Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG026219 | KEH26293.1 | 94.681 | 94 | 5 | 0 | 1 | 94 | 1 | 94 | 8.81e-56 | 186 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG026219 | tr|A0A072UB45|A0A072UB45_MEDTR | 94.681 | 94 | 5 | 0 | 1 | 94 | 1 | 94 | 4.21e-56 | 186 |
| Gene ID | Type | Classification |
|---|---|---|
| MsaG026219 | TF | FAR1 |
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG026219 | MtrunA17_Chr8g0363841 | 76.596 | 94 | 18 | 1 | 1 | 94 | 1 | 90 | 3.49e-44 | 150 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Find 15 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| CCATCTTGAAGCCATGTTCT+TGG | 0.280191 | 5:-18753741 | None:intergenic |
| ATTGTTCTTAAACCCTTGTT+TGG | 0.337062 | 5:-18753842 | None:intergenic |
| TCACCTACGATTTCTCCTTC+TGG | 0.371892 | 5:-18753868 | None:intergenic |
| CAAGAACATGGCTTCAAGAT+GGG | 0.500638 | 5:+18753742 | MsaT026219.1:CDS |
| GGCTGATTCAAGAACTTCAA+AGG | 0.503826 | 5:+18753906 | MsaT026219.1:CDS |
| CCAAGAACATGGCTTCAAGA+TGG | 0.507821 | 5:+18753741 | MsaT026219.1:CDS |
| GCTGATTCAAGAACTTCAAA+GGG | 0.524362 | 5:+18753907 | MsaT026219.1:CDS |
| GATTATTATTGTTCCAAACA+AGG | 0.530481 | 5:+18753829 | MsaT026219.1:CDS |
| TAGGTGAAGTTGCTTATCAA+AGG | 0.533461 | 5:+18753884 | MsaT026219.1:CDS |
| ATTATTATTGTTCCAAACAA+GGG | 0.540953 | 5:+18753830 | MsaT026219.1:CDS |
| AGGTGAAGTTGCTTATCAAA+GGG | 0.546039 | 5:+18753885 | MsaT026219.1:CDS |
| TGGTCAAGTTGTGCATAGCA+AGG | 0.581013 | 5:+18753699 | MsaT026219.1:CDS |
| TTTAAGAACAATGAACCAGA+AGG | 0.621796 | 5:+18753853 | MsaT026219.1:CDS |
| GAACCAGAAGGAGAAATCGT+AGG | 0.643994 | 5:+18753865 | MsaT026219.1:CDS |
| TATAACTTATACCAAGAACA+TGG | 0.669118 | 5:+18753730 | MsaT026219.1:CDS |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| Chr5 | gene | 18753643 | 18753933 | 18753643 | ID=MsaG026219 |
| Chr5 | mRNA | 18753643 | 18753933 | 18753643 | ID=MsaT026219.1;Parent=MsaG026219 |
| Chr5 | exon | 18753643 | 18753933 | 18753643 | ID=MsaT026219.1.exon1;Parent=MsaT026219.1 |
| Chr5 | CDS | 18753643 | 18753933 | 18753643 | ID=cds.MsaT026219.1;Parent=MsaT026219.1 |
| Gene Sequence |
| Protein sequence |
