Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG023942 | XP_024629648.1 | 95.257 | 253 | 12 | 0 | 1 | 253 | 1 | 253 | 9.17e-173 | 488 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG023942 | sp|Q8VWK4|TRB1_ARATH | 46.899 | 258 | 111 | 9 | 1 | 250 | 1 | 240 | 7.53e-65 | 207 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG023942 | tr|G7LCB1|G7LCB1_MEDTR | 95.257 | 253 | 12 | 0 | 1 | 253 | 1 | 253 | 5.41e-171 | 489 |
Gene ID | Type | Classification |
---|---|---|
MsaG023942 | TF | MYB-related |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000023 | MsaG023942 | 0.818323 | 3.630307e-52 | 7.640598e-50 |
MsaG000049 | MsaG023942 | 0.873183 | 3.684695e-67 | 4.893424e-64 |
MsaG000472 | MsaG023942 | 0.812528 | 6.966457e-51 | 1.265814e-48 |
MsaG000545 | MsaG023942 | 0.847721 | 1.826854e-59 | 9.165160e-57 |
MsaG000621 | MsaG023942 | 0.832909 | 1.308498e-55 | 4.119669e-53 |
MsaG000801 | MsaG023942 | 0.804137 | 4.209009e-49 | 6.254727e-47 |
MsaG001036 | MsaG023942 | 0.806121 | 1.624851e-49 | 2.528796e-47 |
MsaG001120 | MsaG023942 | 0.860995 | 2.759180e-63 | 2.227852e-60 |
MsaG001127 | MsaG023942 | 0.867716 | 2.248003e-65 | 2.370402e-62 |
MsaG001307 | MsaG023942 | 0.872554 | 5.966843e-67 | 7.710706e-64 |
MsaG001700 | MsaG023942 | 0.940572 | 5.472772e-100 | 5.363497e-95 |
MsaG001902 | MsaG023942 | 0.814273 | 2.893468e-51 | 5.491930e-49 |
MsaG001897 | MsaG023942 | 0.912787 | 3.202686e-83 | 3.635837e-79 |
MsaG002038 | MsaG023942 | 0.813872 | 3.543682e-51 | 6.658938e-49 |
MsaG002123 | MsaG023942 | 0.862172 | 1.209918e-63 | 1.022257e-60 |
MsaG002636 | MsaG023942 | 0.841639 | 7.806871e-58 | 3.209293e-55 |
MsaG003375 | MsaG023942 | 0.893621 | 1.183571e-74 | 4.229745e-71 |
MsaG003517 | MsaG023942 | 0.853116 | 5.677859e-61 | 3.430263e-58 |
MsaG003711 | MsaG023942 | 0.807842 | 7.056719e-50 | 1.144031e-47 |
MsaG003740 | MsaG023942 | 0.802986 | 7.271495e-49 | 1.052177e-46 |
MsaG004339 | MsaG023942 | 0.860052 | 5.309710e-63 | 4.136506e-60 |
MsaG004620 | MsaG023942 | 0.832863 | 1.342819e-55 | 4.221899e-53 |
MsaG004669 | MsaG023942 | 0.886441 | 7.386488e-72 | 1.816265e-68 |
MsaG004838 | MsaG023942 | 0.808972 | 4.060846e-50 | 6.764920e-48 |
MsaG004844 | MsaG023942 | 0.882030 | 3.117351e-70 | 6.188123e-67 |
MsaG005085 | MsaG023942 | 0.863873 | 3.630415e-64 | 3.279176e-61 |
MsaG005257 | MsaG023942 | 0.826944 | 3.662226e-54 | 9.722815e-52 |
MsaG005338 | MsaG023942 | 0.809337 | 3.393857e-50 | 5.703479e-48 |
MsaG005414 | MsaG023942 | 0.815610 | 1.466497e-51 | 2.879041e-49 |
MsaG005579 | MsaG023942 | 0.808877 | 4.255003e-50 | 7.072265e-48 |
MsaG005636 | MsaG023942 | 0.817911 | 4.493324e-52 | 9.357094e-50 |
MsaG005881 | MsaG023942 | 0.868496 | 1.264583e-65 | 1.376826e-62 |
MsaG005892 | MsaG023942 | 0.809820 | 2.675888e-50 | 4.549951e-48 |
MsaG006131 | MsaG023942 | 0.862349 | 1.068752e-63 | 9.092114e-61 |
MsaG006066 | MsaG023942 | 0.893947 | 8.745682e-75 | 3.181524e-71 |
MsaG006312 | MsaG023942 | 0.907022 | 1.889422e-80 | 1.474237e-76 |
MsaG006475 | MsaG023942 | 0.807431 | 8.616340e-50 | 1.383190e-47 |
MsaG006504 | MsaG023942 | 0.800254 | 2.625832e-48 | 3.570669e-46 |
MsaG006544 | MsaG023942 | 0.900609 | 1.423074e-77 | 7.547379e-74 |
MsaG006686 | MsaG023942 | 0.811974 | 9.192607e-51 | 1.647521e-48 |
MsaG007064 | MsaG023942 | 0.807863 | 6.983234e-50 | 1.132725e-47 |
MsaG007815 | MsaG023942 | 0.921876 | 5.264289e-88 | 1.137588e-83 |
MsaG008049 | MsaG023942 | 0.814225 | 2.965284e-51 | 5.621440e-49 |
MsaG008062 | MsaG023942 | 0.817398 | 5.856993e-52 | 1.203704e-49 |
MsaG008458 | MsaG023942 | 0.837026 | 1.213825e-56 | 4.321066e-54 |
MsaG008409 | MsaG023942 | 0.815054 | 1.946530e-51 | 3.767901e-49 |
MsaG008410 | MsaG023942 | 0.859156 | 9.843106e-63 | 7.411432e-60 |
MsaG008814 | MsaG023942 | 0.803251 | 6.412654e-49 | 9.335926e-47 |
MsaG008994 | MsaG023942 | 0.811854 | 9.758966e-51 | 1.743879e-48 |
MsaG009180 | MsaG023942 | 0.831716 | 2.574619e-55 | 7.829666e-53 |
MsaG010148 | MsaG023942 | 0.806642 | 1.263568e-49 | 1.990929e-47 |
MsaG010316 | MsaG023942 | 0.829135 | 1.093291e-54 | 3.086546e-52 |
MsaG010544 | MsaG023942 | 0.877584 | 1.168395e-68 | 1.886837e-65 |
MsaG010690 | MsaG023942 | 0.820645 | 1.078509e-52 | 2.412800e-50 |
MsaG011084 | MsaG023942 | 0.815780 | 1.344622e-51 | 2.651045e-49 |
MsaG011119 | MsaG023942 | 0.804309 | 3.876391e-49 | 5.783570e-47 |
MsaG012360 | MsaG023942 | 0.879571 | 2.355578e-69 | 4.168608e-66 |
MsaG012442 | MsaG023942 | 0.809102 | 3.809329e-50 | 6.366002e-48 |
MsaG012565 | MsaG023942 | 0.848182 | 1.365086e-59 | 6.955248e-57 |
MsaG013268 | MsaG023942 | 0.871301 | 1.549835e-66 | 1.897880e-63 |
MsaG013503 | MsaG023942 | 0.807189 | 9.694492e-50 | 1.547293e-47 |
MsaG014101 | MsaG023942 | 0.816231 | 1.067353e-51 | 2.128771e-49 |
MsaG014166 | MsaG023942 | 0.808562 | 4.963271e-50 | 8.187083e-48 |
MsaG014232 | MsaG023942 | 0.816012 | 1.194337e-51 | 2.368653e-49 |
MsaG014844 | MsaG023942 | 0.825548 | 7.842994e-54 | 2.002900e-51 |
MsaG014909 | MsaG023942 | 0.814119 | 3.127578e-51 | 5.913380e-49 |
MsaG014937 | MsaG023942 | 0.820914 | 9.358119e-53 | 2.108606e-50 |
MsaG014940 | MsaG023942 | 0.868477 | 1.282852e-65 | 1.395584e-62 |
MsaG015319 | MsaG023942 | 0.842178 | 5.632798e-58 | 2.355723e-55 |
MsaG015898 | MsaG023942 | 0.859334 | 8.712429e-63 | 6.604890e-60 |
MsaG016306 | MsaG023942 | 0.802662 | 8.476195e-49 | 1.217414e-46 |
MsaG016351 | MsaG023942 | 0.818896 | 2.695301e-52 | 5.757964e-50 |
MsaG016706 | MsaG023942 | 0.833594 | 8.849395e-56 | 2.842792e-53 |
MsaG017108 | MsaG023942 | 0.877566 | 1.185336e-68 | 1.912579e-65 |
MsaG017152 | MsaG023942 | 0.810233 | 2.182828e-50 | 3.748851e-48 |
MsaG017280 | MsaG023942 | 0.803944 | 4.614297e-49 | 6.826325e-47 |
MsaG017358 | MsaG023942 | 0.822638 | 3.751875e-53 | 8.851480e-51 |
MsaG017469 | MsaG023942 | 0.803799 | 4.944038e-49 | 7.289534e-47 |
MsaG017725 | MsaG023942 | 0.816977 | 7.277908e-52 | 1.479579e-49 |
MsaG017899 | MsaG023942 | 0.827684 | 2.439703e-54 | 6.612690e-52 |
MsaG017963 | MsaG023942 | 0.829508 | 8.882277e-55 | 2.534708e-52 |
MsaG018368 | MsaG023942 | 0.866220 | 6.706227e-65 | 6.653816e-62 |
MsaG018440 | MsaG023942 | 0.840594 | 1.464700e-57 | 5.825550e-55 |
MsaG018490 | MsaG023942 | 0.889813 | 3.802624e-73 | 1.109722e-69 |
MsaG018958 | MsaG023942 | 0.838398 | 5.415578e-57 | 2.010745e-54 |
MsaG019184 | MsaG023942 | 0.847860 | 1.672783e-59 | 8.432376e-57 |
MsaG019669 | MsaG023942 | 0.901984 | 3.575348e-78 | 2.055649e-74 |
MsaG019661 | MsaG023942 | 0.868626 | 1.148300e-65 | 1.256784e-62 |
MsaG020174 | MsaG023942 | 0.826260 | 5.321120e-54 | 1.386056e-51 |
MsaG020592 | MsaG023942 | 0.841693 | 7.554423e-58 | 3.110866e-55 |
MsaG020791 | MsaG023942 | 0.952643 | 5.129037e-110 | 1.420877e-104 |
MsaG021128 | MsaG023942 | 0.807407 | 8.718012e-50 | 1.398698e-47 |
MsaG021168 | MsaG023942 | 0.817225 | 6.404502e-52 | 1.310409e-49 |
MsaG021153 | MsaG023942 | 0.812485 | 7.119734e-51 | 1.292261e-48 |
MsaG021643 | MsaG023942 | 0.885489 | 1.678818e-71 | 3.937550e-68 |
MsaG021644 | MsaG023942 | 0.892973 | 2.155968e-74 | 7.441236e-71 |
MsaG021729 | MsaG023942 | 0.901877 | 3.985278e-78 | 2.277110e-74 |
MsaG022017 | MsaG023942 | 0.833306 | 1.043320e-55 | 3.323187e-53 |
MsaG022028 | MsaG023942 | 0.841471 | 8.640781e-58 | 3.533298e-55 |
MsaG022191 | MsaG023942 | 0.827000 | 3.551149e-54 | 9.442383e-52 |
MsaG022433 | MsaG023942 | 0.947466 | 1.995602e-105 | 3.628874e-100 |
MsaG023302 | MsaG023942 | 0.899548 | 4.076550e-77 | 2.030702e-73 |
MsaG023412 | MsaG023942 | 0.909818 | 9.028682e-82 | 8.423415e-78 |
MsaG023731 | MsaG023942 | 0.813869 | 3.549846e-51 | 6.669912e-49 |
MsaG023815 | MsaG023942 | 0.942214 | 3.195050e-101 | 3.669582e-96 |
MsaG023912 | MsaG023942 | 0.820245 | 1.331132e-52 | 2.946851e-50 |
MsaG023863 | MsaG023942 | 0.836087 | 2.099502e-56 | 7.265539e-54 |
MsaG023879 | MsaG023942 | 0.855557 | 1.127836e-61 | 7.434854e-59 |
MsaG023942 | MsaG024000 | 0.928713 | 5.283572e-92 | 1.942537e-87 |
MsaG023942 | MsaG024205 | 0.800538 | 2.299592e-48 | 3.147261e-46 |
MsaG023942 | MsaG024335 | 0.827197 | 3.187740e-54 | 8.523003e-52 |
MsaG023942 | MsaG024459 | 0.820754 | 1.018489e-52 | 2.285053e-50 |
MsaG023942 | MsaG025332 | 0.825998 | 6.140728e-54 | 1.587961e-51 |
MsaG023942 | MsaG025643 | 0.805110 | 2.642525e-49 | 4.016475e-47 |
MsaG023942 | MsaG026446 | 0.801589 | 1.405517e-48 | 1.969822e-46 |
MsaG023942 | MsaG026722 | 0.859873 | 6.008394e-63 | 4.648726e-60 |
MsaG023942 | MsaG026756 | 0.806271 | 1.511334e-49 | 2.360623e-47 |
MsaG023942 | MsaG026818 | 0.851908 | 1.250362e-60 | 7.240414e-58 |
MsaG023942 | MsaG026822 | 0.825862 | 6.609359e-54 | 1.702767e-51 |
MsaG023942 | MsaG026989 | 0.828834 | 1.292233e-54 | 3.617323e-52 |
MsaG023942 | MsaG027155 | 0.838264 | 5.860143e-57 | 2.166870e-54 |
MsaG023942 | MsaG027251 | 0.924948 | 9.378978e-90 | 2.563207e-85 |
MsaG023942 | MsaG027313 | 0.810774 | 1.669493e-50 | 2.905402e-48 |
MsaG023942 | MsaG027305 | 0.878668 | 4.895808e-69 | 8.308487e-66 |
MsaG023942 | MsaG027342 | 0.852517 | 8.405377e-61 | 4.971446e-58 |
MsaG023942 | MsaG027802 | 0.851255 | 1.909582e-60 | 1.080717e-57 |
MsaG023942 | MsaG027971 | 0.863145 | 6.088056e-64 | 5.344056e-61 |
MsaG023942 | MsaG028200 | 0.841875 | 6.766975e-58 | 2.803034e-55 |
MsaG023942 | MsaG028232 | 0.888996 | 7.867856e-73 | 2.201205e-69 |
MsaG023942 | MsaG028675 | 0.821270 | 7.755315e-53 | 1.764030e-50 |
MsaG023942 | MsaG028969 | 0.826848 | 3.858801e-54 | 1.021744e-51 |
MsaG023942 | MsaG028928 | 0.850234 | 3.688612e-60 | 2.015079e-57 |
MsaG023942 | MsaG029106 | 0.835253 | 3.406840e-56 | 1.149777e-53 |
MsaG023942 | MsaG029233 | 0.843259 | 2.916981e-58 | 1.263015e-55 |
MsaG023942 | MsaG029539 | 0.823003 | 3.088452e-53 | 7.358549e-51 |
MsaG023942 | MsaG029892 | 0.803474 | 5.770617e-49 | 8.444416e-47 |
MsaG023942 | MsaG029986 | 0.862322 | 1.089393e-63 | 9.257750e-61 |
MsaG023942 | MsaG030619 | 0.821666 | 6.290768e-53 | 1.445942e-50 |
MsaG023942 | MsaG030698 | 0.820937 | 9.246275e-53 | 2.084690e-50 |
MsaG023942 | MsaG031475 | 0.808037 | 6.415263e-50 | 1.044938e-47 |
MsaG023942 | MsaG032036 | 0.801993 | 1.162625e-48 | 1.644411e-46 |
MsaG023942 | MsaG032038 | 0.820144 | 1.403179e-52 | 3.098029e-50 |
MsaG023942 | MsaG032797 | 0.901055 | 9.117440e-78 | 4.963503e-74 |
MsaG023942 | MsaG033487 | 0.840892 | 1.224786e-57 | 4.917068e-55 |
MsaG023942 | MsaG033570 | 0.839529 | 2.768180e-57 | 1.064724e-54 |
MsaG023942 | MsaG033592 | 0.821926 | 5.479877e-53 | 1.268304e-50 |
MsaG023942 | MsaG033852 | 0.801786 | 1.281399e-48 | 1.803917e-46 |
MsaG023942 | MsaG034020 | 0.843640 | 2.310789e-58 | 1.012832e-55 |
MsaG023942 | MsaG034202 | 0.846321 | 4.397397e-59 | 2.105100e-56 |
MsaG023942 | MsaG034409 | 0.895172 | 2.773013e-75 | 1.077720e-71 |
MsaG023942 | MsaG034510 | 0.806359 | 1.448886e-49 | 2.267697e-47 |
MsaG023942 | MsaG034763 | 0.843982 | 1.872922e-58 | 8.299015e-56 |
MsaG023942 | MsaG034930 | 0.812180 | 8.291526e-51 | 1.493563e-48 |
MsaG023942 | MsaG035053 | 0.872667 | 5.476090e-67 | 7.110869e-64 |
MsaG023942 | MsaG035122 | 0.804146 | 4.191098e-49 | 6.229389e-47 |
MsaG023942 | MsaG035271 | 0.806927 | 1.100748e-49 | 1.745988e-47 |
MsaG023942 | MsaG035531 | 0.817713 | 4.979459e-52 | 1.031622e-49 |
MsaG023942 | MsaG035633 | 0.855830 | 9.397253e-62 | 6.255669e-59 |
MsaG023942 | MsaG035658 | 0.893241 | 1.683692e-74 | 5.893879e-71 |
MsaG023942 | MsaG036211 | 0.815692 | 1.406491e-51 | 2.766934e-49 |
MsaG023942 | MsaG036485 | 0.804410 | 3.693837e-49 | 5.524042e-47 |
MsaG023942 | MsaG036954 | 0.873237 | 3.534055e-67 | 4.704174e-64 |
MsaG023942 | MsaG037261 | 0.857555 | 2.936174e-62 | 2.082463e-59 |
MsaG023942 | MsaG037339 | 0.844118 | 1.722233e-58 | 7.666362e-56 |
MsaG023942 | MsaG037569 | 0.825039 | 1.033022e-53 | 2.601389e-51 |
MsaG023942 | MsaG037969 | 0.807352 | 8.954910e-50 | 1.434818e-47 |
MsaG023942 | MsaG038039 | 0.817261 | 6.287583e-52 | 1.287660e-49 |
MsaG023942 | MsaG038100 | 0.856936 | 4.465697e-62 | 3.095424e-59 |
MsaG023942 | MsaG038329 | 0.863771 | 3.902875e-64 | 3.511392e-61 |
MsaG023942 | MsaG039271 | 0.808728 | 4.576368e-50 | 7.579388e-48 |
MsaG023942 | MsaG040450 | 0.842638 | 4.260786e-58 | 1.808514e-55 |
MsaG023942 | MsaG040452 | 0.868896 | 9.402728e-66 | 1.040502e-62 |
MsaG023942 | MsaG040696 | 0.804047 | 4.392320e-49 | 6.513854e-47 |
MsaG023942 | MsaG040708 | 0.890275 | 2.512397e-73 | 7.511862e-70 |
MsaG023942 | MsaG041086 | 0.812261 | 7.964355e-51 | 1.437473e-48 |
MsaG023942 | MsaG041123 | 0.872782 | 5.011992e-67 | 6.540032e-64 |
MsaG023942 | MsaG041861 | 0.823324 | 2.600931e-53 | 6.251233e-51 |
MsaG023942 | MsaG041923 | 0.823064 | 2.989306e-53 | 7.134115e-51 |
MsaG023942 | MsaG042790 | 0.841715 | 7.455238e-58 | 3.072138e-55 |
MsaG023942 | MsaG042796 | 0.841362 | 9.228172e-58 | 3.760353e-55 |
MsaG023942 | MsaG042771 | 0.896213 | 1.033844e-75 | 4.257516e-72 |
MsaG023942 | MsaG043998 | 0.815181 | 1.825164e-51 | 3.544358e-49 |
MsaG023942 | MsaG044219 | 0.816829 | 7.852948e-52 | 1.590367e-49 |
MsaG023942 | MsaG044707 | 0.826289 | 5.238893e-54 | 1.365727e-51 |
MsaG023942 | MsaG045048 | 0.820544 | 1.137137e-52 | 2.537309e-50 |
MsaG023942 | MsaG045242 | 0.829587 | 8.501127e-55 | 2.431444e-52 |
MsaG023942 | MsaG045320 | 0.802867 | 7.692823e-49 | 1.110064e-46 |
MsaG023942 | MsaG045429 | 0.847964 | 1.566847e-59 | 7.925530e-57 |
MsaG023942 | MsaG045454 | 0.808711 | 4.614117e-50 | 7.638859e-48 |
MsaG023942 | MsaG045542 | 0.835543 | 2.880402e-56 | 9.806420e-54 |
MsaG023942 | MsaG045634 | 0.836115 | 2.065844e-56 | 7.155157e-54 |
MsaG023942 | MsaG045582 | 0.829927 | 7.030643e-55 | 2.030534e-52 |
MsaG023942 | MsaG045647 | 0.887214 | 3.773223e-72 | 9.644342e-69 |
MsaG023942 | MsaG046035 | 0.831305 | 3.246642e-55 | 9.754113e-53 |
MsaG023942 | MsaG046172 | 0.829486 | 8.992793e-55 | 2.564606e-52 |
MsaG023942 | MsaG046262 | 0.878766 | 4.522115e-69 | 7.711124e-66 |
MsaG023942 | MsaG046263 | 0.825496 | 8.063615e-54 | 2.056315e-51 |
MsaG023942 | MsaG046492 | 0.858174 | 1.928012e-62 | 1.399289e-59 |
MsaG023942 | MsaG046687 | 0.876394 | 3.010655e-68 | 4.607068e-65 |
MsaG023942 | MsaG046740 | 0.844971 | 1.018134e-58 | 4.661535e-56 |
MsaG023942 | MsaG047065 | 0.910875 | 2.788065e-82 | 2.790127e-78 |
MsaG023942 | MsaG047102 | 0.863097 | 6.298690e-64 | 5.518583e-61 |
MsaG023942 | MsaG047157 | 0.852721 | 7.353928e-61 | 4.381461e-58 |
MsaG023942 | MsaG001761 | 0.819395 | 2.077120e-52 | 4.496061e-50 |
MsaG023942 | MsaG003314 | 0.805731 | 1.960860e-49 | 3.023821e-47 |
MsaG023942 | MsaG002387 | 0.822192 | 4.757127e-53 | 1.108893e-50 |
MsaG023942 | MsaG001319 | 0.904181 | 3.763976e-79 | 2.468867e-75 |
MsaG023942 | MsaG007270 | 0.807489 | 8.379334e-50 | 1.346977e-47 |
MsaG023942 | MsaG010803 | 0.801070 | 1.792985e-48 | 2.483438e-46 |
MsaG023942 | MsaG006540 | 0.800672 | 2.160469e-48 | 2.965851e-46 |
MsaG023942 | MsaG008699 | 0.873584 | 2.704426e-67 | 3.654468e-64 |
MsaG023942 | MsaG007898 | 0.820451 | 1.194459e-52 | 2.658664e-50 |
MsaG023942 | MsaG008985 | 0.802085 | 1.113194e-48 | 1.577825e-46 |
MsaG023942 | MsaG017032 | 0.892826 | 2.468717e-74 | 8.453442e-71 |
MsaG023942 | MsaG013258 | 0.815187 | 1.819171e-51 | 3.533317e-49 |
MsaG023942 | MsaG012745 | 0.862745 | 8.080346e-64 | 6.982014e-61 |
MsaG023942 | MsaG013019 | 0.843645 | 2.303505e-58 | 1.009802e-55 |
MsaG023942 | MsaG013040 | 0.810856 | 1.603119e-50 | 2.795428e-48 |
MsaG023942 | MsaG014169 | 0.801483 | 1.477370e-48 | 2.065533e-46 |
MsaG023942 | MsaG014051 | 0.856862 | 4.695405e-62 | 3.246177e-59 |
MsaG023942 | MsaG013382 | 0.817175 | 6.571146e-52 | 1.342755e-49 |
MsaG023942 | MsaG020185 | 0.833701 | 8.323992e-56 | 2.682464e-53 |
MsaG023942 | MsaG019481 | 0.801735 | 1.312572e-48 | 1.845689e-46 |
MsaG023942 | MsaG022159 | 0.885216 | 2.121036e-71 | 4.910831e-68 |
MsaG023942 | MsaG027471 | 0.857838 | 2.423788e-62 | 1.737252e-59 |
MsaG023942 | MsaG025023 | 0.858717 | 1.330532e-62 | 9.854042e-60 |
MsaG023942 | MsaG031529 | 0.823075 | 2.971976e-53 | 7.094891e-51 |
MsaG023942 | MsaG032676 | 0.898284 | 1.407536e-76 | 6.517030e-73 |
MsaG023942 | MsaG032681 | 0.841774 | 7.193198e-58 | 2.969793e-55 |
MsaG023942 | MsaG033833 | 0.802566 | 8.870003e-49 | 1.271185e-46 |
MsaG023942 | MsaG033560 | 0.848694 | 9.864624e-60 | 5.113525e-57 |
MsaG023942 | MsaG030753 | 0.825635 | 7.479313e-54 | 1.914575e-51 |
MsaG023942 | MsaG032904 | 0.808835 | 4.343757e-50 | 7.212411e-48 |
MsaG023942 | MsaG030261 | 0.801411 | 1.528131e-48 | 2.133059e-46 |
MsaG023942 | MsaG036262 | 0.800871 | 1.968237e-48 | 2.714015e-46 |
MsaG023942 | MsaG040323 | 0.823133 | 2.880667e-53 | 6.887551e-51 |
MsaG023942 | MsaG036799 | 0.821908 | 5.531777e-53 | 1.279706e-50 |
MsaG023942 | MsaG036566 | 0.823556 | 2.297018e-53 | 5.555451e-51 |
MsaG023942 | MsaG036611 | 0.814256 | 2.918220e-51 | 5.536581e-49 |
MsaG023942 | MsaG035337 | 0.804137 | 4.208401e-49 | 6.253869e-47 |
MsaG023942 | MsaG036891 | 0.816273 | 1.044767e-51 | 2.085947e-49 |
MsaG023942 | MsaG036557 | 0.810854 | 1.604794e-50 | 2.798181e-48 |
MsaG023942 | MsaG043527 | 0.827627 | 2.516296e-54 | 6.809610e-52 |
MsaG023942 | MsaG043455 | 0.825050 | 1.027371e-53 | 2.587903e-51 |
MsaG023942 | MsaG043234 | 0.911273 | 1.783043e-82 | 1.830462e-78 |
MsaG023942 | MsaG043778 | 0.816554 | 9.045164e-52 | 1.818897e-49 |
MsaG023942 | MsaG041600 | 0.926118 | 1.932075e-90 | 5.783700e-86 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG023942 | MtrunA17_Chr2g0293381 | 65.323 | 248 | 77 | 1 | 1 | 248 | 1 | 239 | 6.05e-109 | 316 |
MsaG023942 | MtrunA17_Chr8g0384671 | 64.800 | 250 | 73 | 4 | 1 | 248 | 1 | 237 | 2.36e-105 | 307 |
MsaG023942 | MtrunA17_Chr8g0383821 | 97.600 | 125 | 3 | 0 | 1 | 125 | 1 | 125 | 3.59e-86 | 252 |
MsaG023942 | MtrunA17_Chr4g0054131 | 39.015 | 264 | 132 | 5 | 1 | 248 | 1 | 251 | 7.15e-54 | 176 |
MsaG023942 | MtrunA17_Chr5g0401061 | 41.810 | 232 | 130 | 3 | 1 | 231 | 1 | 228 | 2.28e-51 | 169 |
MsaG023942 | MtrunA17_Chr8g0383841 | 88.235 | 68 | 8 | 0 | 186 | 253 | 1 | 68 | 5.06e-34 | 119 |
MsaG023942 | MtrunA17_Chr1g0195251 | 51.969 | 127 | 49 | 3 | 125 | 251 | 295 | 409 | 6.12e-32 | 122 |
MsaG023942 | MtrunA17_Chr8g0342871 | 37.245 | 196 | 102 | 5 | 1 | 187 | 1 | 184 | 7.18e-29 | 110 |
MsaG023942 | MtrunA17_Chr2g0329921 | 32.877 | 219 | 102 | 5 | 1 | 187 | 1 | 206 | 4.62e-26 | 103 |
MsaG023942 | MtrunA17_Chr1g0166681 | 67.188 | 64 | 21 | 0 | 1 | 64 | 1 | 64 | 3.99e-25 | 98.6 |
MsaG023942 | MtrunA17_Chr1g0195261 | 74.000 | 50 | 13 | 0 | 1 | 50 | 1 | 50 | 4.41e-21 | 83.6 |
MsaG023942 | MtrunA17_Chr2g0293401 | 61.290 | 62 | 24 | 0 | 61 | 122 | 3 | 64 | 1.41e-15 | 69.7 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG023942 | AT1G49950.3 | 46.899 | 258 | 111 | 9 | 1 | 250 | 1 | 240 | 7.66e-66 | 207 |
MsaG023942 | AT1G49950.1 | 46.899 | 258 | 111 | 9 | 1 | 250 | 1 | 240 | 7.66e-66 | 207 |
MsaG023942 | AT1G49950.2 | 46.899 | 258 | 111 | 9 | 1 | 250 | 1 | 240 | 7.66e-66 | 207 |
MsaG023942 | AT5G67580.2 | 39.224 | 232 | 136 | 4 | 1 | 229 | 1 | 230 | 6.04e-45 | 153 |
MsaG023942 | AT5G67580.1 | 39.224 | 232 | 136 | 4 | 1 | 229 | 1 | 230 | 6.04e-45 | 153 |
MsaG023942 | AT3G49850.1 | 36.530 | 219 | 137 | 2 | 1 | 219 | 1 | 217 | 2.34e-40 | 141 |
MsaG023942 | AT3G49850.2 | 36.530 | 219 | 137 | 2 | 1 | 219 | 1 | 217 | 2.34e-40 | 141 |
MsaG023942 | AT1G72740.2 | 36.316 | 190 | 113 | 3 | 1 | 187 | 1 | 185 | 1.25e-28 | 110 |
MsaG023942 | AT1G72740.1 | 36.957 | 184 | 108 | 3 | 1 | 181 | 1 | 179 | 2.70e-27 | 107 |
MsaG023942 | AT1G17520.1 | 35.638 | 188 | 116 | 1 | 1 | 183 | 1 | 188 | 7.79e-25 | 100 |
MsaG023942 | AT1G17520.4 | 34.737 | 190 | 119 | 1 | 1 | 185 | 1 | 190 | 2.35e-24 | 99.0 |
MsaG023942 | AT1G17520.2 | 35.979 | 189 | 115 | 2 | 1 | 183 | 1 | 189 | 6.95e-24 | 97.8 |
MsaG023942 | AT1G17520.3 | 35.079 | 191 | 118 | 2 | 1 | 185 | 1 | 191 | 2.23e-23 | 96.7 |
Find 67 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
AACAGATATGCTGGAAATTA+AGG | 0.140872 | 4:-93966168 | MsaT023942.1:CDS |
AACTATTGCTTCTTTCATTA+AGG | 0.194532 | 4:-93965219 | MsaT023942.1:intron |
AAACCGACCCATGTTATTAT+TGG | 0.212298 | 4:-93962763 | MsaT023942.1:CDS |
ACTCTCAGCTAGCAATAAAA+AGG | 0.232134 | 4:-93966292 | MsaT023942.1:CDS |
TAGATATTGCTTCCACTATA+AGG | 0.286103 | 4:+93965273 | None:intergenic |
TGTGGGTTGGATAGGATAAA+TGG | 0.326262 | 4:-93966358 | MsaT023942.1:intron |
TGAAGCATGGCGTAGGTAAA+TGG | 0.346059 | 4:-93966558 | MsaT023942.1:CDS |
TTCCTCTATCTGAATATGCT+TGG | 0.349369 | 4:+93962787 | None:intergenic |
AAATAAGCTGTCAGCAAAAC+TGG | 0.353881 | 4:-93963775 | MsaT023942.1:CDS |
TCCTCTATCTGAATATGCTT+GGG | 0.366075 | 4:+93962788 | None:intergenic |
GGCTGAGATAGACTTGGAAT+TGG | 0.370284 | 4:-93962655 | MsaT023942.1:CDS |
CTATTAAATCTGACAGGGGT+GGG | 0.403434 | 4:-93962722 | MsaT023942.1:CDS |
ACAGATATGCTGGAAATTAA+GGG | 0.415666 | 4:-93966167 | MsaT023942.1:CDS |
GAGGAAGCGGCTCTCAAAGC+TGG | 0.427705 | 4:-93966586 | MsaT023942.1:CDS |
ACGGAGTCGTCACGCTGTTC+TGG | 0.440395 | 4:+93966254 | None:intergenic |
TATTAAATCTGACAGGGGTG+GGG | 0.448513 | 4:-93962721 | MsaT023942.1:CDS |
TCAAGTTAAAACAGATATGC+TGG | 0.453383 | 4:-93966177 | MsaT023942.1:CDS |
AATCTGCCGGTGCGCAGTAT+TGG | 0.455578 | 4:+93963802 | None:intergenic |
ATTAAATCTGACAGGGGTGG+GGG | 0.463232 | 4:-93962720 | MsaT023942.1:CDS |
AAGCCTCTATTAAATCTGAC+AGG | 0.463302 | 4:-93962728 | MsaT023942.1:CDS |
TTCACACTTCAATCAAGAGC+AGG | 0.468692 | 4:+93962102 | None:intergenic |
AATATGAGTCTGAAGGCAAA+TGG | 0.474909 | 4:-93966332 | MsaT023942.1:CDS |
ACCCAAGCATATTCAGATAG+AGG | 0.477513 | 4:-93962789 | MsaT023942.1:CDS |
AGGCAAATGGATCATCCTCC+GGG | 0.485206 | 4:-93966319 | MsaT023942.1:CDS |
ACCCCTGTCAGATTTAATAG+AGG | 0.496957 | 4:+93962725 | None:intergenic |
CCTCCCTTCCAATAATAACA+TGG | 0.497696 | 4:+93962755 | None:intergenic |
AAGGCAAATGGATCATCCTC+CGG | 0.503120 | 4:-93966320 | MsaT023942.1:CDS |
CAGATTGGACAACCTTATAG+TGG | 0.503998 | 4:-93965285 | MsaT023942.1:CDS |
CTGGTGGATCTTGTATCTAG+TGG | 0.509226 | 4:-93963756 | MsaT023942.1:CDS |
GTCCGGAAAGGTCTATCAAA+AGG | 0.511188 | 4:-93966145 | MsaT023942.1:intron |
TATGCTGGAAATTAAGGGTC+CGG | 0.513448 | 4:-93966162 | MsaT023942.1:CDS |
TTATATTTCAGGTGAAACAT+AGG | 0.516350 | 4:-93962827 | MsaT023942.1:intron |
CGACCCATGTTATTATTGGA+AGG | 0.524027 | 4:-93962759 | MsaT023942.1:CDS |
ATCTAGTGGAAAACTGATCA+AGG | 0.537966 | 4:-93963742 | MsaT023942.1:intron |
AAAGTCCATGTCTTTACAAG+AGG | 0.539777 | 4:-93962625 | MsaT023942.1:intron |
CCGCTCAAATATCGATCTCA+AGG | 0.560055 | 4:-93966491 | MsaT023942.1:intron |
AAGAAAGGCTGAGATAGACT+TGG | 0.566957 | 4:-93962661 | MsaT023942.1:CDS |
ATGGTCATCAGAAGAGGAAG+CGG | 0.577986 | 4:-93966599 | MsaT023942.1:CDS |
ACAGAAATGGTCATCAGAAG+AGG | 0.578108 | 4:-93966605 | MsaT023942.1:CDS |
AGCAATATCTAGCTTGAATG+AGG | 0.580943 | 4:-93965261 | MsaT023942.1:CDS |
GACCCATGTTATTATTGGAA+GGG | 0.581327 | 4:-93962758 | MsaT023942.1:CDS |
CTATCTGAATATGCTTGGGT+AGG | 0.584721 | 4:+93962792 | None:intergenic |
ATGGAGAAATATGAGTCTGA+AGG | 0.599241 | 4:-93966339 | MsaT023942.1:CDS |
TGGGTGCTACTAGACAGAAA+TGG | 0.601772 | 4:-93966618 | MsaT023942.1:CDS |
AGCCTCTATTAAATCTGACA+GGG | 0.601960 | 4:-93962727 | MsaT023942.1:CDS |
CTTCCAATAATAACATGGGT+CGG | 0.603083 | 4:+93962760 | None:intergenic |
CCATGTTATTATTGGAAGGG+AGG | 0.603196 | 4:-93962755 | MsaT023942.1:CDS |
GGAGTTGTGAAGCATGGCGT+AGG | 0.603718 | 4:-93966565 | MsaT023942.1:CDS |
TGCTAGCTGAGAGTTGTCCC+CGG | 0.606787 | 4:+93966301 | None:intergenic |
TCACACTTCAATCAAGAGCA+GGG | 0.606896 | 4:+93962103 | None:intergenic |
CTCCCTTCCAATAATAACAT+GGG | 0.607660 | 4:+93962756 | None:intergenic |
TCTATTAAATCTGACAGGGG+TGG | 0.615717 | 4:-93962723 | MsaT023942.1:CDS |
AAAGCTGGAGTTGTGAAGCA+TGG | 0.620365 | 4:-93966571 | MsaT023942.1:CDS |
TAAGCTGTCAGCAAAACTGG+TGG | 0.625095 | 4:-93963772 | MsaT023942.1:CDS |
TACAACACATGGTTAAACTC+AGG | 0.630999 | 4:+93966517 | None:intergenic |
CCTTGAGATCGATATTTGAG+CGG | 0.641849 | 4:+93966491 | None:intergenic |
TGGAAATTAAGGGTCCGGAA+AGG | 0.649175 | 4:-93966157 | MsaT023942.1:CDS |
TCTAGCTTGAATGAGGTCGA+TGG | 0.649394 | 4:-93965254 | MsaT023942.1:CDS |
GTAGAACCAATACTGCGCAC+CGG | 0.653755 | 4:-93963808 | MsaT023942.1:intron |
GATTACCTCTTGTAAAGACA+TGG | 0.659824 | 4:+93962620 | None:intergenic |
GCCTCTATTAAATCTGACAG+GGG | 0.668262 | 4:-93962726 | MsaT023942.1:CDS |
TAAATGGAGTAAGATACTCA+AGG | 0.669197 | 4:-93966542 | MsaT023942.1:CDS |
AGTAACAAGATTTACAGCCA+CGG | 0.669902 | 4:+93966235 | None:intergenic |
TTGAGCGGATATACAACACA+TGG | 0.677687 | 4:+93966506 | None:intergenic |
AGAACAGCGTGACGACTCCG+TGG | 0.703510 | 4:-93966252 | MsaT023942.1:CDS |
TAGCTGAGAGTTGTCCCCGG+AGG | 0.710409 | 4:+93966304 | None:intergenic |
GGCAAATGGATCATCCTCCG+GGG | 0.731603 | 4:-93966318 | MsaT023942.1:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr4 | gene | 93962110 | 93966641 | 93962110 | ID=MsaG023942 |
Chr4 | mRNA | 93962110 | 93966641 | 93962110 | ID=MsaT023942.1;Parent=MsaG023942 |
Chr4 | exon | 93962110 | 93962130 | 93962110 | ID=MsaT023942.1.exon6;Parent=MsaT023942.1 |
Chr4 | CDS | 93962110 | 93962130 | 93962110 | ID=cds.MsaT023942.1;Parent=MsaT023942.1 |
Chr4 | exon | 93962626 | 93962838 | 93962626 | ID=MsaT023942.1.exon5;Parent=MsaT023942.1 |
Chr4 | CDS | 93962626 | 93962838 | 93962626 | ID=cds.MsaT023942.1;Parent=MsaT023942.1 |
Chr4 | exon | 93963743 | 93963826 | 93963743 | ID=MsaT023942.1.exon4;Parent=MsaT023942.1 |
Chr4 | CDS | 93963743 | 93963826 | 93963743 | ID=cds.MsaT023942.1;Parent=MsaT023942.1 |
Chr4 | exon | 93965220 | 93965304 | 93965220 | ID=MsaT023942.1.exon3;Parent=MsaT023942.1 |
Chr4 | CDS | 93965220 | 93965304 | 93965220 | ID=cds.MsaT023942.1;Parent=MsaT023942.1 |
Chr4 | exon | 93966146 | 93966366 | 93966146 | ID=MsaT023942.1.exon2;Parent=MsaT023942.1 |
Chr4 | CDS | 93966146 | 93966366 | 93966146 | ID=cds.MsaT023942.1;Parent=MsaT023942.1 |
Chr4 | exon | 93966492 | 93966641 | 93966492 | ID=MsaT023942.1.exon1;Parent=MsaT023942.1 |
Chr4 | CDS | 93966492 | 93966641 | 93966492 | ID=cds.MsaT023942.1;Parent=MsaT023942.1 |
Gene Sequence |
Protein sequence |