AlfalfaGEDB | MsaG021278

M. sativa ssp. caerulea / MsaG021278

KEGG: -
GO: -
PFAM: PF13912.9

Nr:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG021278	RHN79076.1	78.295	258	41	5	1	245	1	256	5.93e-131	382

Swissprot:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score

Trembl:

Query id	Subject id	identity %	alignment length	mis matches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG021278	tr\|A0A396JLE5\|A0A396JLE5_MEDTR	78.295	258	41	5	1	245	1	256	2.83e-131	382

TFs/TRs:

Gene ID	Type	Classification
MsaG021278	TF	C2H2

Protein Kinases:

Gene ID	Type	Classification

Network:

Co-expression Network

Gene1	Gene2	correlation coefficient	p_value	FDR
MsaG001179	MsaG021278	0.808532	5.038366e-50	8.304854e-48
MsaG001414	MsaG021278	0.889352	5.735192e-73	1.633989e-69
MsaG001415	MsaG021278	0.854990	1.645965e-61	1.062936e-58
MsaG002009	MsaG021278	0.801710	1.328134e-48	1.866475e-46
MsaG002016	MsaG021278	0.819994	1.517924e-52	3.338053e-50
MsaG003288	MsaG021278	0.808675	4.696927e-50	7.769090e-48
MsaG004319	MsaG021278	0.849550	5.717741e-60	3.052075e-57
MsaG005148	MsaG021278	0.810340	2.070451e-50	3.565241e-48
MsaG005149	MsaG021278	0.842088	5.948354e-58	2.480616e-55
MsaG005150	MsaG021278	0.834205	6.231470e-56	2.038244e-53
MsaG005205	MsaG021278	0.903098	1.150188e-78	7.069188e-75
MsaG006533	MsaG021278	0.825118	9.899785e-54	2.498399e-51
MsaG006601	MsaG021278	0.813488	4.302182e-51	8.006394e-49
MsaG007428	MsaG021278	0.811932	9.385947e-51	1.680487e-48
MsaG007429	MsaG021278	0.801497	1.467971e-48	2.053030e-46
MsaG008047	MsaG021278	0.875310	7.064001e-68	1.029779e-64
MsaG008208	MsaG021278	0.888096	1.741955e-72	4.654750e-69
MsaG008229	MsaG021278	0.822651	3.725541e-53	8.792392e-51
MsaG008426	MsaG021278	0.855215	1.416710e-61	9.223393e-59
MsaG008550	MsaG021278	0.869313	6.896904e-66	7.765349e-63
MsaG008956	MsaG021278	0.819939	1.562305e-52	3.430548e-50
MsaG008961	MsaG021278	0.856793	4.918668e-62	3.391804e-59
MsaG008967	MsaG021278	0.850731	2.678316e-60	1.488591e-57
MsaG009100	MsaG021278	0.828378	1.663017e-54	4.596538e-52
MsaG011115	MsaG021278	0.812134	8.483647e-51	1.526398e-48
MsaG011296	MsaG021278	0.800226	2.660459e-48	3.615455e-46
MsaG011505	MsaG021278	0.813274	4.789770e-51	8.866163e-49
MsaG012273	MsaG021278	0.836403	1.746282e-56	6.101286e-54
MsaG013646	MsaG021278	0.804000	4.491321e-49	6.653138e-47
MsaG014099	MsaG021278	0.816903	7.558870e-52	1.533764e-49
MsaG014541	MsaG021278	0.870997	1.949543e-66	2.356770e-63
MsaG015152	MsaG021278	0.804953	2.848655e-49	4.314083e-47
MsaG015178	MsaG021278	0.808343	5.525719e-50	9.066732e-48
MsaG017328	MsaG021278	0.849258	6.890817e-60	3.641405e-57
MsaG018183	MsaG021278	0.832710	1.464779e-55	4.584968e-53
MsaG018341	MsaG021278	0.808321	5.586154e-50	9.160881e-48
MsaG018343	MsaG021278	0.810639	1.785700e-50	3.097343e-48
MsaG019140	MsaG021278	0.815988	1.208573e-51	2.395505e-49
MsaG019451	MsaG021278	0.816555	9.038662e-52	1.817645e-49
MsaG020314	MsaG021278	0.820057	1.468533e-52	3.234836e-50
MsaG021076	MsaG021278	0.833478	9.454219e-56	3.026748e-53
MsaG021278	MsaG021279	0.931765	6.418540e-94	3.019119e-89
MsaG021278	MsaG021280	0.852075	1.121318e-60	6.531230e-58
MsaG021278	MsaG021281	0.914881	2.826816e-84	3.698535e-80
MsaG021278	MsaG022010	0.843329	2.793966e-58	1.212496e-55
MsaG021278	MsaG022011	0.822418	4.217739e-53	9.891840e-51
MsaG021278	MsaG022058	0.834843	4.317334e-56	1.439396e-53
MsaG021278	MsaG022059	0.802558	8.904092e-49	1.275834e-46
MsaG021278	MsaG022683	0.813059	5.337830e-51	9.828030e-49
MsaG021278	MsaG023089	0.841981	6.347369e-58	2.638102e-55
MsaG021278	MsaG023408	0.834008	6.977941e-56	2.268953e-53
MsaG021278	MsaG023516	0.802459	9.328857e-49	1.333664e-46
MsaG021278	MsaG023917	0.890467	2.113776e-73	6.383831e-70
MsaG021278	MsaG023835	0.871873	1.003262e-66	1.259175e-63
MsaG021278	MsaG023837	0.866079	7.430485e-65	7.329924e-62
MsaG021278	MsaG023838	0.865480	1.146576e-64	1.104202e-61
MsaG021278	MsaG023842	0.821427	7.139399e-53	1.630572e-50
MsaG021278	MsaG023856	0.835708	2.616491e-56	8.951815e-54
MsaG021278	MsaG024025	0.826928	3.693412e-54	9.801391e-52
MsaG021278	MsaG024026	0.836161	2.011164e-56	6.975456e-54
MsaG021278	MsaG026990	0.810047	2.392312e-50	4.090052e-48
MsaG021278	MsaG029184	0.861740	1.639090e-63	1.361824e-60
MsaG021278	MsaG029340	0.839378	3.029341e-57	1.159649e-54
MsaG021278	MsaG031277	0.824900	1.114005e-53	2.794685e-51
MsaG021278	MsaG031436	0.807742	7.406599e-50	1.197878e-47
MsaG021278	MsaG032998	0.814966	2.035516e-51	3.931541e-49
MsaG021278	MsaG033354	0.819481	1.986376e-52	4.309255e-50
MsaG021278	MsaG033437	0.808914	4.178327e-50	6.950971e-48
MsaG021278	MsaG033812	0.800355	2.505728e-48	3.415160e-46
MsaG021278	MsaG033814	0.856316	6.779533e-62	4.594638e-59
MsaG021278	MsaG034658	0.825297	8.985418e-54	2.278778e-51
MsaG021278	MsaG034659	0.826347	5.075877e-54	1.325391e-51
MsaG021278	MsaG035373	0.855240	1.393604e-61	9.081418e-59
MsaG021278	MsaG035375	0.830674	4.628369e-55	1.365496e-52
MsaG021278	MsaG035376	0.851546	1.581785e-60	9.042219e-58
MsaG021278	MsaG035378	0.856099	7.846565e-62	5.275357e-59
MsaG021278	MsaG037863	0.862334	1.079803e-63	9.180706e-61
MsaG021278	MsaG037865	0.815284	1.731758e-51	3.371796e-49
MsaG021278	MsaG037867	0.819905	1.591147e-52	3.490620e-50
MsaG021278	MsaG037869	0.832859	1.346018e-55	4.231402e-53
MsaG021278	MsaG038395	0.853995	3.182638e-61	1.983796e-58
MsaG021278	MsaG038533	0.867422	2.788752e-65	2.905021e-62
MsaG021278	MsaG039671	0.818553	3.221748e-52	6.821072e-50
MsaG021278	MsaG040071	0.833349	1.018055e-55	3.246807e-53
MsaG021278	MsaG040072	0.836135	2.041633e-56	7.075652e-54
MsaG021278	MsaG040077	0.803861	4.798488e-49	7.085206e-47
MsaG021278	MsaG040775	0.817489	5.588442e-52	1.151208e-49
MsaG021278	MsaG040820	0.832519	1.633374e-55	5.084156e-53
MsaG021278	MsaG040823	0.827738	2.367994e-54	6.428225e-52
MsaG021278	MsaG041049	0.841933	6.535148e-58	2.711979e-55
MsaG021278	MsaG041561	0.841090	1.087089e-57	4.391884e-55
MsaG021278	MsaG041687	0.830698	4.567186e-55	1.348353e-52
MsaG021278	MsaG041888	0.827630	2.512259e-54	6.799278e-52
MsaG021278	MsaG042406	0.842882	3.670510e-58	1.570185e-55
MsaG021278	MsaG043369	0.820248	1.328543e-52	2.941437e-50
MsaG021278	MsaG044352	0.815281	1.734245e-51	3.376380e-49
MsaG021278	MsaG044380	0.802931	7.463783e-49	1.078619e-46
MsaG021278	MsaG044794	0.851160	2.030403e-60	1.145332e-57
MsaG021278	MsaG046120	0.823569	2.281579e-53	5.520020e-51
MsaG021278	MsaG010012	0.801975	1.172392e-48	1.657583e-46
MsaG021278	MsaG013262	0.854631	2.089042e-61	1.331910e-58
MsaG021278	MsaG021538	0.857018	4.225704e-62	2.937755e-59
MsaG021278	MsaG024399	0.866659	4.871651e-65	4.920841e-62
MsaG021278	MsaG032859	0.846490	3.956606e-59	1.904627e-56
MsaG021278	MsaG033509	0.842370	5.013248e-58	2.109711e-55
MsaG021278	MsaG031902	0.912657	3.714412e-83	4.181020e-79
MsaG021278	MsaG031903	0.868958	8.979004e-66	9.962042e-63
MsaG021278	MsaG030523	0.821543	6.712432e-53	1.537835e-50
MsaG021278	MsaG038716	0.805191	2.542221e-49	3.871371e-47
MsaG021278	MsaG037163	0.834393	5.594902e-56	1.840399e-53
MsaG021278	MsaG035298	0.828593	1.476411e-54	4.105310e-52
MsaG021278	MsaG038131	0.828198	1.837352e-54	5.052504e-52
MsaG021278	MsaG039770	0.808490	5.141063e-50	8.465731e-48
MsaG021278	MsaG037023	0.859436	8.122760e-63	6.181433e-60
MsaG021278	MsaG035340	0.805044	2.727304e-49	4.139114e-47
MsaG021278	MsaG045440	0.830117	6.324492e-55	1.836506e-52
MsaG021278	MsaG043831	0.808346	5.517555e-50	9.053957e-48

PPI

Gene1	Gene2	Type

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG021278	MtrunA17_Chr1g0172961	78.295	258	41	5	1	245	1	256	5.45e-135	382
MsaG021278	MtrunA17_Chr4g0037041	87.050	139	16	1	1	137	1	139	1.11e-83	249
MsaG021278	MtrunA17_Chr1g0172861	44.272	323	83	11	1	274	1	275	4.15e-57	184
MsaG021278	MtrunA17_Chr1g0169521	34.967	306	133	11	20	278	28	314	2.03e-33	124
MsaG021278	MtrunA17_Chr1g0169561	34.967	306	133	11	20	278	28	314	3.18e-33	123
MsaG021278	MtrunA17_Chr7g0214511	39.200	250	104	12	42	278	71	285	6.73e-24	97.8
MsaG021278	MtrunA17_Chr1g0174871	33.333	264	149	10	31	278	31	283	8.81e-24	97.8
MsaG021278	MtrunA17_Chr1g0174861	35.047	214	112	7	23	235	25	212	2.92e-21	90.1
MsaG021278	MtrunA17_Chr1g0174001	37.255	204	102	11	90	278	1	193	2.11e-14	70.1

Query id	Subject id	identity %	alignment length	mismatches	gap openings	q. start	q. end	s. start	s. end	e-value	bit score
MsaG021278	AT2G45120.1	30.233	129	79	1	19	136	180	308	2.14e-11	63.5

Find 50 sgRNAs with CRISPR-Local

Find sgRNAs with CRISPR-GE

CRISPR-Local

CRISPR-Local
sgRNA_sequence	on_target_score	Position	Region
ATTGATCATGAACATCTTAA+TGG	0.235891	4:-64394824	MsaT021278.1:CDS
AGAAGAACATGGATTATAAA+AGG	0.308077	4:+64395231	None:intergenic
CCGCTCTCATACTATTAATA+AGG	0.314029	4:-64395092	MsaT021278.1:CDS
AAATTCATAACAACTCCTTT+TGG	0.331715	4:+64394488	None:intergenic
CCTCCTGATAGAACGTTTGT+TGG	0.361348	4:+64394856	None:intergenic
TGCGCTGCGGCTGGTGGTGG+TGG	0.387987	4:-64394776	MsaT021278.1:CDS
AAATACTTGGTTAAGTCAAT+TGG	0.389715	4:+64394899	None:intergenic
AAACCAACAAACGTTCTATC+AGG	0.407703	4:-64394859	MsaT021278.1:CDS
GCTGGTGGTGGTGGTGATCA+TGG	0.417182	4:-64394767	MsaT021278.1:CDS
GGACTTTGGTGGCAAATACT+TGG	0.426874	4:+64394886	None:intergenic
AACTCACACTCATACATTCT+CGG	0.428608	4:+64395172	None:intergenic
ATGTCCGCGAAAAGCCTTGT+TGG	0.435044	4:+64395015	None:intergenic
TCTTGCGCTGCGGCTGGTGG+TGG	0.459861	4:-64394779	MsaT021278.1:CDS
TATGATATTGCACCATGAAA+AGG	0.464373	4:-64394993	MsaT021278.1:CDS
GGTTGACGATTGAATACTCT+TGG	0.485743	4:+64394967	None:intergenic
TCTAATGAATTGAAGCCAAA+AGG	0.489056	4:-64394503	MsaT021278.1:CDS
TCATGTGCAACATCTTCTGT+TGG	0.490922	4:+64394449	None:intergenic
TTGAAATTGTTCCAAGGATG+TGG	0.492696	4:+64394946	None:intergenic
AATATGTCTTGCGCTGCGGC+TGG	0.494836	4:-64394785	MsaT021278.1:CDS
TCAATCGTCAACCACATCCT+TGG	0.496081	4:-64394957	MsaT021278.1:CDS
GAACAATTTCAATTTCAAGT+TGG	0.498276	4:-64394935	MsaT021278.1:CDS
TTCAACTCTGGCAACGCACT+CGG	0.512404	4:-64395136	MsaT021278.1:CDS
GAAACAGAAACATAGTTGTC+CGG	0.516663	4:-64395059	MsaT021278.1:CDS
TTGAAATTGAAATTGTTCCA+AGG	0.519609	4:+64394940	None:intergenic
ATTATTATTGTCCTTCACCT+TGG	0.520250	4:+64394655	None:intergenic
ATGATATTGCACCATGAAAA+GGG	0.521004	4:-64394992	MsaT021278.1:CDS
TACTTGGTTAAGTCAATTGG+TGG	0.543017	4:+64394902	None:intergenic
ATGTCTTGCGCTGCGGCTGG+TGG	0.545212	4:-64394782	MsaT021278.1:CDS
TCTTTAATCTTGAATATCAG+CGG	0.572245	4:+64394605	None:intergenic
TGGTGACATTGATGAAACTT+CGG	0.577161	4:-64394681	MsaT021278.1:CDS
AAGGTCTCGCAATGCAGCCA+AGG	0.578454	4:-64394578	MsaT021278.1:CDS
TGATGAAACTTCGGCGACCA+AGG	0.579505	4:-64394672	MsaT021278.1:CDS
AGTGTGAGTTGTGCGGCAAA+AGG	0.579769	4:-64395159	MsaT021278.1:CDS
TAGTTGTCCGGTTTGCAACA+AGG	0.585771	4:-64395047	MsaT021278.1:CDS
TGCGGCAAAAGGTTCAACTC+TGG	0.586813	4:-64395148	MsaT021278.1:CDS
GACAAGGTCGAGAAACAAGT+TGG	0.597799	4:-64394701	MsaT021278.1:CDS
TTGGTTAAGTCAATTGGTGG+TGG	0.603616	4:+64394905	None:intergenic
AAGCAATGTGGACGATGACA+AGG	0.610743	4:-64394717	MsaT021278.1:CDS
AACTCTGGCAACGCACTCGG+TGG	0.616672	4:-64395133	MsaT021278.1:CDS
CTTCAATATGTCTTGCGCTG+CGG	0.618324	4:-64394789	MsaT021278.1:CDS
AACTTCGGCGACCAAGGTGA+AGG	0.625913	4:-64394666	MsaT021278.1:CDS
GGATTATAAAAGGAACAAGA+AGG	0.636811	4:+64395241	None:intergenic
AATGAATGAAAAGAAGAACA+TGG	0.641497	4:+64395220	None:intergenic
TGAAGGTGGTGAAACTGCGA+TGG	0.648342	4:-64394534	MsaT021278.1:CDS
CCAACAAACGTTCTATCAGG+AGG	0.665230	4:-64394856	MsaT021278.1:CDS
GCTCAAAGTTTCAAGCAATG+TGG	0.669423	4:-64394729	MsaT021278.1:CDS
ATTCAAGATTAAAGACAACA+AGG	0.676790	4:-64394597	MsaT021278.1:CDS
TATTAATAGTATGAGAGCGG+CGG	0.687350	4:+64395095	None:intergenic
CCTTATTAATAGTATGAGAG+CGG	0.698742	4:+64395092	None:intergenic
ATGTATGAGTGTGAGTTGTG+CGG	0.703631	4:-64395166	MsaT021278.1:CDS

CRISPR-GE

badsite warning	sgRNA_sequence	Strand	Position	Region	GC_content

Chromosome	Type	Strat	End	Strand	Name
Chr4	gene	64394445	64395281	64394445	ID=MsaG021278
Chr4	mRNA	64394445	64395281	64394445	ID=MsaT021278.1;Parent=MsaG021278
Chr4	exon	64394445	64395281	64394445	ID=MsaT021278.1.exon1;Parent=MsaT021278.1
Chr4	CDS	64394445	64395281	64394445	ID=cds.MsaT021278.1;Parent=MsaT021278.1

Gene Sequence

>MsaT021278.1

ATGAGGAAGAAACGTACTCCTTCTTGTTCCTTTTATAATCCATGTTCTTCTTTTCATTCATTCGAAGATAATGAGAAATCTCAAGCTCCGAGAATGTATGAGTGTGAGTTGTGCGGCAAAAGGTTCAACTCTGGCAACGCACTCGGTGGCCACAAAACATCTCACCGCCGCTCTCATACTATTAATAAGGACGATGATGAGAAACAGAAACATAGTTGTCCGGTTTGCAACAAGGTTTTTTCATCCAACAAGGCTTTTCGCGGACATATGATATTGCACCATGAAAAGGGTTCCAAGAGTATTCAATCGTCAACCACATCCTTGGAACAATTTCAATTTCAAGTTGGTATTGCACCACCACCAATTGACTTAACCAAGTATTTGCCACCAAAGTCCCATAAAACCAACAAACGTTCTATCAGGAGGAGAAATATCATTGATCATGAACATCTTAATGGAGCACAAACACTCTTCAATATGTCTTGCGCTGCGGCTGGTGGTGGTGGTGATCATGGTCACATACATAAAAAGCTCAAAGTTTCAAGCAATGTGGACGATGACAAGGTCGAGAAACAAGTTGGTGACATTGATGAAACTTCGGCGACCAAGGTGAAGGACAATAATAATAATAATAATAACAGTAAAAAGAGTTTGCCGCTGATATTCAAGATTAAAGACAACAAGGTCTCGCAATGCAGCCAAGGTGAAGAAAAGAAGAAAAATAATGAAGGTGGTGAAACTGCGATGGAAGAGAGTTCTAATGAATTGAAGCCAAAAGGAGTTGTTATGAATTTTGATTTGAATGAGCTTCCAACAGAAGATGTTGCACATGAATGA

Protein sequence

>MsaT021278.1

MRKKRTPSCSFYNPCSSFHSFEDNEKSQAPRMYECELCGKRFNSGNALGGHKTSHRRSHTINKDDDEKQKHSCPVCNKVFSSNKAFRGHMILHHEKGSKSIQSSTTSLEQFQFQVGIAPPPIDLTKYLPPKSHKTNKRSIRRRNIIDHEHLNGAQTLFNMSCAAAGGGGDHGHIHKKLKVSSNVDDDKVEKQVGDIDETSATKVKDNNNNNNNSKKSLPLIFKIKDNKVSQCSQGEEKKKNNEGGETAMEESSNELKPKGVVMNFDLNELPTEDVAHE*