Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG027206 | XP_039687084.1 | 84.706 | 85 | 13 | 0 | 6 | 90 | 38 | 122 | 1.24e-46 | 155 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG027206 | tr|G7INX6|G7INX6_MEDTR | 84.706 | 85 | 13 | 0 | 6 | 90 | 38 | 122 | 5.91e-47 | 155 |
| Gene ID | Type | Classification |
|---|---|---|
| MsaG027206 | TF | B3 |
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG027206 | MtrunA17_Chr2g0281511 | 84.706 | 85 | 13 | 0 | 6 | 90 | 38 | 122 | 1.14e-50 | 155 |
| MsaG027206 | MtrunA17_Chr2g0309121 | 83.529 | 85 | 13 | 1 | 6 | 90 | 38 | 121 | 1.21e-47 | 147 |
| MsaG027206 | MtrunA17_Chr3g0081891 | 85.714 | 42 | 6 | 0 | 6 | 47 | 38 | 79 | 9.17e-21 | 78.6 |
| MsaG027206 | MtrunA17_Chr7g0276661 | 42.500 | 80 | 44 | 2 | 9 | 87 | 88 | 166 | 1.25e-17 | 72.8 |
| MsaG027206 | MtrunA17_Chr7g0228081 | 30.588 | 85 | 59 | 0 | 4 | 88 | 8 | 92 | 4.95e-13 | 59.3 |
| MsaG027206 | MtrunA17_Chr8g0372431 | 31.250 | 80 | 55 | 0 | 9 | 88 | 23 | 102 | 2.28e-12 | 57.8 |
| MsaG027206 | MtrunA17_Chr5g0430431 | 46.429 | 56 | 30 | 0 | 29 | 84 | 199 | 254 | 2.98e-12 | 60.1 |
| MsaG027206 | MtrunA17_Chr0c01g0489371 | 41.333 | 75 | 42 | 1 | 6 | 78 | 240 | 314 | 5.12e-12 | 59.7 |
| MsaG027206 | MtrunA17_Chr8g0356961 | 40.000 | 75 | 43 | 1 | 6 | 78 | 91 | 165 | 1.51e-11 | 57.0 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Find 16 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| TACCAGTTTCTTCATCAAAA+AGG | 0.252196 | 5:-37406842 | None:intergenic |
| TGTATGCTACCGTCGTTAAC+TGG | 0.297739 | 5:+37407009 | MsaT027206.1:CDS |
| CCTCGACGTGTTGCCGAGAA+TGG | 0.307864 | 5:+37406792 | MsaT027206.1:CDS |
| CGGTCAATAATCCTCCTAAT+AGG | 0.355854 | 5:+37406985 | MsaT027206.1:CDS |
| ACGGTAGCATACATCCTATT+AGG | 0.440754 | 5:-37406999 | None:intergenic |
| ATTGGTATACAAACCATTCT+CGG | 0.470714 | 5:-37406805 | None:intergenic |
| GTATGCTACCGTCGTTAACT+GGG | 0.522932 | 5:+37407010 | MsaT027206.1:CDS |
| GCATGGATCAGAAATACATA+GGG | 0.559318 | 5:+37406901 | MsaT027206.1:CDS |
| AGCATGGATCAGAAATACAT+AGG | 0.564126 | 5:+37406900 | MsaT027206.1:CDS |
| CTTGAAAAGTGCCTAAAAGT+TGG | 0.570138 | 5:+37406945 | MsaT027206.1:CDS |
| AGAAATACATAGGGAGAGGA+TGG | 0.573439 | 5:+37406910 | MsaT027206.1:CDS |
| GATCAGAAATACATAGGGAG+AGG | 0.587262 | 5:+37406906 | MsaT027206.1:CDS |
| TCACACTGCGTCAAGAAGCA+TGG | 0.587686 | 5:+37406884 | MsaT027206.1:CDS |
| CCATTCTCGGCAACACGTCG+AGG | 0.599354 | 5:-37406792 | None:intergenic |
| GTAGCATACATCCTATTAGG+AGG | 0.633251 | 5:-37406996 | None:intergenic |
| TAATCAGTCCCAGTTAACGA+CGG | 0.733495 | 5:-37407018 | None:intergenic |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| Chr5 | gene | 37406571 | 37407037 | 37406571 | ID=MsaG027206 |
| Chr5 | mRNA | 37406571 | 37407037 | 37406571 | ID=MsaT027206.1;Parent=MsaG027206 |
| Chr5 | exon | 37406571 | 37406591 | 37406571 | ID=MsaT027206.1.exon1;Parent=MsaT027206.1 |
| Chr5 | CDS | 37406571 | 37406591 | 37406571 | ID=cds.MsaT027206.1;Parent=MsaT027206.1 |
| Chr5 | exon | 37406786 | 37407037 | 37406786 | ID=MsaT027206.1.exon2;Parent=MsaT027206.1 |
| Chr5 | CDS | 37406786 | 37407037 | 37406786 | ID=cds.MsaT027206.1;Parent=MsaT027206.1 |
| Gene Sequence |
| Protein sequence |
