e-51 | 1.500589e-48 |
MsaG019527 | MsaG020550 | 0.812561 | 6.853145e-51 | 1.246231e-48 |
MsaG019527 | MsaG020733 | 0.888927 | 8.367137e-73 | 2.332216e-69 |
MsaG019527 | MsaG020992 | 0.816736 | 8.239715e-52 | 1.664689e-49 |
MsaG019527 | MsaG021200 | 0.802545 | 8.959801e-49 | 1.283431e-46 |
MsaG019527 | MsaG021222 | 0.814011 | 3.304244e-51 | 6.230375e-49 |
MsaG019527 | MsaG022811 | 0.906772 | 2.466622e-80 | 1.893921e-76 |
MsaG019527 | MsaG022899 | 0.807606 | 7.915796e-50 | 1.276007e-47 |
MsaG019527 | MsaG023188 | 0.911395 | 1.554348e-82 | 1.608545e-78 |
MsaG019527 | MsaG023563 | 0.821067 | 8.632825e-53 | 1.953084e-50 |
MsaG019527 | MsaG023649 | 0.874738 | 1.104412e-67 | 1.570132e-64 |
MsaG019527 | MsaG023711 | 0.862805 | 7.747223e-64 | 6.710202e-61 |
MsaG019527 | MsaG023716 | 0.862601 | 8.944321e-64 | 7.685377e-61 |
MsaG019527 | MsaG023729 | 0.837934 | 7.120948e-57 | 2.606394e-54 |
MsaG019527 | MsaG023793 | 0.882279 | 2.534225e-70 | 5.089135e-67 |
MsaG019527 | MsaG023794 | 0.807179 | 9.738287e-50 | 1.553938e-47 |
MsaG019527 | MsaG023834 | 0.852907 | 6.512426e-61 | 3.905404e-58 |
MsaG019527 | MsaG023861 | 0.852911 | 6.495178e-61 | 3.895665e-58 |
MsaG019527 | MsaG024134 | 0.853776 | 3.678510e-61 | 2.274940e-58 |
MsaG019527 | MsaG024295 | 0.804158 | 4.166068e-49 | 6.193970e-47 |
MsaG019527 | MsaG024480 | 0.856811 | 4.859577e-62 | 3.353252e-59 |
MsaG019527 | MsaG025067 | 0.806336 | 1.464675e-49 | 2.291213e-47 |
MsaG019527 | MsaG025143 | 0.890827 | 1.528519e-73 | 4.703360e-70 |
MsaG019527 | MsaG025153 | 0.867785 | 2.137313e-65 | 2.259894e-62 |
MsaG019527 | MsaG025641 | 0.824253 | 1.579734e-53 | 3.893513e-51 |
MsaG019527 | MsaG026475 | 0.814687 | 2.346214e-51 | 4.499663e-49 |
MsaG019527 | MsaG026686 | 0.859703 | 6.754227e-63 | 5.192417e-60 |
MsaG019527 | MsaG026692 | 0.843346 | 2.765345e-58 | 1.200746e-55 |
MsaG019527 | MsaG026786 | 0.806045 | 1.685316e-49 | 2.618193e-47 |
MsaG019527 | MsaG027170 | 0.873170 | 3.721820e-67 | 4.940246e-64 |
MsaG019527 | MsaG027198 | 0.888574 | 1.143776e-72 | 3.131512e-69 |
MsaG019527 | MsaG027207 | 0.878439 | 5.886885e-69 | 9.883526e-66 |
MsaG019527 | MsaG027210 | 0.898559 | 1.075876e-76 | 5.060117e-73 |
MsaG019527 | MsaG027291 | 0.861040 | 2.672735e-63 | 2.161995e-60 |
MsaG019527 | MsaG027483 | 0.831787 | 2.472726e-55 | 7.535465e-53 |
MsaG019527 | MsaG027511 | 0.805226 | 2.499007e-49 | 3.808644e-47 |
MsaG019527 | MsaG027572 | 0.809136 | 3.745893e-50 | 6.265081e-48 |
MsaG019527 | MsaG027738 | 0.800192 | 2.703047e-48 | 3.670488e-46 |
MsaG019527 | MsaG027828 | 0.920943 | 1.732158e-87 | 3.497544e-83 |
MsaG019527 | MsaG027963 | 0.838012 | 6.800953e-57 | 2.495187e-54 |
MsaG019527 | MsaG028028 | 0.817423 | 5.784228e-52 | 1.189498e-49 |
MsaG019527 | MsaG028191 | 0.825721 | 7.136633e-54 | 1.831383e-51 |
MsaG019527 | MsaG028193 | 0.847837 | 1.697801e-59 | 8.551763e-57 |
MsaG019527 | MsaG028211 | 0.824070 | 1.743139e-53 | 4.275015e-51 |
MsaG019527 | MsaG028335 | 0.848029 | 1.504140e-59 | 7.625167e-57 |
MsaG019527 | MsaG028420 | 0.859140 | 9.951092e-63 | 7.488422e-60 |
MsaG019527 | MsaG028531 | 0.861850 | 1.517617e-63 | 1.266201e-60 |
MsaG019527 | MsaG028781 | 0.817267 | 6.267132e-52 | 1.283678e-49 |
MsaG019527 | MsaG029048 | 0.862860 | 7.452856e-64 | 6.468627e-61 |
MsaG019527 | MsaG029091 | 0.866316 | 6.253189e-65 | 6.227549e-62 |
MsaG019527 | MsaG029212 | 0.814982 | 2.018752e-51 | 3.900733e-49 |
MsaG019527 | MsaG029307 | 0.839687 | 2.519159e-57 | 9.738502e-55 |
MsaG019527 | MsaG029561 | 0.844161 | 1.677409e-58 | 7.477441e-56 |
MsaG019527 | MsaG029546 | 0.891798 | 6.330023e-74 | 2.050379e-70 |
MsaG019527 | MsaG029953 | 0.887323 | 3.430602e-72 | 8.817845e-69 |
MsaG019527 | MsaG029928 | 0.830048 | 6.573997e-55 | 1.905187e-52 |
MsaG019527 | MsaG030649 | 0.805507 | 2.184224e-49 | 3.350548e-47 |
MsaG019527 | MsaG031129 | 0.893185 | 1.772308e-74 | 6.185633e-71 |
MsaG019527 | MsaG032115 | 0.805122 | 2.627406e-49 | 3.994615e-47 |
MsaG019527 | MsaG032279 | 0.816670 | 8.521135e-52 | 1.718601e-49 |
MsaG019527 | MsaG032848 | 0.904223 | 3.606992e-79 | 2.371558e-75 |
MsaG019527 | MsaG032901 | 0.857574 | 2.899191e-62 | 2.057670e-59 |
MsaG019527 | MsaG033781 | 0.808955 | 4.094990e-50 | 6.819053e-48 |
MsaG019527 | MsaG034217 | 0.842793 | 3.875755e-58 | 1.653252e-55 |
MsaG019527 | MsaG034108 | 0.822331 | 4.418438e-53 | 1.033836e-50 |
MsaG019527 | MsaG034590 | 0.833177 | 1.123038e-55 | 3.563789e-53 |
MsaG019527 | MsaG034977 | 0.803560 | 5.538292e-49 | 8.120766e-47 |
MsaG019527 | MsaG034974 | 0.803011 | 7.185147e-49 | 1.040287e-46 |
MsaG019527 | MsaG035156 | 0.801551 | 1.430958e-48 | 2.003752e-46 |
MsaG019527 | MsaG035277 | 0.811714 | 1.046588e-50 | 1.863730e-48 |
MsaG019527 | MsaG035380 | 0.808836 | 4.340440e-50 | 7.207187e-48 |
MsaG019527 | MsaG035984 | 0.838601 | 4.802568e-57 | 1.794614e-54 |
MsaG019527 | MsaG036065 | 0.827786 | 2.306207e-54 | 6.268838e-52 |
MsaG019527 | MsaG036279 | 0.850515 | 3.078516e-60 | 1.698299e-57 |
MsaG019527 | MsaG036335 | 0.840485 | 1.563318e-57 | 6.196487e-55 |
MsaG019527 | MsaG036447 | 0.805479 | 2.213391e-49 | 3.393153e-47 |
MsaG019527 | MsaG038749 | 0.804084 | 4.315975e-49 | 6.406006e-47 |
MsaG019527 | MsaG039734 | 0.834108 | 6.590006e-56 | 2.149204e-53 |
MsaG019527 | MsaG040270 | 0.839097 | 3.579739e-57 | 1.358502e-54 |
MsaG019527 | MsaG040504 | 0.864849 | 1.805970e-64 | 1.695994e-61 |
MsaG019527 | MsaG040577 | 0.906271 | 4.203576e-80 | 3.130876e-76 |
MsaG019527 | MsaG040598 | 0.816395 | 9.813049e-52 | 1.965317e-49 |
MsaG019527 | MsaG040600 | 0.832572 | 1.584500e-55 | 4.939608e-53 |
MsaG019527 | MsaG041229 | 0.810013 | 2.432930e-50 | 4.156085e-48 |
MsaG019527 | MsaG041717 | 0.815113 | 1.888792e-51 | 3.661542e-49 |
MsaG019527 | MsaG041754 | 0.888289 | 1.470709e-72 | 3.967927e-69 |
MsaG019527 | MsaG041800 | 0.844108 | 1.733174e-58 | 7.712660e-56 |
MsaG019527 | MsaG042928 | 0.836291 | 1.864355e-56 | 6.491743e-54 |
MsaG019527 | MsaG042996 | 0.814699 | 2.331379e-51 | 4.472653e-49 |
MsaG019527 | MsaG043725 | 0.868642 | 1.135018e-65 | 1.243126e-62 |
MsaG019527 | MsaG043788 | 0.828100 | 1.939068e-54 | 5.317603e-52 |
MsaG019527 | MsaG043817 | 0.813872 | 3.543459e-51 | 6.658537e-49 |
MsaG019527 | MsaG044117 | 0.857286 | 3.523210e-62 | 2.474097e-59 |
MsaG019527 | MsaG044104 | 0.803101 | 6.884962e-49 | 9.989099e-47 |
MsaG019527 | MsaG044200 | 0.870654 | 2.526014e-66 | 3.008650e-63 |
MsaG019527 | MsaG044688 | 0.823983 | 1.826450e-53 | 4.468741e-51 |
MsaG019527 | MsaG044997 | 0.815632 | 1.450315e-51 | 2.848831e-49 |
MsaG019527 | MsaG045284 | 0.817674 | 5.080171e-52 | 1.051445e-49 |
MsaG019527 | MsaG045581 | 0.833452 | 9.596854e-56 | 3.070092e-53 |
MsaG019527 | MsaG045819 | 0.897702 | 2.475888e-76 | 1.109522e-72 |
MsaG019527 | MsaG045969 | 0.873011 | 4.204090e-67 | 5.541275e-64 |
MsaG019527 | MsaG046123 | 0.811143 | 1.390511e-50 | 2.441764e-48 |
MsaG019527 | MsaG046173 | 0.892908 | 2.288831e-74 | 7.873310e-71 |
MsaG019527 | MsaG046206 | 0.851610 | 1.517082e-60 | 8.691687e-58 |
MsaG019527 | MsaG046522 | 0.855146 | 1.483486e-61 | 9.634155e-59 |
MsaG019527 | MsaG046501 | 0.892934 | 2.235769e-74 | 7.700590e-71 |
MsaG019527 | MsaG046503 | 0.821448 | 7.059784e-53 | 1.613333e-50 |
MsaG019527 | MsaG046589 | 0.852066 | 1.128027e-60 | 6.568304e-58 |
MsaG019527 | MsaG046603 | 0.827713 | 2.400064e-54 | 6.510720e-52 |
MsaG019527 | MsaG046902 | 0.877405 | 1.348452e-68 | 2.159567e-65 |
MsaG019527 | MsaG046939 | 0.868970 | 8.897224e-66 | 9.876117e-63 |
MsaG019527 | MsaG046927 | 0.800797 | 2.038024e-48 | 2.805624e-46 |
MsaG019527 | MsaG046975 | 0.869925 | 4.366204e-66 | 5.044086e-63 |
MsaG019527 | MsaG047077 | 0.809545 | 3.064844e-50 | 5.176788e-48 |
MsaG019527 | MsaG047097 | 0.875507 | 6.052072e-68 | 8.901683e-65 |
MsaG019527 | MsaG002654 | 0.875309 | 7.072511e-68 | 1.030969e-64 |
MsaG019527 | MsaG005167 | 0.823037 | 3.032738e-53 | 7.232497e-51 |
MsaG019527 | MsaG002617 | 0.805637 | 2.051923e-49 | 3.157288e-47 |
MsaG019527 | MsaG011183 | 0.802320 | 9.961516e-49 | 1.419615e-46 |
MsaG019527 | MsaG006148 | 0.863496 | 4.745482e-64 | 4.223557e-61 |
MsaG019527 | MsaG012744 | 0.812582 | 6.782755e-51 | 1.234060e-48 |
MsaG019527 | MsaG013496 | 0.826511 | 4.641343e-54 | 1.217478e-51 |
MsaG019527 | MsaG012993 | 0.817766 | 4.843444e-52 | 1.004860e-49 |
MsaG019527 | MsaG022046 | 0.852308 | 9.634709e-61 | 5.657875e-58 |
MsaG019527 | MsaG023179 | 0.804314 | 3.867343e-49 | 5.770663e-47 |
MsaG019527 | MsaG020399 | 0.826443 | 4.816345e-54 | 1.261055e-51 |
MsaG019527 | MsaG018912 | 0.871725 | 1.123314e-66 | 1.400699e-63 |
MsaG019527 | MsaG020128 | 0.864943 | 1.687093e-64 | 1.590288e-61 |
MsaG019527 | MsaG022828 | 0.815857 | 1.292657e-51 | 2.553610e-49 |
MsaG019527 | MsaG019847 | 0.881340 | 5.523964e-70 | 1.061207e-66 |
MsaG019527 | MsaG025092 | 0.831498 | 2.910475e-55 | 8.794200e-53 |
MsaG019527 | MsaG029390 | 0.884041 | 5.766650e-71 | 1.261001e-67 |
MsaG019527 | MsaG026803 | 0.849059 | 7.822223e-60 | 4.105745e-57 |
MsaG019527 | MsaG026407 | 0.830631 | 4.742142e-55 | 1.397317e-52 |
MsaG019527 | MsaG028079 | 0.874484 | 1.346072e-67 | 1.892735e-64 |
MsaG019527 | MsaG033602 | 0.907152 | 1.643885e-80 | 1.293716e-76 |
MsaG019527 | MsaG031012 | 0.805256 | 2.463606e-49 | 3.757227e-47 |
MsaG019527 | MsaG032886 | 0.825104 | 9.977244e-54 | 2.516970e-51 |
MsaG019527 | MsaG034655 | 0.846857 | 3.144721e-59 | 1.532554e-56 |
MsaG019527 | MsaG033082 | 0.836425 | 1.724918e-56 | 6.030546e-54 |
MsaG019527 | MsaG032525 | 0.834684 | 4.732527e-56 | 1.570364e-53 |
MsaG019527 | MsaG031503 | 0.800084 | 2.843026e-48 | 3.851203e-46 |
MsaG019527 | MsaG030566 | 0.822918 | 3.231286e-53 | 7.681262e-51 |
MsaG019527 | MsaG032799 | 0.802733 | 8.197385e-49 | 1.179232e-46 |
MsaG019527 | MsaG031638 | 0.801138 | 1.737256e-48 | 2.409964e-46 |
MsaG019527 | MsaG033259 | 0.843937 | 1.925442e-58 | 8.519551e-56 |
MsaG019527 | MsaG038885 | 0.802109 | 1.100718e-48 | 1.560944e-46 |
MsaG019527 | MsaG036286 | 0.878053 | 8.025114e-69 | 1.324003e-65 |
MsaG019527 | MsaG036043 | 0.872970 | 4.338943e-67 | 5.708442e-64 |
MsaG019527 | MsaG035600 | 0.819606 | 1.860570e-52 | 4.049356e-50 |
MsaG019527 | MsaG037161 | 0.800815 | 2.020919e-48 | 2.783137e-46 |
MsaG019527 | MsaG037383 | 0.810576 | 1.842306e-50 | 3.190588e-48 |
MsaG019527 | MsaG037531 | 0.844953 | 1.029673e-58 | 4.711495e-56 |
MsaG019527 | MsaG036685 | 0.833692 | 8.365013e-56 | 2.695027e-53 |
MsaG019527 | MsaG039797 | 0.814956 | 2.045986e-51 | 3.950721e-49 |
MsaG019527 | MsaG036758 | 0.865843 | 8.813015e-65 | 8.611765e-62 |
MsaG019527 | MsaG041442 | 0.875378 | 6.698691e-68 | 9.794118e-65 |
MsaG019527 | MsaG044977 | 0.827692 | 2.428542e-54 | 6.583956e-52 |
MsaG019527 | MsaG044531 | 0.847872 | 1.660597e-59 | 8.374174e-57 |
MsaG019527 | MsaG043142 | 0.818429 | 3.436119e-52 | 7.251598e-50 |
MsaG019527 | MsaG046854 | 0.815517 | 1.537601e-51 | 3.011442e-49 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG019527 | MtrunA17_Chr4g0018761 | 67.347 | 245 | 74 | 1 | 1 | 239 | 1 | 245 | 2.16e-117 | 335 |
MsaG019527 | MtrunA17_Chr4g0018741 | 80.769 | 104 | 20 | 0 | 78 | 181 | 1 | 104 | 1.43e-56 | 176 |
MsaG019527 | MtrunA17_Chr3g0079061 | 26.038 | 265 | 158 | 6 | 3 | 229 | 2 | 266 | 1.72e-16 | 76.6 |
MsaG019527 | MtrunA17_Chr3g0079131 | 25.806 | 279 | 139 | 7 | 7 | 232 | 6 | 269 | 1.86e-16 | 76.6 |
MsaG019527 | MtrunA17_Chr4g0056091 | 59.322 | 59 | 22 | 1 | 173 | 229 | 210 | 268 | 4.77e-14 | 70.5 |
MsaG019527 | MtrunA17_Chr7g0231181 | 41.975 | 81 | 37 | 1 | 170 | 240 | 239 | 319 | 6.68e-14 | 70.1 |
MsaG019527 | MtrunA17_Chr3g0079091 | 35.484 | 124 | 74 | 3 | 3 | 121 | 2 | 124 | 1.69e-12 | 63.9 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG019527 | AT3G60580.1 | 30.566 | 265 | 116 | 6 | 9 | 229 | 6 | 246 | 6.11e-19 | 84.0 |
MsaG019527 | AT1G02030.1 | 45.570 | 79 | 30 | 2 | 171 | 236 | 160 | 238 | 1.84e-13 | 68.6 |
MsaG019527 | AT5G61470.1 | 43.836 | 73 | 29 | 2 | 168 | 229 | 225 | 296 | 1.24e-12 | 66.6 |
Find 64 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
TTGAACACTTTGTTGCAATT+TGG | 0.166386 | 4:+30164657 | None:intergenic |
TTCTGTGTTTGTTGTATTTC+GGG | 0.187551 | 4:+30165086 | None:intergenic |
ATTCTGTGTTTGTTGTATTT+CGG | 0.237824 | 4:+30165085 | None:intergenic |
AATTGGATCTCTTGCGGGTT+GGG | 0.313326 | 4:+30164982 | None:intergenic |
TGAACACTTTGTTGCAATTT+GGG | 0.315013 | 4:+30164658 | None:intergenic |
TGAGTATTAGTTTCAAGCTT+TGG | 0.337317 | 4:+30165176 | None:intergenic |
GCCGCAATTGGATCTCTTGC+GGG | 0.342035 | 4:+30164977 | None:intergenic |
GTACACTCTTCCAGTGCTAA+TGG | 0.389630 | 4:-30164603 | MsaT019527.1:CDS |
CAATTGGATCTCTTGCGGGT+TGG | 0.402481 | 4:+30164981 | None:intergenic |
TACTCAAGCTGTAGACAATT+CGG | 0.436960 | 4:-30165159 | MsaT019527.1:CDS |
ATTAAGTTCGCGGCCGCAAT+TGG | 0.437633 | 4:+30164965 | None:intergenic |
ATTTGTGGGAAGTGGTTCTC+CGG | 0.453707 | 4:-30165254 | MsaT019527.1:CDS |
GTTTCAAGCTTTGGAGCAAT+CGG | 0.454553 | 4:+30165185 | None:intergenic |
TTCCGATCTTATCAGGCTCT+TGG | 0.457389 | 4:-30164747 | MsaT019527.1:CDS |
TTCTCCGGTGGGAAAGCCCT+TGG | 0.463478 | 4:-30165239 | MsaT019527.1:CDS |
TTGCAATTTGGGCAGTGAAA+AGG | 0.463868 | 4:+30164669 | None:intergenic |
GGAAAGCCTGTGGGATTTGT+GGG | 0.467351 | 4:-30165268 | MsaT019527.1:CDS |
GGGAAAGCCTGTGGGATTTG+TGG | 0.468727 | 4:-30165269 | MsaT019527.1:CDS |
CGATCTTATCAGGCTCTTGG+TGG | 0.468794 | 4:-30164744 | MsaT019527.1:CDS |
GCCTCCAAGGGCTTTCCCAC+CGG | 0.472807 | 4:+30165235 | None:intergenic |
AGATCTCATGTGGCCTCCAA+GGG | 0.485485 | 4:+30165223 | None:intergenic |
TACTGCAAAAGAGGCAATGA+TGG | 0.488382 | 4:-30164711 | MsaT019527.1:CDS |
TCCGGTGGGAAAGCCCTTGG+AGG | 0.494800 | 4:-30165236 | MsaT019527.1:CDS |
TTCAAGTCTGCTCAGGCACT+CGG | 0.500253 | 4:-30164639 | MsaT019527.1:CDS |
CCCCATAACATCAAAACACC+TGG | 0.500612 | 4:+30164909 | None:intergenic |
GGCCGCAATTGGATCTCTTG+CGG | 0.503301 | 4:+30164976 | None:intergenic |
TCTGTTTGAGTTTGCAGAGG+AGG | 0.504442 | 4:+30165034 | None:intergenic |
AACGATGGCGAAAGCAGTAC+AGG | 0.507873 | 4:-30164831 | MsaT019527.1:CDS |
AGCAAATTGATTTCGACGAT+GGG | 0.509489 | 4:+30165127 | None:intergenic |
GCACCTCTCACAGTTGAACC+TGG | 0.509618 | 4:+30164779 | None:intergenic |
ATTTCGACGATGGGTTGAAT+CGG | 0.510947 | 4:+30165136 | None:intergenic |
CAGCCGCAGCATTAAGTTCG+CGG | 0.512384 | 4:+30164955 | None:intergenic |
TTCTCTGTTTGAGTTTGCAG+AGG | 0.512537 | 4:+30165031 | None:intergenic |
GAGATCTCATGTGGCCTCCA+AGG | 0.514030 | 4:+30165222 | None:intergenic |
GAAGATATGTCAAGAGATCC+AGG | 0.516117 | 4:-30164927 | MsaT019527.1:CDS |
TGTGGGAAGTGGTTCTCCGG+TGG | 0.517822 | 4:-30165251 | MsaT019527.1:CDS |
CAAAGTGTTCAAGTCTGCTC+AGG | 0.524975 | 4:-30164646 | MsaT019527.1:CDS |
CACAGAGTATACTGCAAAAG+AGG | 0.526500 | 4:-30164720 | MsaT019527.1:CDS |
CACAAGCAGACTCTGAAGCC+AGG | 0.539423 | 4:-30164797 | MsaT019527.1:CDS |
GGGGACTTGAAAATTCAATA+CGG | 0.545028 | 4:+30164561 | None:intergenic |
ACTTTGAAATCCATTAGCAC+TGG | 0.550464 | 4:+30164593 | None:intergenic |
AAGCAAATTGATTTCGACGA+TGG | 0.551421 | 4:+30165126 | None:intergenic |
GTGTTTGTTGTATTTCGGGA+AGG | 0.552910 | 4:+30165090 | None:intergenic |
CCTGTGGGATTTGTGGGAAG+TGG | 0.558125 | 4:-30165262 | MsaT019527.1:CDS |
GGGACTTGAAAATTCAATAC+GGG | 0.558578 | 4:+30164562 | None:intergenic |
GTGGGAAGTGGTTCTCCGGT+GGG | 0.561353 | 4:-30165250 | MsaT019527.1:CDS |
TTGAAAATTCAATACGGGTG+TGG | 0.569607 | 4:+30164567 | None:intergenic |
GATCTTATCAGGCTCTTGGT+GGG | 0.571526 | 4:-30164743 | MsaT019527.1:CDS |
GCAACTATGGAGAAGAGCGA+TGG | 0.579019 | 4:-30165290 | None:intergenic |
CACCAAGAGCCTGATAAGAT+CGG | 0.582662 | 4:+30164745 | None:intergenic |
AAGAGCGATGGGAAAGCCTG+TGG | 0.598960 | 4:-30165278 | MsaT019527.1:CDS |
AGGCACTCGGTGGACACAAG+AGG | 0.606213 | 4:-30164626 | MsaT019527.1:CDS |
CAACTATGGAGAAGAGCGAT+GGG | 0.616240 | 4:-30165289 | None:intergenic |
AAGCCAGGTTCAACTGTGAG+AGG | 0.622627 | 4:-30164782 | MsaT019527.1:CDS |
GGCACTCGGTGGACACAAGA+GGG | 0.632635 | 4:-30164625 | MsaT019527.1:CDS |
CCACTTCCCACAAATCCCAC+AGG | 0.647858 | 4:+30165262 | None:intergenic |
AGAGCGATGGGAAAGCCTGT+GGG | 0.654994 | 4:-30165277 | MsaT019527.1:CDS |
CGGCCGCGAACTTAATGCTG+CGG | 0.660556 | 4:-30164958 | MsaT019527.1:CDS |
AGGTTCAACTGTGAGAGGTG+CGG | 0.663022 | 4:-30164777 | MsaT019527.1:CDS |
TTCGGGAAGGCAAGTCTGTG+AGG | 0.669270 | 4:+30165103 | None:intergenic |
AAGTCTGCTCAGGCACTCGG+TGG | 0.670340 | 4:-30164636 | MsaT019527.1:CDS |
AGGCCACATGAGATCTCACA+TGG | 0.682156 | 4:-30165216 | MsaT019527.1:CDS |
ACCCGCAAGAGATCCAATTG+CGG | 0.686880 | 4:-30164978 | MsaT019527.1:CDS |
GAACCATGTGAGATCTCATG+TGG | 0.730676 | 4:+30165213 | None:intergenic |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr4 | gene | 30164575 | 30165306 | 30164575 | ID=MsaG019527 |
Chr4 | mRNA | 30164575 | 30165306 | 30164575 | ID=MsaT019527.1;Parent=MsaG019527 |
Chr4 | exon | 30164575 | 30165306 | 30164575 | ID=MsaT019527.1.exon1;Parent=MsaT019527.1 |
Chr4 | CDS | 30164575 | 30165306 | 30164575 | ID=cds.MsaT019527.1;Parent=MsaT019527.1 |
Gene Sequence |
Protein sequence |