Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG024058 | XP_003630403.2 | 96.137 | 699 | 25 | 1 | 1 | 699 | 1 | 697 | 0.0 | 1376 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG024058 | sp|O88379|BAZ1A_MOUSE | 28.692 | 237 | 114 | 7 | 1 | 189 | 1 | 230 | 1.55e-16 | 88.2 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG024058 | tr|G7LFT5|G7LFT5_MEDTR | 96.137 | 699 | 25 | 1 | 1 | 699 | 1 | 697 | 0.0 | 1376 |
Gene ID | Type | Classification |
---|---|---|
MsaG024058 | TR | DDT |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000234 | MsaG024058 | 0.860324 | 4.396564e-63 | 3.461635e-60 |
MsaG000379 | MsaG024058 | 0.842289 | 5.266371e-58 | 2.210297e-55 |
MsaG000413 | MsaG024058 | 0.831459 | 2.976323e-55 | 8.982561e-53 |
MsaG000694 | MsaG024058 | 0.852009 | 1.170821e-60 | 6.804073e-58 |
MsaG000719 | MsaG024058 | 0.805572 | 2.117081e-49 | 3.252485e-47 |
MsaG000753 | MsaG024058 | 0.820323 | 1.277692e-52 | 2.834374e-50 |
MsaG000792 | MsaG024058 | 0.814966 | 2.035259e-51 | 3.931062e-49 |
MsaG000999 | MsaG024058 | 0.869346 | 6.725956e-66 | 7.583668e-63 |
MsaG001281 | MsaG024058 | 0.802005 | 1.155663e-48 | 1.635017e-46 |
MsaG001283 | MsaG024058 | 0.803081 | 6.952266e-49 | 1.008182e-46 |
MsaG001373 | MsaG024058 | 0.865773 | 9.271949e-65 | 9.034465e-62 |
MsaG001490 | MsaG024058 | 0.850464 | 3.181458e-60 | 1.751970e-57 |
MsaG001875 | MsaG024058 | 0.899527 | 4.162008e-77 | 2.070665e-73 |
MsaG001936 | MsaG024058 | 0.864867 | 1.782518e-64 | 1.675201e-61 |
MsaG002114 | MsaG024058 | 0.854313 | 2.579960e-61 | 1.626512e-58 |
MsaG002717 | MsaG024058 | 0.815262 | 1.750917e-51 | 3.407270e-49 |
MsaG002884 | MsaG024058 | 0.830235 | 5.918714e-55 | 1.724478e-52 |
MsaG003042 | MsaG024058 | 0.872278 | 7.368056e-67 | 9.409145e-64 |
MsaG003252 | MsaG024058 | 0.879198 | 3.187418e-69 | 5.544691e-66 |
MsaG003460 | MsaG024058 | 0.821974 | 5.342259e-53 | 1.238043e-50 |
MsaG003435 | MsaG024058 | 0.827998 | 2.051453e-54 | 5.609653e-52 |
MsaG003605 | MsaG024058 | 0.848165 | 1.380280e-59 | 7.028669e-57 |
MsaG003616 | MsaG024058 | 0.846500 | 3.932278e-59 | 1.893580e-56 |
MsaG003646 | MsaG024058 | 0.862735 | 8.139348e-64 | 7.029991e-61 |
MsaG003750 | MsaG024058 | 0.848524 | 1.099053e-59 | 5.664092e-57 |
MsaG003896 | MsaG024058 | 0.823323 | 2.602988e-53 | 6.255857e-51 |
MsaG003930 | MsaG024058 | 0.848772 | 9.388346e-60 | 4.879497e-57 |
MsaG003934 | MsaG024058 | 0.830405 | 5.382153e-55 | 1.575820e-52 |
MsaG004165 | MsaG024058 | 0.837641 | 8.462481e-57 | 3.069654e-54 |
MsaG004227 | MsaG024058 | 0.827920 | 2.142292e-54 | 5.845260e-52 |
MsaG004306 | MsaG024058 | 0.803033 | 7.112486e-49 | 1.030268e-46 |
MsaG004402 | MsaG024058 | 0.833118 | 1.160945e-55 | 3.677848e-53 |
MsaG004456 | MsaG024058 | 0.814829 | 2.182939e-51 | 4.201638e-49 |
MsaG004466 | MsaG024058 | 0.880858 | 8.219662e-70 | 1.544404e-66 |
MsaG004596 | MsaG024058 | 0.805149 | 2.593719e-49 | 3.945905e-47 |
MsaG004686 | MsaG024058 | 0.896559 | 7.430819e-76 | 3.120491e-72 |
MsaG004967 | MsaG024058 | 0.830932 | 4.004153e-55 | 1.190165e-52 |
MsaG005348 | MsaG024058 | 0.831856 | 2.377657e-55 | 7.260316e-53 |
MsaG005351 | MsaG024058 | 0.854227 | 2.730406e-61 | 1.716049e-58 |
MsaG005403 | MsaG024058 | 0.847282 | 2.409142e-59 | 1.190918e-56 |
MsaG005559 | MsaG024058 | 0.813766 | 3.738800e-51 | 7.006716e-49 |
MsaG005598 | MsaG024058 | 0.843183 | 3.054894e-58 | 1.319455e-55 |
MsaG005631 | MsaG024058 | 0.862487 | 9.696849e-64 | 8.294407e-61 |
MsaG006002 | MsaG024058 | 0.866866 | 4.189794e-65 | 4.268220e-62 |
MsaG006027 | MsaG024058 | 0.843146 | 3.125306e-58 | 1.348239e-55 |
MsaG006078 | MsaG024058 | 0.808994 | 4.016642e-50 | 6.694949e-48 |
MsaG006186 | MsaG024058 | 0.874250 | 1.614726e-67 | 2.247012e-64 |
MsaG006293 | MsaG024058 | 0.856598 | 5.607285e-62 | 3.839477e-59 |
MsaG006357 | MsaG024058 | 0.813633 | 3.997310e-51 | 7.466260e-49 |
MsaG006425 | MsaG024058 | 0.824541 | 1.352386e-53 | 3.359582e-51 |
MsaG006526 | MsaG024058 | 0.869332 | 6.799142e-66 | 7.661364e-63 |
MsaG006589 | MsaG024058 | 0.829914 | 7.085165e-55 | 2.045475e-52 |
MsaG006549 | MsaG024058 | 0.876929 | 1.968678e-68 | 3.085940e-65 |
MsaG006743 | MsaG024058 | 0.833010 | 1.235092e-55 | 3.899889e-53 |
MsaG006831 | MsaG024058 | 0.839948 | 2.156808e-57 | 8.405878e-55 |
MsaG006937 | MsaG024058 | 0.865432 | 1.186598e-64 | 1.140516e-61 |
MsaG007015 | MsaG024058 | 0.812285 | 7.867560e-51 | 1.420854e-48 |
MsaG007317 | MsaG024058 | 0.899176 | 5.881047e-77 | 2.866545e-73 |
MsaG007375 | MsaG024058 | 0.866185 | 6.881650e-65 | 6.818292e-62 |
MsaG007585 | MsaG024058 | 0.803304 | 6.254000e-49 | 9.116009e-47 |
MsaG007607 | MsaG024058 | 0.809422 | 3.255778e-50 | 5.482973e-48 |
MsaG007623 | MsaG024058 | 0.836449 | 1.700972e-56 | 5.950876e-54 |
MsaG007686 | MsaG024058 | 0.830762 | 4.405273e-55 | 1.303002e-52 |
MsaG007665 | MsaG024058 | 0.813147 | 5.106546e-51 | 9.422621e-49 |
MsaG007862 | MsaG024058 | 0.840726 | 1.353553e-57 | 5.405478e-55 |
MsaG007759 | MsaG024058 | 0.815444 | 1.596313e-51 | 3.120668e-49 |
MsaG007970 | MsaG024058 | 0.818904 | 2.683519e-52 | 5.734106e-50 |
MsaG008367 | MsaG024058 | 0.877546 | 1.204336e-68 | 1.941606e-65 |
MsaG008616 | MsaG024058 | 0.802117 | 1.096542e-48 | 1.555330e-46 |
MsaG008998 | MsaG024058 | 0.820829 | 9.786163e-53 | 2.199990e-50 |
MsaG009000 | MsaG024058 | 0.817354 | 5.993444e-52 | 1.230314e-49 |
MsaG009172 | MsaG024058 | 0.873510 | 2.864343e-67 | 3.858241e-64 |
MsaG009256 | MsaG024058 | 0.901110 | 8.626627e-78 | 4.711574e-74 |
MsaG009270 | MsaG024058 | 0.857613 | 2.823651e-62 | 2.006825e-59 |
MsaG009372 | MsaG024058 | 0.842839 | 3.768105e-58 | 1.609649e-55 |
MsaG009495 | MsaG024058 | 0.817961 | 4.379514e-52 | 9.131894e-50 |
MsaG009478 | MsaG024058 | 0.878534 | 5.450706e-69 | 9.194108e-66 |
MsaG009714 | MsaG024058 | 0.827202 | 3.179367e-54 | 8.501714e-52 |
MsaG009880 | MsaG024058 | 0.870283 | 3.337414e-66 | 3.913666e-63 |
MsaG010298 | MsaG024058 | 0.826224 | 5.428136e-54 | 1.412498e-51 |
MsaG010597 | MsaG024058 | 0.800133 | 2.777992e-48 | 3.767293e-46 |
MsaG010609 | MsaG024058 | 0.809850 | 2.637411e-50 | 4.487672e-48 |
MsaG010891 | MsaG024058 | 0.872414 | 6.642490e-67 | 8.531632e-64 |
MsaG011119 | MsaG024058 | 0.827638 | 2.501107e-54 | 6.770657e-52 |
MsaG011133 | MsaG024058 | 0.802951 | 7.393765e-49 | 1.068982e-46 |
MsaG011199 | MsaG024058 | 0.860439 | 4.060965e-63 | 3.211241e-60 |
MsaG011218 | MsaG024058 | 0.848606 | 1.043300e-59 | 5.392102e-57 |
MsaG011230 | MsaG024058 | 0.815103 | 1.898980e-51 | 3.680353e-49 |
MsaG011238 | MsaG024058 | 0.881714 | 4.054026e-70 | 7.929417e-67 |
MsaG011389 | MsaG024058 | 0.846683 | 3.508036e-59 | 1.699635e-56 |
MsaG011428 | MsaG024058 | 0.818336 | 3.605664e-52 | 7.591258e-50 |
MsaG011650 | MsaG024058 | 0.871374 | 1.466114e-66 | 1.800916e-63 |
MsaG011749 | MsaG024058 | 0.833571 | 8.963879e-56 | 2.877595e-53 |
MsaG011979 | MsaG024058 | 0.823304 | 2.629131e-53 | 6.315349e-51 |
MsaG012161 | MsaG024058 | 0.832851 | 1.351855e-55 | 4.248751e-53 |
MsaG012301 | MsaG024058 | 0.866474 | 5.574591e-65 | 5.587217e-62 |
MsaG012393 | MsaG024058 | 0.814278 | 2.886715e-51 | 5.479775e-49 |
MsaG012438 | MsaG024058 | 0.854437 | 2.376978e-61 | 1.505148e-58 |
MsaG012443 | MsaG024058 | 0.800208 | 2.683026e-48 | 3.644549e-46 |
MsaG012656 | MsaG024058 | 0.821549 | 6.691443e-53 | 1.533274e-50 |
MsaG012774 | MsaG024058 | 0.867469 | 2.695322e-65 | 2.812789e-62 |
MsaG012887 | MsaG024058 | 0.846358 | 4.299204e-59 | 2.060547e-56 |
MsaG013265 | MsaG024058 | 0.801623 | 1.383721e-48 | 1.940762e-46 |
MsaG013308 | MsaG024058 | 0.804919 | 2.896545e-49 | 4.383063e-47 |
MsaG013633 | MsaG024058 | 0.847649 | 1.911753e-59 | 9.567355e-57 |
MsaG014043 | MsaG024058 | 0.854295 | 2.609924e-61 | 1.644395e-58 |
MsaG014143 | MsaG024058 | 0.814624 | 2.422105e-51 | 4.637835e-49 |
MsaG014221 | MsaG024058 | 0.811370 | 1.242363e-50 | 2.193784e-48 |
MsaG014300 | MsaG024058 | 0.824895 | 1.117181e-53 | 2.802239e-51 |
MsaG014548 | MsaG024058 | 0.812170 | 8.332430e-51 | 1.500543e-48 |
MsaG014615 | MsaG024058 | 0.813818 | 3.641908e-51 | 6.834265e-49 |
MsaG014630 | MsaG024058 | 0.879712 | 2.100474e-69 | 3.740863e-66 |
MsaG014642 | MsaG024058 | 0.869840 | 4.654346e-66 | 5.357014e-63 |
MsaG014720 | MsaG024058 | 0.851872 | 1.279785e-60 | 7.401017e-58 |
MsaG014726 | MsaG024058 | 0.878256 | 6.821570e-69 | 1.136139e-65 |
MsaG014840 | MsaG024058 | 0.838057 | 6.624162e-57 | 2.433747e-54 |
MsaG014841 | MsaG024058 | 0.896884 | 5.445114e-76 | 2.328960e-72 |
MsaG014945 | MsaG024058 | 0.896976 | 4.985405e-76 | 2.143395e-72 |
MsaG015088 | MsaG024058 | 0.833140 | 1.146781e-55 | 3.635320e-53 |
MsaG015113 | MsaG024058 | 0.850438 | 3.234953e-60 | 1.779799e-57 |
MsaG015347 | MsaG024058 | 0.857884 | 2.349181e-62 | 1.686629e-59 |
MsaG015397 | MsaG024058 | 0.859826 | 6.207035e-63 | 4.793933e-60 |
MsaG016261 | MsaG024058 | 0.827157 | 3.258402e-54 | 8.702152e-52 |
MsaG016375 | MsaG024058 | 0.819965 | 1.541832e-52 | 3.387965e-50 |
MsaG016387 | MsaG024058 | 0.864935 | 1.697069e-64 | 1.599133e-61 |
MsaG016472 | MsaG024058 | 0.845407 | 7.768815e-59 | 3.608001e-56 |
MsaG016687 | MsaG024058 | 0.863950 | 3.435599e-64 | 3.112702e-61 |
MsaG016688 | MsaG024058 | 0.824313 | 1.529038e-53 | 3.775005e-51 |
MsaG016773 | MsaG024058 | 0.861028 | 2.696478e-63 | 2.180100e-60 |
MsaG016801 | MsaG024058 | 0.872355 | 6.951729e-67 | 8.906712e-64 |
MsaG016982 | MsaG024058 | 0.869006 | 8.665178e-66 | 9.633148e-63 |
MsaG017107 | MsaG024058 | 0.813067 | 5.315389e-51 | 9.788788e-49 |
MsaG017181 | MsaG024058 | 0.865405 | 1.209959e-64 | 1.161699e-61 |
MsaG017243 | MsaG024058 | 0.877340 | 1.419619e-68 | 2.267025e-65 |
MsaG017362 | MsaG024058 | 0.816746 | 8.194617e-52 | 1.656045e-49 |
MsaG017405 | MsaG024058 | 0.838493 | 5.119488e-57 | 1.906566e-54 |
MsaG017461 | MsaG024058 | 0.817509 | 5.533220e-52 | 1.140387e-49 |
MsaG017569 | MsaG024058 | 0.817029 | 7.085211e-52 | 1.442360e-49 |
MsaG017571 | MsaG024058 | 0.851943 | 1.222019e-60 | 7.084863e-58 |
MsaG017587 | MsaG024058 | 0.849832 | 4.772606e-60 | 2.571874e-57 |
MsaG017825 | MsaG024058 | 0.800892 | 1.948797e-48 | 2.688460e-46 |
MsaG017879 | MsaG024058 | 0.841479 | 8.597757e-58 | 3.516580e-55 |
MsaG018260 | MsaG024058 | 0.821111 | 8.435697e-53 | 1.910662e-50 |
MsaG018340 | MsaG024058 | 0.815609 | 1.467451e-51 | 2.880835e-49 |
MsaG018439 | MsaG024058 | 0.827760 | 2.339274e-54 | 6.354202e-52 |
MsaG018504 | MsaG024058 | 0.899929 | 2.799493e-77 | 1.426142e-73 |
MsaG018501 | MsaG024058 | 0.809683 | 2.863068e-50 | 4.852063e-48 |
MsaG018539 | MsaG024058 | 0.813822 | 3.633470e-51 | 6.819221e-49 |
MsaG018592 | MsaG024058 | 0.833983 | 7.079994e-56 | 2.300464e-53 |
MsaG018863 | MsaG024058 | 0.810496 | 1.916689e-50 | 3.313004e-48 |
MsaG019034 | MsaG024058 | 0.893217 | 1.721422e-74 | 6.017853e-71 |
MsaG019071 | MsaG024058 | 0.885632 | 1.485209e-71 | 3.507889e-68 |
MsaG019209 | MsaG024058 | 0.822204 | 4.727083e-53 | 1.102248e-50 |
MsaG019211 | MsaG024058 | 0.835166 | 3.582842e-56 | 1.206053e-53 |
MsaG019214 | MsaG024058 | 0.801551 | 1.431021e-48 | 2.003836e-46 |
MsaG019268 | MsaG024058 | 0.856127 | 7.695872e-62 | 5.179506e-59 |
MsaG019276 | MsaG024058 | 0.808697 | 4.645825e-50 | 7.688727e-48 |
MsaG019453 | MsaG024058 | 0.871169 | 1.712390e-66 | 2.085002e-63 |
MsaG019532 | MsaG024058 | 0.803186 | 6.615309e-49 | 9.616537e-47 |
MsaG019557 | MsaG024058 | 0.818894 | 2.697908e-52 | 5.763254e-50 |
MsaG019641 | MsaG024058 | 0.855107 | 1.522344e-61 | 9.872590e-59 |
MsaG019740 | MsaG024058 | 0.816836 | 7.826093e-52 | 1.585180e-49 |
MsaG019939 | MsaG024058 | 0.817471 | 5.640861e-52 | 1.161455e-49 |
MsaG019945 | MsaG024058 | 0.860224 | 4.712440e-63 | 3.695861e-60 |
MsaG020015 | MsaG024058 | 0.801545 | 1.435112e-48 | 2.009283e-46 |
MsaG020042 | MsaG024058 | 0.873061 | 4.044948e-67 | 5.343733e-64 |
MsaG020075 | MsaG024058 | 0.856897 | 4.584966e-62 | 3.173698e-59 |
MsaG020148 | MsaG024058 | 0.805168 | 2.569775e-49 | 3.911293e-47 |
MsaG020257 | MsaG024058 | 0.824298 | 1.542014e-53 | 3.805395e-51 |
MsaG020356 | MsaG024058 | 0.807963 | 6.649686e-50 | 1.081196e-47 |
MsaG020370 | MsaG024058 | 0.897689 | 2.506372e-76 | 1.122521e-72 |
MsaG020405 | MsaG024058 | 0.823837 | 1.975400e-53 | 4.814145e-51 |
MsaG020423 | MsaG024058 | 0.815110 | 1.891603e-51 | 3.666747e-49 |
MsaG020558 | MsaG024058 | 0.842338 | 5.111872e-58 | 2.148907e-55 |
MsaG020552 | MsaG024058 | 0.844370 | 1.475665e-58 | 6.622813e-56 |
MsaG020577 | MsaG024058 | 0.832677 | 1.492671e-55 | 4.667500e-53 |
MsaG020576 | MsaG024058 | 0.800472 | 2.371736e-48 | 3.241120e-46 |
MsaG020670 | MsaG024058 | 0.825476 | 8.152677e-54 | 2.077845e-51 |
MsaG020725 | MsaG024058 | 0.838119 | 6.386132e-57 | 2.350765e-54 |
MsaG021083 | MsaG024058 | 0.810120 | 2.308230e-50 | 3.953296e-48 |
MsaG021109 | MsaG024058 | 0.841308 | 9.536368e-58 | 3.879274e-55 |
MsaG022259 | MsaG024058 | 0.810571 | 1.846582e-50 | 3.197625e-48 |
MsaG022404 | MsaG024058 | 0.877388 | 1.366507e-68 | 2.186967e-65 |
MsaG022540 | MsaG024058 | 0.845287 | 8.371328e-59 | 3.872037e-56 |
MsaG022550 | MsaG024058 | 0.834757 | 4.536922e-56 | 1.508775e-53 |
MsaG022793 | MsaG024058 | 0.866950 | 3.940772e-65 | 4.028349e-62 |
MsaG022850 | MsaG024058 | 0.818961 | 2.604371e-52 | 5.573521e-50 |
MsaG023110 | MsaG024058 | 0.828512 | 1.544750e-54 | 4.285545e-52 |
MsaG023265 | MsaG024058 | 0.842432 | 4.828723e-58 | 2.036087e-55 |
MsaG023269 | MsaG024058 | 0.833792 | 7.901011e-56 | 2.552833e-53 |
MsaG023554 | MsaG024058 | 0.852127 | 1.083717e-60 | 6.323878e-58 |
MsaG023556 | MsaG024058 | 0.809354 | 3.365775e-50 | 5.658622e-48 |
MsaG023671 | MsaG024058 | 0.831959 | 2.243401e-55 | 6.870685e-53 |
MsaG023746 | MsaG024058 | 0.880776 | 8.793995e-70 | 1.646175e-66 |
MsaG023749 | MsaG024058 | 0.800011 | 2.941239e-48 | 3.977854e-46 |
MsaG023817 | MsaG024058 | 0.800074 | 2.855664e-48 | 3.867571e-46 |
MsaG023897 | MsaG024058 | 0.845020 | 9.876193e-59 | 4.529041e-56 |
MsaG023970 | MsaG024058 | 0.809569 | 3.028198e-50 | 5.117981e-48 |
MsaG023979 | MsaG024058 | 0.804623 | 3.335815e-49 | 5.013236e-47 |
MsaG024058 | MsaG024118 | 0.892327 | 3.905947e-74 | 1.301816e-70 |
MsaG024058 | MsaG024136 | 0.819936 | 1.564858e-52 | 3.435887e-50 |
MsaG024058 | MsaG024181 | 0.820871 | 9.574704e-53 | 2.154879e-50 |
MsaG024058 | MsaG024169 | 0.874896 | 9.763216e-68 | 1.397774e-64 |
MsaG024058 | MsaG024171 | 0.813387 | 4.526022e-51 | 8.401872e-49 |
MsaG024058 | MsaG024360 | 0.875749 | 5.006850e-68 | 7.444031e-65 |
MsaG024058 | MsaG024380 | 0.863431 | 4.972765e-64 | 4.414501e-61 |
MsaG024058 | MsaG024410 | 0.824371 | 1.482309e-53 | 3.665406e-51 |
MsaG024058 | MsaG024652 | 0.865222 | 1.380386e-64 | 1.315887e-61 |
MsaG024058 | MsaG025081 | 0.881861 | 3.586638e-70 | 7.064119e-67 |
MsaG024058 | MsaG025262 | 0.857160 | 3.837713e-62 | 2.682139e-59 |
MsaG024058 | MsaG025779 | 0.805671 | 2.018535e-49 | 3.108354e-47 |
MsaG024058 | MsaG026798 | 0.821028 | 8.811844e-53 | 1.991579e-50 |
MsaG024058 | MsaG026926 | 0.830320 | 5.643544e-55 | 1.648302e-52 |
MsaG024058 | MsaG026966 | 0.824657 | 1.270043e-53 | 3.164957e-51 |
MsaG024058 | MsaG027021 | 0.884113 | 5.427274e-71 | 1.190749e-67 |
MsaG024058 | MsaG027041 | 0.838469 | 5.191878e-57 | 1.932042e-54 |
MsaG024058 | MsaG027046 | 0.807738 | 7.420728e-50 | 1.200058e-47 |
MsaG024058 | MsaG027129 | 0.809730 | 2.797863e-50 | 4.746871e-48 |
MsaG024058 | MsaG027183 | 0.818512 | 3.290678e-52 | 6.959863e-50 |
MsaG024058 | MsaG027217 | 0.820918 | 9.337844e-53 | 2.104273e-50 |
MsaG024058 | MsaG027424 | 0.855024 | 1.608711e-61 | 1.040167e-58 |
MsaG024058 | MsaG027408 | 0.859662 | 6.948434e-63 | 5.333289e-60 |
MsaG024058 | MsaG027474 | 0.830410 | 5.367189e-55 | 1.571646e-52 |
MsaG024058 | MsaG027562 | 0.866975 | 3.869623e-65 | 3.959512e-62 |
MsaG024058 | MsaG027566 | 0.814634 | 2.409992e-51 | 4.615787e-49 |
MsaG024058 | MsaG027679 | 0.859314 | 8.833611e-63 | 6.691901e-60 |
MsaG024058 | MsaG027999 | 0.864042 | 3.217734e-64 | 2.926233e-61 |
MsaG024058 | MsaG028158 | 0.811627 | 1.092675e-50 | 1.941668e-48 |
MsaG024058 | MsaG028200 | 0.823184 | 2.802696e-53 | 6.710407e-51 |
MsaG024058 | MsaG028282 | 0.811736 | 1.035242e-50 | 1.844518e-48 |
MsaG024058 | MsaG028342 | 0.841607 | 7.958238e-58 | 3.268287e-55 |
MsaG024058 | MsaG028625 | 0.858402 | 1.649845e-62 | 1.207697e-59 |
MsaG024058 | MsaG028657 | 0.858439 | 1.608664e-62 | 1.179262e-59 |
MsaG024058 | MsaG028842 | 0.821731 | 6.076465e-53 | 1.399129e-50 |
MsaG024058 | MsaG028950 | 0.815642 | 1.442842e-51 | 2.834898e-49 |
MsaG024058 | MsaG028986 | 0.814448 | 2.648245e-51 | 5.048620e-49 |
MsaG024058 | MsaG029234 | 0.828576 | 1.490377e-54 | 4.142185e-52 |
MsaG024058 | MsaG029236 | 0.842881 | 3.673906e-58 | 1.571576e-55 |
MsaG024058 | MsaG029295 | 0.807808 | 7.173797e-50 | 1.162067e-47 |
MsaG024058 | MsaG029313 | 0.844275 | 1.563706e-58 | 6.996607e-56 |
MsaG024058 | MsaG029314 | 0.848950 | 8.385795e-60 | 4.385095e-57 |
MsaG024058 | MsaG029352 | 0.841632 | 7.841556e-58 | 3.222843e-55 |
MsaG024058 | MsaG029462 | 0.803083 | 6.946345e-49 | 1.007371e-46 |
MsaG024058 | MsaG029840 | 0.813894 | 3.503920e-51 | 6.587822e-49 |
MsaG024058 | MsaG029916 | 0.876598 | 2.560677e-68 | 3.954796e-65 |
MsaG024058 | MsaG030015 | 0.822661 | 3.706003e-53 | 8.748658e-51 |
MsaG024058 | MsaG030113 | 0.822392 | 4.276730e-53 | 1.002320e-50 |
MsaG024058 | MsaG030201 | 0.881112 | 6.666519e-70 | 1.267045e-66 |
MsaG024058 | MsaG030518 | 0.834796 | 4.436050e-56 | 1.476888e-53 |
MsaG024058 | MsaG030788 | 0.851550 | 1.577311e-60 | 9.018008e-58 |
MsaG024058 | MsaG031093 | 0.820469 | 1.183114e-52 | 2.634655e-50 |
MsaG024058 | MsaG031752 | 0.810543 | 1.872262e-50 | 3.239957e-48 |
MsaG024058 | MsaG032127 | 0.890437 | 2.172790e-73 | 6.552397e-70 |
MsaG024058 | MsaG032227 | 0.809315 | 3.431309e-50 | 5.763232e-48 |
MsaG024058 | MsaG032378 | 0.895805 | 1.524189e-75 | 6.133611e-72 |
MsaG024058 | MsaG032554 | 0.802956 | 7.376770e-49 | 1.066634e-46 |
MsaG024058 | MsaG033171 | 0.803734 | 5.098064e-49 | 7.505661e-47 |
MsaG024058 | MsaG033528 | 0.844731 | 1.180731e-58 | 5.362658e-56 |
MsaG024058 | MsaG033856 | 0.822483 | 4.075401e-53 | 9.574539e-51 |
MsaG024058 | MsaG034410 | 0.840926 | 1.199614e-57 | 4.821320e-55 |
MsaG024058 | MsaG034956 | 0.804816 | 3.042260e-49 | 4.592641e-47 |
MsaG024058 | MsaG035157 | 0.851286 | 1.871163e-60 | 1.060127e-57 |
MsaG024058 | MsaG035269 | 0.894466 | 5.384542e-75 | 2.014696e-71 |
MsaG024058 | MsaG035395 | 0.846173 | 4.823499e-59 | 2.297764e-56 |
MsaG024058 | MsaG035514 | 0.824642 | 1.280587e-53 | 3.189858e-51 |
MsaG024058 | MsaG035523 | 0.866792 | 4.423184e-65 | 4.491885e-62 |
MsaG024058 | MsaG035631 | 0.849826 | 4.793727e-60 | 2.582631e-57 |
MsaG024058 | MsaG036130 | 0.807282 | 9.266284e-50 | 1.482202e-47 |
MsaG024058 | MsaG036214 | 0.869479 | 6.093490e-66 | 6.908698e-63 |
MsaG024058 | MsaG036294 | 0.861032 | 2.688539e-63 | 2.174058e-60 |
MsaG024058 | MsaG036424 | 0.814920 | 2.083829e-51 | 4.020110e-49 |
MsaG024058 | MsaG036431 | 0.855632 | 1.072838e-61 | 7.091579e-59 |
MsaG024058 | MsaG036679 | 0.822445 | 4.157839e-53 | 9.758161e-51 |
MsaG024058 | MsaG036699 | 0.827116 | 3.331664e-54 | 8.887832e-52 |
MsaG024058 | MsaG037325 | 0.838733 | 4.441699e-57 | 1.666613e-54 |
MsaG024058 | MsaG037805 | 0.880136 | 1.485772e-69 | 2.698016e-66 |
MsaG024058 | MsaG038089 | 0.841791 | 7.121145e-58 | 2.941617e-55 |
MsaG024058 | MsaG038460 | 0.801343 | 1.577970e-48 | 2.199222e-46 |
MsaG024058 | MsaG038993 | 0.812876 | 5.852112e-51 | 1.072566e-48 |
MsaG024058 | MsaG039483 | 0.830975 | 3.907914e-55 | 1.162998e-52 |
MsaG024058 | MsaG040153 | 0.800725 | 2.107332e-48 | 2.896346e-46 |
MsaG024058 | MsaG040540 | 0.809745 | 2.776421e-50 | 4.712301e-48 |
MsaG024058 | MsaG040599 | 0.887192 | 3.847484e-72 | 9.822935e-69 |
MsaG024058 | MsaG041015 | 0.826515 | 4.631131e-54 | 1.214936e-51 |
MsaG024058 | MsaG041017 | 0.829928 | 7.027712e-55 | 2.029719e-52 |
MsaG024058 | MsaG041392 | 0.807036 | 1.043821e-49 | 1.659979e-47 |
MsaG024058 | MsaG041798 | 0.811374 | 1.239378e-50 | 2.188746e-48 |
MsaG024058 | MsaG041955 | 0.801451 | 1.500119e-48 | 2.095838e-46 |
MsaG024058 | MsaG042225 | 0.867141 | 3.427440e-65 | 3.529925e-62 |
MsaG024058 | MsaG042323 | 0.858905 | 1.169232e-62 | 8.720996e-60 |
MsaG024058 | MsaG042543 | 0.846898 | 3.066169e-59 | 1.496260e-56 |
MsaG024058 | MsaG042634 | 0.831024 | 3.802533e-55 | 1.133216e-52 |
MsaG024058 | MsaG042742 | 0.849762 | 4.992731e-60 | 2.684185e-57 |
MsaG024058 | MsaG042981 | 0.814490 | 2.591864e-51 | 4.946268e-49 |
MsaG024058 | MsaG043967 | 0.833736 | 8.156884e-56 | 2.631299e-53 |
MsaG024058 | MsaG044023 | 0.843629 | 2.325099e-58 | 1.018763e-55 |
MsaG024058 | MsaG044093 | 0.815796 | 1.333443e-51 | 2.630167e-49 |
MsaG024058 | MsaG044267 | 0.870016 | 4.077798e-66 | 4.729134e-63 |
MsaG024058 | MsaG044277 | 0.896001 | 1.264931e-75 | 5.147263e-72 |
MsaG024058 | MsaG044324 | 0.839315 | 3.145099e-57 | 1.201580e-54 |
MsaG024058 | MsaG044331 | 0.822430 | 4.191523e-53 | 9.833297e-51 |
MsaG024058 | MsaG044473 | 0.834088 | 6.666458e-56 | 2.172833e-53 |
MsaG024058 | MsaG044542 | 0.803334 | 6.164483e-49 | 8.991816e-47 |
MsaG024058 | MsaG044851 | 0.868464 | 1.294529e-65 | 1.407579e-62 |
MsaG024058 | MsaG044867 | 0.883801 | 7.065064e-71 | 1.527043e-67 |
MsaG024058 | MsaG045143 | 0.843463 | 2.574330e-58 | 1.121982e-55 |
MsaG024058 | MsaG045116 | 0.808290 | 5.670228e-50 | 9.292123e-48 |
MsaG024058 | MsaG045187 | 0.879793 | 1.966271e-69 | 3.514880e-66 |
MsaG024058 | MsaG045275 | 0.815902 | 1.263202e-51 | 2.498320e-49 |
MsaG024058 | MsaG045283 | 0.818325 | 3.626408e-52 | 7.632752e-50 |
MsaG024058 | MsaG045589 | 0.836905 | 1.303134e-56 | 4.622021e-54 |
MsaG024058 | MsaG045665 | 0.827128 | 3.310279e-54 | 8.833771e-52 |
MsaG024058 | MsaG045753 | 0.842186 | 5.605276e-58 | 2.344803e-55 |
MsaG024058 | MsaG045776 | 0.903155 | 1.083974e-78 | 6.686555e-75 |
MsaG024058 | MsaG045806 | 0.803312 | 6.231925e-49 | 9.085410e-47 |
MsaG024058 | MsaG046056 | 0.870796 | 2.269456e-66 | 2.719839e-63 |
MsaG024058 | MsaG046177 | 0.824123 | 1.694109e-53 | 4.160813e-51 |
MsaG024058 | MsaG046276 | 0.802865 | 7.701726e-49 | 1.111283e-46 |
MsaG024058 | MsaG046380 | 0.847605 | 1.965733e-59 | 9.823032e-57 |
MsaG024058 | MsaG046480 | 0.895893 | 1.402374e-75 | 5.672475e-72 |
MsaG024058 | MsaG046602 | 0.801399 | 1.536662e-48 | 2.144373e-46 |
MsaG024058 | MsaG046766 | 0.872759 | 5.101551e-67 | 6.650137e-64 |
MsaG024058 | MsaG046805 | 0.841812 | 7.033074e-58 | 2.907161e-55 |
MsaG024058 | MsaG046973 | 0.828412 | 1.631969e-54 | 4.514935e-52 |
MsaG024058 | MsaG047001 | 0.840803 | 1.291878e-57 | 5.171867e-55 |
MsaG024058 | MsaG047132 | 0.857308 | 3.472250e-62 | 2.440195e-59 |
MsaG024058 | MsaG002246 | 0.893433 | 1.408768e-74 | 4.983970e-71 |
MsaG024058 | MsaG001093 | 0.828126 | 1.911931e-54 | 5.247057e-52 |
MsaG024058 | MsaG001536 | 0.902848 | 1.484913e-78 | 8.988821e-75 |
MsaG024058 | MsaG007676 | 0.811015 | 1.481565e-50 | 2.593521e-48 |
MsaG024058 | MsaG008384 | 0.814618 | 2.429036e-51 | 4.650435e-49 |
MsaG024058 | MsaG010542 | 0.824495 | 1.386655e-53 | 3.440359e-51 |
MsaG024058 | MsaG009684 | 0.871775 | 1.081491e-66 | 1.351432e-63 |
MsaG024058 | MsaG009055 | 0.833826 | 7.746709e-56 | 2.505453e-53 |
MsaG024058 | MsaG007989 | 0.814268 | 2.900817e-51 | 5.505187e-49 |
MsaG024058 | MsaG009932 | 0.842314 | 5.186236e-58 | 2.178467e-55 |
MsaG024058 | MsaG014171 | 0.861469 | 1.981318e-63 | 1.629125e-60 |
MsaG024058 | MsaG013507 | 0.856779 | 4.966036e-62 | 3.422694e-59 |
MsaG024058 | MsaG013680 | 0.824972 | 1.071284e-53 | 2.692800e-51 |
MsaG024058 | MsaG012862 | 0.865307 | 1.298369e-64 | 1.241826e-61 |
MsaG024058 | MsaG016450 | 0.821821 | 5.793145e-53 | 1.337035e-50 |
MsaG024058 | MsaG013813 | 0.811655 | 1.077752e-50 | 1.916456e-48 |
MsaG024058 | MsaG014424 | 0.807815 | 7.148061e-50 | 1.158101e-47 |
MsaG024058 | MsaG012243 | 0.821041 | 8.752772e-53 | 1.978881e-50 |
MsaG024058 | MsaG018733 | 0.879386 | 2.737310e-69 | 4.802713e-66 |
MsaG024058 | MsaG021527 | 0.837056 | 1.192991e-56 | 4.250856e-54 |
MsaG024058 | MsaG018721 | 0.844350 | 1.493140e-58 | 6.697054e-56 |
MsaG024058 | MsaG019026 | 0.853208 | 5.344704e-61 | 3.239445e-58 |
MsaG024058 | MsaG020996 | 0.871880 | 9.981089e-67 | 1.253107e-63 |
MsaG024058 | MsaG019406 | 0.806255 | 1.523317e-49 | 2.378411e-47 |
MsaG024058 | MsaG028128 | 0.841276 | 9.717520e-58 | 3.949144e-55 |
MsaG024058 | MsaG026810 | 0.840858 | 1.249690e-57 | 5.011654e-55 |
MsaG024058 | MsaG026524 | 0.853090 | 5.776511e-61 | 3.486573e-58 |
MsaG024058 | MsaG028393 | 0.806070 | 1.665220e-49 | 2.588521e-47 |
MsaG024058 | MsaG032143 | 0.832145 | 2.019702e-55 | 6.219142e-53 |
MsaG024058 | MsaG030927 | 0.819328 | 2.151039e-52 | 4.648061e-50 |
MsaG024058 | MsaG031895 | 0.823901 | 1.908710e-53 | 4.659662e-51 |
MsaG024058 | MsaG031458 | 0.879745 | 2.044025e-69 | 3.645696e-66 |
MsaG024058 | MsaG030552 | 0.863091 | 6.325436e-64 | 5.540761e-61 |
MsaG024058 | MsaG030622 | 0.827846 | 2.231338e-54 | 6.075603e-52 |
MsaG024058 | MsaG033667 | 0.891293 | 1.002021e-73 | 3.159862e-70 |
MsaG024058 | MsaG031339 | 0.830311 | 5.671945e-55 | 1.656169e-52 |
MsaG024058 | MsaG032077 | 0.862653 | 8.626225e-64 | 7.426698e-61 |
MsaG024058 | MsaG032719 | 0.824619 | 1.296307e-53 | 3.227086e-51 |
MsaG024058 | MsaG031245 | 0.850910 | 2.386322e-60 | 1.334631e-57 |
MsaG024058 | MsaG032837 | 0.827805 | 2.281967e-54 | 6.206387e-52 |
MsaG024058 | MsaG030574 | 0.812382 | 7.497497e-51 | 1.357334e-48 |
MsaG024058 | MsaG030876 | 0.868022 | 1.794946e-65 | 1.916408e-62 |
MsaG024058 | MsaG039769 | 0.866805 | 4.381666e-65 | 4.452140e-62 |
MsaG024058 | MsaG036290 | 0.800858 | 1.980754e-48 | 2.730462e-46 |
MsaG024058 | MsaG039297 | 0.838262 | 5.867379e-57 | 2.169388e-54 |
MsaG024058 | MsaG036456 | 0.815623 | 1.456956e-51 | 2.861203e-49 |
MsaG024058 | MsaG037000 | 0.806247 | 1.529024e-49 | 2.386879e-47 |
MsaG024058 | MsaG039370 | 0.875722 | 5.113008e-68 | 7.592622e-65 |
MsaG024058 | MsaG037437 | 0.912187 | 6.346893e-83 | 6.919350e-79 |
MsaG024058 | MsaG036891 | 0.807585 | 7.994835e-50 | 1.288121e-47 |
MsaG024058 | MsaG037837 | 0.897257 | 3.805457e-76 | 1.663150e-72 |
MsaG024058 | MsaG037532 | 0.834875 | 4.238322e-56 | 1.414410e-53 |
MsaG024058 | MsaG036557 | 0.817373 | 5.933118e-52 | 1.218557e-49 |
MsaG024058 | MsaG036656 | 0.855303 | 1.336299e-61 | 8.728380e-59 |
MsaG024058 | MsaG037829 | 0.836767 | 1.412212e-56 | 4.988195e-54 |
MsaG024058 | MsaG036052 | 0.836474 | 1.675900e-56 | 5.867568e-54 |
MsaG024058 | MsaG038148 | 0.845334 | 8.129998e-59 | 3.766433e-56 |
MsaG024058 | MsaG043567 | 0.901175 | 8.077064e-78 | 4.428017e-74 |
MsaG024058 | MsaG041132 | 0.884000 | 5.973466e-71 | 1.303477e-67 |
MsaG024058 | MsaG046904 | 0.844257 | 1.581689e-58 | 7.072857e-56 |
MsaG024058 | MsaG047167 | 0.808253 | 5.773610e-50 | 9.453224e-48 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG024058 | MtrunA17_Chr8g0385211 | 96.137 | 699 | 25 | 1 | 1 | 699 | 1 | 697 | 0.0 | 1376 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG024058 | AT5G08630.1 | 49.728 | 736 | 320 | 11 | 1 | 699 | 1 | 723 | 0.0 | 662 |
MsaG024058 | AT5G08630.3 | 49.728 | 736 | 320 | 11 | 1 | 699 | 1 | 723 | 0.0 | 662 |
MsaG024058 | AT5G08630.2 | 49.728 | 736 | 320 | 11 | 1 | 699 | 1 | 723 | 0.0 | 662 |
Find 162 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
CTTCTCTGATGGATCCTTTC+TGG | 0.107207 | 4:-95303734 | None:intergenic |
TTAGAGTATTTCTACTAAAA+AGG | 0.152161 | 4:-95300783 | None:intergenic |
GCAGGAGTCATGAATTCTTT+TGG | 0.251563 | 4:-95299106 | None:intergenic |
AATAATCACATTAAACAAAA+TGG | 0.272373 | 4:+95303419 | MsaT024058.1:CDS |
AGGAACTTGGGGCCTCTAAA+AGG | 0.283127 | 4:+95303288 | MsaT024058.1:CDS |
TTCAGATAACAATGGTTAAC+TGG | 0.293549 | 4:+95303072 | MsaT024058.1:intron |
TTGTGTAGGGAATCTCTTAA+TGG | 0.296835 | 4:+95302666 | MsaT024058.1:CDS |
CTGAAAGAACCAGCAGAAAA+TGG | 0.315447 | 4:+95303700 | MsaT024058.1:CDS |
CCTAATGGGCTTCTACTAAT+AGG | 0.323172 | 4:-95303886 | None:intergenic |
AAGACAATTCACTGGGTAAA+AGG | 0.324894 | 4:+95303486 | MsaT024058.1:CDS |
AGGGAATCTCTTAATGGTTT+GGG | 0.335374 | 4:+95302672 | MsaT024058.1:CDS |
TAGTCTCGGTCTTTACCTAA+TGG | 0.344955 | 4:-95303901 | None:intergenic |
CCCTGAAAATTGCAGTTTCA+AGG | 0.346144 | 4:-95303235 | None:intergenic |
GGTATTTATCGGCTCCTTCA+TGG | 0.350508 | 4:-95300675 | None:intergenic |
ATCTATACCGCCAGAGGGTT+TGG | 0.350587 | 4:+95298996 | MsaT024058.1:CDS |
AAAACAATTATCGTAGTATA+TGG | 0.357958 | 4:+95304156 | MsaT024058.1:CDS |
TAGGGAATCTCTTAATGGTT+TGG | 0.359730 | 4:+95302671 | MsaT024058.1:CDS |
ATAATCGCTAATTTGTGTTA+AGG | 0.365021 | 4:-95298960 | None:intergenic |
TCGTAGAAAAGCAGAGGATA+TGG | 0.369713 | 4:+95298929 | MsaT024058.1:intron |
AGTCTCGGTCTTTACCTAAT+GGG | 0.370559 | 4:-95303900 | None:intergenic |
AGAAGTCCATGCAGAAGATT+TGG | 0.375284 | 4:+95300747 | MsaT024058.1:CDS |
GTTCTTTCAGCTCTTGATCC+AGG | 0.379159 | 4:-95303687 | None:intergenic |
AAGGAGAAAGCCTTTGGCTT+TGG | 0.379570 | 4:+95298651 | MsaT024058.1:CDS |
TCCACTTGTTAACATATTTG+AGG | 0.381698 | 4:-95304848 | None:intergenic |
ACACTTGTCGCCGTACTCTT+TGG | 0.383626 | 4:+95302723 | MsaT024058.1:CDS |
ATATCCCATTGATGATCTAT+TGG | 0.390572 | 4:+95302570 | MsaT024058.1:CDS |
CCTATTAGTAGAAGCCCATT+AGG | 0.393334 | 4:+95303886 | MsaT024058.1:CDS |
TGCAGGTATGCTCCCTTTGA+AGG | 0.403392 | 4:+95300543 | MsaT024058.1:intron |
ATTGAACAGCGGCAGGAACT+TGG | 0.404109 | 4:+95303275 | MsaT024058.1:CDS |
CATGTGGGGAAGAAAATAAA+TGG | 0.406416 | 4:+95303443 | MsaT024058.1:CDS |
GGAACATTAAAGTCTCTTGA+TGG | 0.407958 | 4:-95302637 | None:intergenic |
GAAGGACGATCAGTGAAAAC+AGG | 0.410514 | 4:-95302613 | None:intergenic |
TTTGTTGGTGCGGAATTGTA+TGG | 0.422417 | 4:+95300607 | MsaT024058.1:CDS |
GAACCGCATTCCCATCCTTA+TGG | 0.425234 | 4:-95302768 | None:intergenic |
TGATCAATATTCCTCAATTA+CGG | 0.425945 | 4:+95303123 | MsaT024058.1:CDS |
TGAAAATGCAATCTGCCATA+AGG | 0.432122 | 4:+95302753 | MsaT024058.1:CDS |
TTATAATTTGCTCCAAGAAA+AGG | 0.434059 | 4:+95300935 | MsaT024058.1:CDS |
TACCTCATAACGGTATTTAT+CGG | 0.434201 | 4:-95300686 | None:intergenic |
TCAGTGAAAACAGGGTCATC+TGG | 0.436755 | 4:-95302604 | None:intergenic |
CTTCACCAATAGATCATCAA+TGG | 0.438495 | 4:-95302575 | None:intergenic |
ACTTGGTAAACATGCTCATC+TGG | 0.439545 | 4:-95298697 | None:intergenic |
ATACTCTAAAGTCTTTCATC+CGG | 0.448357 | 4:+95300797 | MsaT024058.1:CDS |
TACCTATCGAAATGCCCCTT+GGG | 0.456446 | 4:+95300825 | MsaT024058.1:CDS |
CTATGAAGGAACCATAAAAC+GGG | 0.456689 | 4:+95303148 | MsaT024058.1:CDS |
ATTGCAAGGGTGAGCGGGAA+AGG | 0.457819 | 4:+95304114 | MsaT024058.1:CDS |
TTGAACAGCGGCAGGAACTT+GGG | 0.459272 | 4:+95303276 | MsaT024058.1:CDS |
GCTGTAGTATCCCCACTCCT+TGG | 0.470462 | 4:-95303980 | None:intergenic |
TTGCAGGAGCGTTTGTTTGT+TGG | 0.471705 | 4:+95300592 | MsaT024058.1:CDS |
TAAACATAAAAGAAAGAAGT+TGG | 0.472658 | 4:+95302100 | MsaT024058.1:CDS |
ACCTTTCCTCTTAACTCCTC+AGG | 0.479963 | 4:-95300895 | None:intergenic |
GTGATAGCTTGATGCATTGA+TGG | 0.480731 | 4:+95304082 | MsaT024058.1:intron |
TCAAAATCTTCCAAAGAGTA+CGG | 0.481765 | 4:-95302733 | None:intergenic |
ACTATGAAGGAACCATAAAA+CGG | 0.481937 | 4:+95303147 | MsaT024058.1:CDS |
TAAGATTTCTAGTTTAGCAT+TGG | 0.483800 | 4:-95303192 | None:intergenic |
CCTTCATAGTGCCGTAATTG+AGG | 0.488180 | 4:-95303134 | None:intergenic |
CCAGAGGGTTTGGTCATGTA+AGG | 0.490194 | 4:+95299006 | MsaT024058.1:CDS |
ATGTTCCAATGCATTGTGTA+GGG | 0.490919 | 4:+95302653 | MsaT024058.1:CDS |
TGAGTTTATTGAACAGCGGC+AGG | 0.492835 | 4:+95303268 | MsaT024058.1:CDS |
GTAAAGACCGAGACTACAAT+AGG | 0.494001 | 4:+95303908 | MsaT024058.1:CDS |
GACAAACTGGCACAAAATCA+TGG | 0.495015 | 4:+95300856 | MsaT024058.1:CDS |
ATGGAGAGATAGAATCATCT+AGG | 0.496560 | 4:+95303462 | MsaT024058.1:CDS |
CCTGAAAATTGCAGTTTCAA+GGG | 0.498613 | 4:-95303234 | None:intergenic |
TCATCTGGCTTCAAATCCTC+AGG | 0.502064 | 4:-95298682 | None:intergenic |
TTGCAAGGGTGAGCGGGAAA+GGG | 0.502818 | 4:+95304115 | MsaT024058.1:CDS |
TCCTCAAATATGTTAACAAG+TGG | 0.504252 | 4:+95304847 | MsaT024058.1:CDS |
GGAACTTGGGGCCTCTAAAA+GGG | 0.507903 | 4:+95303289 | MsaT024058.1:CDS |
ATTAAACAAAATGGACATGT+GGG | 0.508941 | 4:+95303428 | MsaT024058.1:CDS |
TATTGGTGGTTCCGTCGCGA+TGG | 0.509839 | 4:+95303931 | MsaT024058.1:CDS |
AAAGGCTTTCTCCTTAAAAG+AGG | 0.511177 | 4:-95298643 | None:intergenic |
ACTAGAAATCTTATGTGAGT+TGG | 0.511639 | 4:+95303202 | MsaT024058.1:CDS |
ACCGAGACTACAATAGGTAT+TGG | 0.512131 | 4:+95303914 | MsaT024058.1:CDS |
GGCTTTGGCTGAGCCTCCTG+AGG | 0.513105 | 4:+95298666 | MsaT024058.1:CDS |
AATGTTCCAATGCATTGTGT+AGG | 0.514690 | 4:+95302652 | MsaT024058.1:CDS |
CTACCTATCGAAATGCCCCT+TGG | 0.515270 | 4:+95300824 | MsaT024058.1:CDS |
TCTATACTATTCTTCTCTGA+TGG | 0.516611 | 4:-95303745 | None:intergenic |
ACCAATACCTATTGTAGTCT+CGG | 0.518556 | 4:-95303915 | None:intergenic |
CATAAAAGAAAGAAGTTGGA+CGG | 0.520584 | 4:+95302104 | MsaT024058.1:CDS |
ATGACGAGTCTGTGCTTCGA+AGG | 0.520616 | 4:+95304778 | MsaT024058.1:CDS |
AATACCGTTATGAGGTAGCT+TGG | 0.521287 | 4:+95300692 | MsaT024058.1:CDS |
AATGGTTCTGCACAAGAGAA+AGG | 0.524537 | 4:+95302137 | MsaT024058.1:CDS |
AAGCTGACTCAGAAAGCAAT+GGG | 0.525222 | 4:+95303363 | MsaT024058.1:CDS |
GCTGAATTGCAAGGGTGAGC+GGG | 0.525450 | 4:+95304109 | MsaT024058.1:CDS |
CATTTCGATAGGTAGATTCC+CGG | 0.525618 | 4:-95300816 | None:intergenic |
AAAACAGGGTCATCTGGACT+AGG | 0.526194 | 4:-95302598 | None:intergenic |
GAATCGGCAAGCTCCTTCAA+AGG | 0.526421 | 4:-95300556 | None:intergenic |
CCTCAATTACGGCACTATGA+AGG | 0.526729 | 4:+95303134 | MsaT024058.1:CDS |
GGTGGTTCCGTCGCGATGGG+AGG | 0.530125 | 4:+95303935 | MsaT024058.1:CDS |
GTTTAGCATTGGCATCTACA+AGG | 0.531441 | 4:-95303181 | None:intergenic |
ATCTAGGCAAGACAATTCAC+TGG | 0.533178 | 4:+95303478 | MsaT024058.1:CDS |
GTTTGGTCATGTAAGGTCAC+TGG | 0.533479 | 4:+95299013 | MsaT024058.1:CDS |
ATTGGTGGTTCCGTCGCGAT+GGG | 0.534850 | 4:+95303932 | MsaT024058.1:CDS |
TTCACCAATAGATCATCAAT+GGG | 0.536238 | 4:-95302574 | None:intergenic |
AGAATACTTTGAACGAGAGA+TGG | 0.537615 | 4:+95303855 | MsaT024058.1:CDS |
AGCCGATAAATACCGTTATG+AGG | 0.538299 | 4:+95300684 | MsaT024058.1:CDS |
CCTTACATGACCAAACCCTC+TGG | 0.539626 | 4:-95299006 | None:intergenic |
TGGAAAAGAATTATCCAGAA+AGG | 0.543257 | 4:+95303720 | MsaT024058.1:CDS |
TCCTGAGGAGTTAAGAGGAA+AGG | 0.544829 | 4:+95300894 | MsaT024058.1:CDS |
CGCTGAATTGCAAGGGTGAG+CGG | 0.545656 | 4:+95304108 | MsaT024058.1:CDS |
AAGCTGTGACTCCAAGGAGT+GGG | 0.547750 | 4:+95303969 | MsaT024058.1:CDS |
CATTAAACAAAATGGACATG+TGG | 0.548399 | 4:+95303427 | MsaT024058.1:CDS |
TACTGAATGATCTTTAAAGC+AGG | 0.550463 | 4:-95299124 | None:intergenic |
TACTCTAAAGTCTTTCATCC+GGG | 0.550624 | 4:+95300798 | MsaT024058.1:CDS |
AACATATTTGAGGAAAGCAC+TGG | 0.552278 | 4:-95304838 | None:intergenic |
ATACTACAGCAGCAAGGAAG+AGG | 0.554283 | 4:+95303993 | MsaT024058.1:CDS |
GAAGAATAGTATAGAGCAGA+GGG | 0.559232 | 4:+95303753 | MsaT024058.1:CDS |
AGATTCCCTACACAATGCAT+TGG | 0.560023 | 4:-95302658 | None:intergenic |
AGGGAACAAGCACTAGAAGA+AGG | 0.564376 | 4:+95303308 | MsaT024058.1:CDS |
TCATCAATGGGATATTTGAC+TGG | 0.564513 | 4:-95302562 | None:intergenic |
TGAACAGCGGCAGGAACTTG+GGG | 0.565350 | 4:+95303277 | MsaT024058.1:CDS |
TGTTGAAAGCTGTGACTCCA+AGG | 0.565461 | 4:+95303963 | MsaT024058.1:CDS |
AATCGGCAAGCTCCTTCAAA+GGG | 0.566027 | 4:-95300555 | None:intergenic |
TTGTTGGTGCGGAATTGTAT+GGG | 0.566354 | 4:+95300608 | MsaT024058.1:CDS |
AATGCAATCTGCCATAAGGA+TGG | 0.567728 | 4:+95302757 | MsaT024058.1:CDS |
ACAGAAACGAAGTGTGAAGA+AGG | 0.568103 | 4:+95302861 | MsaT024058.1:CDS |
TATTTGAGGAAAGCACTGGC+AGG | 0.571825 | 4:-95304834 | None:intergenic |
GGAGGCTCAGCCAAAGCCAA+AGG | 0.571923 | 4:-95298661 | None:intergenic |
GATGGGTTCGCTGAATTGCA+AGG | 0.572638 | 4:+95304100 | MsaT024058.1:CDS |
ATAAAAGAAAGAAGTTGGAC+GGG | 0.577666 | 4:+95302105 | MsaT024058.1:CDS |
TCTGCACCAAATCTTCTGCA+TGG | 0.577710 | 4:-95300753 | None:intergenic |
AAAGCTGACTCAGAAAGCAA+TGG | 0.580758 | 4:+95303362 | MsaT024058.1:CDS |
GATGTTCCTGAGGAGTTAAG+AGG | 0.585158 | 4:+95300889 | MsaT024058.1:CDS |
TTAAAGTCTCTTGATGGAGA+AGG | 0.586141 | 4:-95302631 | None:intergenic |
AACTGGCTTGACTTATGAAG+AGG | 0.587923 | 4:+95299039 | MsaT024058.1:CDS |
ATGCAATCTGCCATAAGGAT+GGG | 0.588555 | 4:+95302758 | MsaT024058.1:CDS |
TGATAGCTTGATGCATTGAT+GGG | 0.592407 | 4:+95304083 | MsaT024058.1:intron |
AGTTTGTCATGTAAAACCCA+AGG | 0.592962 | 4:-95300841 | None:intergenic |
CTCCAAGAAAAGGAATAATG+AGG | 0.596054 | 4:+95300945 | MsaT024058.1:CDS |
CGAACCAAGCTACCTCATAA+CGG | 0.598769 | 4:-95300696 | None:intergenic |
TCGTGTTCGAGCTCCACCTA+GGG | 0.599113 | 4:+95304806 | MsaT024058.1:CDS |
AACCCAAGGGGCATTTCGAT+AGG | 0.607105 | 4:-95300827 | None:intergenic |
GGAGCGTTTGTTTGTTGGTG+CGG | 0.607787 | 4:+95300597 | MsaT024058.1:CDS |
GAGACTACAATAGGTATTGG+TGG | 0.613718 | 4:+95303917 | MsaT024058.1:CDS |
AGAAGAATAGTATAGAGCAG+AGG | 0.620057 | 4:+95303752 | MsaT024058.1:CDS |
AGAACTGCAGAAAAGATCAA+AGG | 0.621791 | 4:+95304734 | MsaT024058.1:CDS |
AAAGCTGTGACTCCAAGGAG+TGG | 0.624462 | 4:+95303968 | MsaT024058.1:CDS |
CTCGTGTTCGAGCTCCACCT+AGG | 0.625716 | 4:+95304805 | MsaT024058.1:CDS |
TCTTAACTCCTCAGGAACAT+CGG | 0.628787 | 4:-95300887 | None:intergenic |
ATATTAAAAGTCATCCATGA+AGG | 0.629139 | 4:+95300661 | MsaT024058.1:CDS |
TCCAGAACATGAAGAACACA+AGG | 0.629982 | 4:+95302534 | MsaT024058.1:intron |
GTTTGTCATGTAAAACCCAA+GGG | 0.631504 | 4:-95300840 | None:intergenic |
TTGGACGGGACACTAGTCAA+TGG | 0.632342 | 4:+95302119 | MsaT024058.1:CDS |
TTTGAATCTATACCGCCAGA+GGG | 0.635243 | 4:+95298991 | MsaT024058.1:CDS |
CTGCCATAAGGATGGGAATG+CGG | 0.638650 | 4:+95302765 | MsaT024058.1:CDS |
AGCTGTGACTCCAAGGAGTG+GGG | 0.641289 | 4:+95303970 | MsaT024058.1:CDS |
TACATGACCAAACCCTCTGG+CGG | 0.644810 | 4:-95299003 | None:intergenic |
TCTGGCTTCAAATCCTCAGG+AGG | 0.644827 | 4:-95298679 | None:intergenic |
AGCAATGGGAATCATCTCAA+CGG | 0.650870 | 4:+95303377 | MsaT024058.1:CDS |
TAACTCCTCAGGAACATCGG+TGG | 0.650954 | 4:-95300884 | None:intergenic |
CAAATATCCTCCCATCGCGA+CGG | 0.651308 | 4:-95303942 | None:intergenic |
AGAAAAGCAGAGGATATGGA+TGG | 0.653046 | 4:+95298933 | MsaT024058.1:intron |
ATTTCGTCGTAGAAAAGCAG+AGG | 0.655507 | 4:+95298923 | MsaT024058.1:intron |
GTGGGGATACTACAGCAGCA+AGG | 0.659358 | 4:+95303987 | MsaT024058.1:CDS |
GTTTGAATCTATACCGCCAG+AGG | 0.661345 | 4:+95298990 | MsaT024058.1:CDS |
ATGGGTTCGCTGAATTGCAA+GGG | 0.662156 | 4:+95304101 | MsaT024058.1:CDS |
TATCTCCACCGATGTTCCTG+AGG | 0.662162 | 4:+95300879 | MsaT024058.1:CDS |
TCTAGGCAAGACAATTCACT+GGG | 0.669591 | 4:+95303479 | MsaT024058.1:CDS |
TGGATGAGTTTATTGAACAG+CGG | 0.670070 | 4:+95303264 | MsaT024058.1:CDS |
AAGGACGATCAGTGAAAACA+GGG | 0.691019 | 4:-95302612 | None:intergenic |
GTGCAGCATGAGATTCGACA+AGG | 0.695395 | 4:-95302792 | None:intergenic |
TTAAACAAAATGGACATGTG+GGG | 0.696809 | 4:+95303429 | MsaT024058.1:CDS |
TTTGTCATGTAAAACCCAAG+GGG | 0.737360 | 4:-95300839 | None:intergenic |
TATGAAGGAACCATAAAACG+GGG | 0.757617 | 4:+95303149 | MsaT024058.1:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr4 | gene | 95298640 | 95304881 | 95298640 | ID=MsaG024058 |
Chr4 | mRNA | 95298640 | 95304881 | 95298640 | ID=MsaT024058.1;Parent=MsaG024058 |
Chr4 | exon | 95298640 | 95298717 | 95298640 | ID=MsaT024058.1.exon1;Parent=MsaT024058.1 |
Chr4 | CDS | 95298640 | 95298717 | 95298640 | ID=cds.MsaT024058.1;Parent=MsaT024058.1 |
Chr4 | exon | 95298935 | 95299148 | 95298935 | ID=MsaT024058.1.exon2;Parent=MsaT024058.1 |
Chr4 | CDS | 95298935 | 95299148 | 95298935 | ID=cds.MsaT024058.1;Parent=MsaT024058.1 |
Chr4 | exon | 95300548 | 95300966 | 95300548 | ID=MsaT024058.1.exon3;Parent=MsaT024058.1 |
Chr4 | CDS | 95300548 | 95300966 | 95300548 | ID=cds.MsaT024058.1;Parent=MsaT024058.1 |
Chr4 | exon | 95302080 | 95302158 | 95302080 | ID=MsaT024058.1.exon4;Parent=MsaT024058.1 |
Chr4 | CDS | 95302080 | 95302158 | 95302080 | ID=cds.MsaT024058.1;Parent=MsaT024058.1 |
Chr4 | exon | 95302539 | 95302882 | 95302539 | ID=MsaT024058.1.exon5;Parent=MsaT024058.1 |
Chr4 | CDS | 95302539 | 95302882 | 95302539 | ID=cds.MsaT024058.1;Parent=MsaT024058.1 |
Chr4 | exon | 95303077 | 95303507 | 95303077 | ID=MsaT024058.1.exon6;Parent=MsaT024058.1 |
Chr4 | CDS | 95303077 | 95303507 | 95303077 | ID=cds.MsaT024058.1;Parent=MsaT024058.1 |
Chr4 | exon | 95303642 | 95303774 | 95303642 | ID=MsaT024058.1.exon7;Parent=MsaT024058.1 |
Chr4 | CDS | 95303642 | 95303774 | 95303642 | ID=cds.MsaT024058.1;Parent=MsaT024058.1 |
Chr4 | exon | 95303853 | 95304014 | 95303853 | ID=MsaT024058.1.exon8;Parent=MsaT024058.1 |
Chr4 | CDS | 95303853 | 95304014 | 95303853 | ID=cds.MsaT024058.1;Parent=MsaT024058.1 |
Chr4 | exon | 95304089 | 95304177 | 95304089 | ID=MsaT024058.1.exon9;Parent=MsaT024058.1 |
Chr4 | CDS | 95304089 | 95304177 | 95304089 | ID=cds.MsaT024058.1;Parent=MsaT024058.1 |
Chr4 | exon | 95304731 | 95304881 | 95304731 | ID=MsaT024058.1.exon10;Parent=MsaT024058.1 |
Chr4 | CDS | 95304731 | 95304881 | 95304731 | ID=cds.MsaT024058.1;Parent=MsaT024058.1 |
Gene Sequence |
Protein sequence |