Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG020040 | XP_039687084.1 | 81.148 | 122 | 12 | 1 | 1 | 111 | 1 | 122 | 2.20e-62 | 196 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG020040 | tr|G7INX6|G7INX6_MEDTR | 81.148 | 122 | 12 | 1 | 1 | 111 | 1 | 122 | 1.05e-62 | 196 |
| Gene ID | Type | Classification |
|---|---|---|
| MsaG020040 | TF | B3 |
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG020040 | MtrunA17_Chr2g0281511 | 81.148 | 122 | 12 | 1 | 1 | 111 | 1 | 122 | 2.02e-66 | 196 |
| MsaG020040 | MtrunA17_Chr2g0309121 | 74.590 | 122 | 19 | 2 | 1 | 111 | 1 | 121 | 1.52e-58 | 176 |
| MsaG020040 | MtrunA17_Chr3g0081891 | 78.750 | 80 | 6 | 1 | 1 | 69 | 1 | 80 | 2.45e-37 | 121 |
| MsaG020040 | MtrunA17_Chr7g0276661 | 30.534 | 131 | 62 | 3 | 7 | 109 | 38 | 167 | 1.35e-16 | 70.9 |
| MsaG020040 | MtrunA17_Chr5g0430431 | 38.235 | 68 | 42 | 0 | 38 | 105 | 187 | 254 | 6.66e-12 | 60.1 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Find 21 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| GAAGTCAATGGTACTGATTT+AGG | 0.173353 | 4:-43109549 | MsaT020040.1:CDS |
| CTTGAAAAGGGCCTAAAATT+TGG | 0.185070 | 4:-43109227 | MsaT020040.1:CDS |
| AAAATGTCGATGTTCATTAT+TGG | 0.262235 | 4:-43109518 | MsaT020040.1:CDS |
| TACCGGTTTCTTCATCAAAA+AGG | 0.272684 | 4:+43109330 | None:intergenic |
| TGTATGCTACCGTCGTTAAC+TGG | 0.297739 | 4:-43109163 | MsaT020040.1:CDS |
| AAGTCAATGGTACTGATTTA+GGG | 0.335811 | 4:-43109548 | MsaT020040.1:CDS |
| TAATGTTACTACTTCTGCTT+TGG | 0.339709 | 4:-43109490 | MsaT020040.1:CDS |
| CGGTCAATAATCCTTCTAAT+AGG | 0.358396 | 4:-43109187 | MsaT020040.1:CDS |
| ATCACAGTCATAAGATTTAC+CGG | 0.369848 | 4:+43109313 | None:intergenic |
| TTTGGATGGTAACAACGTTT+TGG | 0.386599 | 4:-43109472 | MsaT020040.1:intron |
| GTACGACTTTGTTCTTGAAA+AGG | 0.412286 | 4:-43109240 | MsaT020040.1:CDS |
| GTAGCATACATCCTATTAGA+AGG | 0.445852 | 4:+43109176 | None:intergenic |
| TACGACTTTGTTCTTGAAAA+GGG | 0.450393 | 4:-43109239 | MsaT020040.1:CDS |
| GTATGCTACCGTCGTTAACT+GGG | 0.522932 | 4:-43109162 | MsaT020040.1:CDS |
| GTTACTACTTCTGCTTTGGA+TGG | 0.538059 | 4:-43109486 | MsaT020040.1:CDS |
| AGCATGCATCAGAAATACAT+AGG | 0.544935 | 4:-43109272 | MsaT020040.1:CDS |
| AGAAATACATAGGGAGAGGA+TGG | 0.573439 | 4:-43109262 | MsaT020040.1:CDS |
| CATCAGAAATACATAGGGAG+AGG | 0.580360 | 4:-43109266 | MsaT020040.1:CDS |
| GCATGCATCAGAAATACATA+GGG | 0.580795 | 4:-43109271 | MsaT020040.1:CDS |
| GAGATTGGAGTTGAAGTCAA+TGG | 0.592580 | 4:-43109561 | MsaT020040.1:CDS |
| AAATCAGTCCCAGTTAACGA+CGG | 0.724437 | 4:+43109154 | None:intergenic |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| Chr4 | gene | 43109157 | 43109589 | 43109157 | ID=MsaG020040 |
| Chr4 | mRNA | 43109157 | 43109589 | 43109157 | ID=MsaT020040.1;Parent=MsaG020040 |
| Chr4 | exon | 43109157 | 43109375 | 43109157 | ID=MsaT020040.1.exon2;Parent=MsaT020040.1 |
| Chr4 | CDS | 43109157 | 43109375 | 43109157 | ID=cds.MsaT020040.1;Parent=MsaT020040.1 |
| Chr4 | exon | 43109473 | 43109589 | 43109473 | ID=MsaT020040.1.exon1;Parent=MsaT020040.1 |
| Chr4 | CDS | 43109473 | 43109589 | 43109473 | ID=cds.MsaT020040.1;Parent=MsaT020040.1 |
| Gene Sequence |
| Protein sequence |