Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG020346 | XP_003606099.1 | 97.468 | 79 | 2 | 0 | 1 | 79 | 98 | 176 | 1.21e-50 | 167 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG020346 | sp|Q3EAL1|OFP6_ARATH | 63.333 | 60 | 22 | 0 | 3 | 62 | 67 | 126 | 1.74e-21 | 85.1 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG020346 | tr|G7JHA0|G7JHA0_MEDTR | 97.468 | 79 | 2 | 0 | 1 | 79 | 98 | 176 | 5.79e-51 | 167 |
| Gene ID | Type | Classification |
|---|---|---|
| MsaG020346 | TF | OFP |
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| MsaG002718 | MsaG020346 | 0.821308 | 7.603214e-53 | 1.731113e-50 |
| MsaG004538 | MsaG020346 | 0.824366 | 1.486260e-53 | 3.674639e-51 |
| MsaG004595 | MsaG020346 | 0.808870 | 4.269281e-50 | 7.094867e-48 |
| MsaG005092 | MsaG020346 | 0.838161 | 6.228118e-57 | 2.295601e-54 |
| MsaG007431 | MsaG020346 | 0.813613 | 4.037822e-51 | 7.538180e-49 |
| MsaG010545 | MsaG020346 | 0.831205 | 3.434481e-55 | 1.028849e-52 |
| MsaG011087 | MsaG020346 | 0.812568 | 6.827676e-51 | 1.241828e-48 |
| MsaG011472 | MsaG020346 | 0.808657 | 4.737496e-50 | 7.832762e-48 |
| MsaG014671 | MsaG020346 | 0.814397 | 2.717116e-51 | 5.173416e-49 |
| MsaG017057 | MsaG020346 | 0.808624 | 4.816661e-50 | 7.956896e-48 |
| MsaG018577 | MsaG020346 | 0.860847 | 3.058869e-63 | 2.456206e-60 |
| MsaG018975 | MsaG020346 | 0.804720 | 3.184930e-49 | 4.797254e-47 |
| MsaG019525 | MsaG020346 | 0.818653 | 3.057968e-52 | 6.491499e-50 |
| MsaG019910 | MsaG020346 | 0.802469 | 9.287901e-49 | 1.328084e-46 |
| MsaG020353 | MsaG020346 | 0.822529 | 3.975549e-53 | 9.351713e-51 |
| MsaG020346 | MsaG024508 | 0.819949 | 1.554482e-52 | 3.414290e-50 |
| MsaG020346 | MsaG024574 | 0.801922 | 1.201918e-48 | 1.697295e-46 |
| MsaG020346 | MsaG026963 | 0.823151 | 2.853232e-53 | 6.825175e-51 |
| MsaG020346 | MsaG027307 | 0.834893 | 4.194844e-56 | 1.400641e-53 |
| MsaG020346 | MsaG027775 | 0.815812 | 1.322716e-51 | 2.610043e-49 |
| MsaG020346 | MsaG033744 | 0.800922 | 1.921743e-48 | 2.652917e-46 |
| MsaG020346 | MsaG033995 | 0.821179 | 8.136924e-53 | 1.846378e-50 |
| MsaG020346 | MsaG040379 | 0.810971 | 1.514489e-50 | 2.648292e-48 |
| MsaG020346 | MsaG040725 | 0.802563 | 8.884925e-49 | 1.273225e-46 |
| MsaG020346 | MsaG044019 | 0.802197 | 1.056050e-48 | 1.500643e-46 |
| MsaG020346 | MsaG045019 | 0.818254 | 3.761346e-52 | 7.902403e-50 |
| MsaG020346 | MsaG001950 | 0.809375 | 3.332049e-50 | 5.604858e-48 |
| MsaG020346 | MsaG028732 | 0.804570 | 3.423014e-49 | 5.137918e-47 |
| MsaG020346 | MsaG032408 | 0.812810 | 6.047169e-51 | 1.106491e-48 |
| MsaG020346 | MsaG031242 | 0.803930 | 4.644109e-49 | 6.868255e-47 |
| MsaG020346 | MsaG039945 | 0.853046 | 5.946343e-61 | 3.583588e-58 |
| MsaG020346 | MsaG035299 | 0.832104 | 2.066475e-55 | 6.355803e-53 |
| MsaG020346 | MsaG042989 | 0.822904 | 3.256139e-53 | 7.737200e-51 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG020346 | MtrunA17_Chr4g0025901 | 97.468 | 79 | 2 | 0 | 1 | 79 | 98 | 176 | 1.11e-54 | 167 |
| MsaG020346 | MtrunA17_Chr4g0025911 | 76.829 | 82 | 15 | 1 | 2 | 79 | 93 | 174 | 6.68e-40 | 129 |
| MsaG020346 | MtrunA17_Chr1g0177881 | 62.319 | 69 | 26 | 0 | 4 | 72 | 104 | 172 | 9.36e-26 | 93.6 |
| MsaG020346 | MtrunA17_Chr5g0435131 | 56.338 | 71 | 31 | 0 | 1 | 71 | 90 | 160 | 3.52e-25 | 91.7 |
| MsaG020346 | MtrunA17_Chr7g0267111 | 59.211 | 76 | 24 | 1 | 4 | 79 | 112 | 180 | 4.56e-25 | 92.4 |
| MsaG020346 | MtrunA17_Chr5g0432531 | 57.377 | 61 | 26 | 0 | 5 | 65 | 189 | 249 | 2.52e-16 | 70.5 |
| MsaG020346 | MtrunA17_Chr8g0390531 | 48.529 | 68 | 35 | 0 | 2 | 69 | 258 | 325 | 3.46e-15 | 68.2 |
| MsaG020346 | MtrunA17_Chr4g0013081 | 50.000 | 60 | 30 | 0 | 3 | 62 | 315 | 374 | 2.50e-14 | 65.9 |
| MsaG020346 | MtrunA17_Chr7g0244571 | 47.541 | 61 | 32 | 0 | 2 | 62 | 281 | 341 | 3.80e-13 | 62.4 |
| MsaG020346 | MtrunA17_Chr3g0141471 | 53.846 | 65 | 30 | 0 | 3 | 67 | 199 | 263 | 6.54e-12 | 58.9 |
| MsaG020346 | MtrunA17_Chr4g0075391 | 39.062 | 64 | 39 | 0 | 4 | 67 | 83 | 146 | 8.06e-12 | 57.0 |
| MsaG020346 | MtrunA17_Chr2g0284471 | 40.323 | 62 | 37 | 0 | 1 | 62 | 246 | 307 | 3.33e-11 | 57.0 |
| MsaG020346 | MtrunA17_Chr8g0379681 | 40.323 | 62 | 37 | 0 | 1 | 62 | 257 | 318 | 4.30e-11 | 56.6 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG020346 | AT3G52525.1 | 63.333 | 60 | 22 | 0 | 3 | 62 | 67 | 126 | 1.77e-22 | 85.1 |
| MsaG020346 | AT2G36026.1 | 57.377 | 61 | 26 | 0 | 7 | 67 | 91 | 151 | 4.13e-19 | 77.0 |
| MsaG020346 | AT5G19650.1 | 50.769 | 65 | 32 | 0 | 3 | 67 | 155 | 219 | 1.07e-15 | 68.9 |
| MsaG020346 | AT5G22240.1 | 44.595 | 74 | 39 | 1 | 3 | 74 | 97 | 170 | 1.33e-15 | 68.2 |
| MsaG020346 | AT5G58360.1 | 46.032 | 63 | 34 | 0 | 1 | 63 | 223 | 285 | 9.22e-14 | 64.3 |
| MsaG020346 | AT2G18500.1 | 50.847 | 59 | 29 | 0 | 4 | 62 | 228 | 286 | 1.23e-13 | 64.3 |
| MsaG020346 | AT1G06920.1 | 49.153 | 59 | 30 | 0 | 1 | 59 | 242 | 300 | 4.89e-13 | 62.4 |
| MsaG020346 | AT2G30400.1 | 47.619 | 63 | 33 | 0 | 1 | 63 | 251 | 313 | 6.08e-13 | 62.4 |
| MsaG020346 | AT5G01840.1 | 52.632 | 57 | 27 | 0 | 6 | 62 | 202 | 258 | 8.75e-13 | 61.6 |
| MsaG020346 | AT4G18830.1 | 45.000 | 60 | 33 | 0 | 3 | 62 | 283 | 342 | 6.69e-12 | 59.3 |
Find 14 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| CTCAATTCTAGTTGTTATCA+TGG | 0.388006 | 4:+50194961 | MsaT020346.1:CDS |
| GCAGTGCTACCAACCTTGTC+CGG | 0.389497 | 4:-50195027 | None:intergenic |
| CATATGTCATGAAGCTTTCC+CGG | 0.390173 | 4:+50195008 | MsaT020346.1:CDS |
| ATGATCTTCAAGATCTTCTC+CGG | 0.511298 | 4:+50194926 | MsaT020346.1:CDS |
| TCATGAAGCTTTCCCGGACA+AGG | 0.542749 | 4:+50195014 | MsaT020346.1:CDS |
| CAGTGCTACCAACCTTGTCC+GGG | 0.561453 | 4:-50195026 | None:intergenic |
| GAACACGGTGGCGGTAGAGA+AGG | 0.563314 | 4:+50194828 | MsaT020346.1:CDS |
| GAATGTTTGAAATCATGATA+CGG | 0.577874 | 4:-50194862 | None:intergenic |
| GAAGCTTTCCCGGACAAGGT+TGG | 0.580453 | 4:+50195018 | MsaT020346.1:CDS |
| AATTGAGATGAAGAAAACAC+CGG | 0.628303 | 4:-50194945 | None:intergenic |
| CCCACTAATGAACACGGTGG+CGG | 0.643057 | 4:+50194819 | None:intergenic |
| GGCGGTAGAGAAGGACTCTG+AGG | 0.686815 | 4:+50194837 | MsaT020346.1:CDS |
| ACAAAGCCCACTAATGAACA+CGG | 0.697529 | 4:+50194813 | None:intergenic |
| AAGCCCACTAATGAACACGG+TGG | 0.804493 | 4:+50194816 | None:intergenic |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| Chr4 | gene | 50194826 | 50195068 | 50194826 | ID=MsaG020346 |
| Chr4 | mRNA | 50194826 | 50195068 | 50194826 | ID=MsaT020346.1;Parent=MsaG020346 |
| Chr4 | exon | 50194826 | 50195068 | 50194826 | ID=MsaT020346.1.exon1;Parent=MsaT020346.1 |
| Chr4 | CDS | 50194826 | 50195068 | 50194826 | ID=cds.MsaT020346.1;Parent=MsaT020346.1 |
| Gene Sequence |
| Protein sequence |
