Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG027621 | XP_003614897.2 | 96.648 | 358 | 12 | 0 | 16 | 373 | 1 | 358 | 0.0 | 723 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG027621 | sp|Q93ZE2|TGA7_ARATH | 52.785 | 377 | 148 | 6 | 1 | 361 | 1 | 363 | 6.68e-122 | 359 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG027621 | tr|G7K933|G7K933_MEDTR | 96.648 | 358 | 12 | 0 | 16 | 373 | 1 | 358 | 0.0 | 723 |
Gene ID | Type | Classification |
---|---|---|
MsaG027621 | TF | bZIP |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000135 | MsaG027621 | 0.808158 | 6.048585e-50 | 9.880628e-48 |
MsaG000139 | MsaG027621 | 0.813043 | 5.380955e-51 | 9.903332e-49 |
MsaG000142 | MsaG027621 | 0.862053 | 1.315947e-63 | 1.106720e-60 |
MsaG000325 | MsaG027621 | 0.867453 | 2.727459e-65 | 2.844526e-62 |
MsaG000467 | MsaG027621 | 0.803432 | 5.885804e-49 | 8.604708e-47 |
MsaG000648 | MsaG027621 | 0.812065 | 8.783295e-51 | 1.577617e-48 |
MsaG001138 | MsaG027621 | 0.805969 | 1.748823e-49 | 2.711914e-47 |
MsaG002137 | MsaG027621 | 0.805008 | 2.775430e-49 | 4.208508e-47 |
MsaG002481 | MsaG027621 | 0.830187 | 6.080940e-55 | 1.769296e-52 |
MsaG002885 | MsaG027621 | 0.825960 | 6.268986e-54 | 1.619466e-51 |
MsaG003422 | MsaG027621 | 0.812512 | 7.023738e-51 | 1.275712e-48 |
MsaG003712 | MsaG027621 | 0.840466 | 1.581337e-57 | 6.264179e-55 |
MsaG003715 | MsaG027621 | 0.869672 | 5.276684e-66 | 6.031277e-63 |
MsaG003778 | MsaG027621 | 0.803946 | 4.609962e-49 | 6.820214e-47 |
MsaG003796 | MsaG027621 | 0.847739 | 1.806245e-59 | 9.067378e-57 |
MsaG003804 | MsaG027621 | 0.848360 | 1.219563e-59 | 6.250185e-57 |
MsaG003894 | MsaG027621 | 0.813512 | 4.249184e-51 | 7.912802e-49 |
MsaG004092 | MsaG027621 | 0.814152 | 3.075768e-51 | 5.820164e-49 |
MsaG004112 | MsaG027621 | 0.813408 | 4.477884e-51 | 8.316830e-49 |
MsaG004280 | MsaG027621 | 0.882956 | 1.438784e-70 | 2.986217e-67 |
MsaG004654 | MsaG027621 | 0.814460 | 2.631811e-51 | 5.018773e-49 |
MsaG004656 | MsaG027621 | 0.801162 | 1.717262e-48 | 2.383536e-46 |
MsaG004718 | MsaG027621 | 0.801023 | 1.833044e-48 | 2.536250e-46 |
MsaG004887 | MsaG027621 | 0.805686 | 2.003832e-49 | 3.086843e-47 |
MsaG005055 | MsaG027621 | 0.819213 | 2.284191e-52 | 4.920676e-50 |
MsaG005641 | MsaG027621 | 0.821303 | 7.621617e-53 | 1.735083e-50 |
MsaG005728 | MsaG027621 | 0.827960 | 2.094510e-54 | 5.721310e-52 |
MsaG005886 | MsaG027621 | 0.830401 | 5.394708e-55 | 1.579304e-52 |
MsaG006090 | MsaG027621 | 0.809822 | 2.672934e-50 | 4.545118e-48 |
MsaG006240 | MsaG027621 | 0.832982 | 1.255165e-55 | 3.960055e-53 |
MsaG006547 | MsaG027621 | 0.820964 | 9.113438e-53 | 2.056235e-50 |
MsaG006638 | MsaG027621 | 0.818475 | 3.354864e-52 | 7.088621e-50 |
MsaG006683 | MsaG027621 | 0.840087 | 1.984567e-57 | 7.768511e-55 |
MsaG006855 | MsaG027621 | 0.831161 | 3.519817e-55 | 1.053109e-52 |
MsaG007241 | MsaG027621 | 0.854486 | 2.299663e-61 | 1.458731e-58 |
MsaG007416 | MsaG027621 | 0.801219 | 1.672262e-48 | 2.324017e-46 |
MsaG007584 | MsaG027621 | 0.809469 | 3.181852e-50 | 5.364579e-48 |
MsaG007742 | MsaG027621 | 0.812566 | 6.834441e-51 | 1.242994e-48 |
MsaG007768 | MsaG027621 | 0.826392 | 4.953216e-54 | 1.294980e-51 |
MsaG007828 | MsaG027621 | 0.802261 | 1.024408e-48 | 1.457826e-46 |
MsaG008155 | MsaG027621 | 0.807292 | 9.220508e-50 | 1.475229e-47 |
MsaG008238 | MsaG027621 | 0.808074 | 6.301938e-50 | 1.027371e-47 |
MsaG008298 | MsaG027621 | 0.802999 | 7.228393e-49 | 1.046238e-46 |
MsaG008511 | MsaG027621 | 0.802826 | 7.843518e-49 | 1.130733e-46 |
MsaG009117 | MsaG027621 | 0.840384 | 1.661662e-57 | 6.565611e-55 |
MsaG009531 | MsaG027621 | 0.816100 | 1.141553e-51 | 2.269066e-49 |
MsaG010112 | MsaG027621 | 0.805795 | 1.901824e-49 | 2.937112e-47 |
MsaG010265 | MsaG027621 | 0.819085 | 2.442574e-52 | 5.244192e-50 |
MsaG010637 | MsaG027621 | 0.806433 | 1.397559e-49 | 2.191291e-47 |
MsaG010644 | MsaG027621 | 0.803153 | 6.720236e-49 | 9.761349e-47 |
MsaG010706 | MsaG027621 | 0.811354 | 1.251895e-50 | 2.209772e-48 |
MsaG010860 | MsaG027621 | 0.816662 | 8.555207e-52 | 1.725125e-49 |
MsaG010890 | MsaG027621 | 0.805284 | 2.431012e-49 | 3.709840e-47 |
MsaG011316 | MsaG027621 | 0.805972 | 1.746456e-49 | 2.708418e-47 |
MsaG011481 | MsaG027621 | 0.844156 | 1.682950e-58 | 7.500846e-56 |
MsaG011484 | MsaG027621 | 0.819142 | 2.370145e-52 | 5.096454e-50 |
MsaG011812 | MsaG027621 | 0.802733 | 8.196903e-49 | 1.179166e-46 |
MsaG011941 | MsaG027621 | 0.828457 | 1.592281e-54 | 4.410719e-52 |
MsaG012046 | MsaG027621 | 0.868071 | 1.730929e-65 | 1.851773e-62 |
MsaG012208 | MsaG027621 | 0.802128 | 1.090960e-48 | 1.547792e-46 |
MsaG012478 | MsaG027621 | 0.819433 | 2.036605e-52 | 4.412702e-50 |
MsaG012496 | MsaG027621 | 0.809338 | 3.392298e-50 | 5.700964e-48 |
MsaG012497 | MsaG027621 | 0.802334 | 9.896795e-49 | 1.410837e-46 |
MsaG014292 | MsaG027621 | 0.812450 | 7.245727e-51 | 1.313968e-48 |
MsaG015722 | MsaG027621 | 0.854877 | 1.773991e-61 | 1.141035e-58 |
MsaG016329 | MsaG027621 | 0.800337 | 2.526832e-48 | 3.442453e-46 |
MsaG016495 | MsaG027621 | 0.811845 | 9.802819e-51 | 1.751325e-48 |
MsaG016974 | MsaG027621 | 0.831949 | 2.256463e-55 | 6.908703e-53 |
MsaG017057 | MsaG027621 | 0.803651 | 5.303892e-49 | 7.793336e-47 |
MsaG017219 | MsaG027621 | 0.803071 | 6.984954e-49 | 1.012688e-46 |
MsaG017290 | MsaG027621 | 0.828802 | 1.315402e-54 | 3.678850e-52 |
MsaG017483 | MsaG027621 | 0.842643 | 4.247823e-58 | 1.803326e-55 |
MsaG017495 | MsaG027621 | 0.813287 | 4.759590e-51 | 8.812971e-49 |
MsaG017839 | MsaG027621 | 0.811925 | 9.421479e-51 | 1.686529e-48 |
MsaG018082 | MsaG027621 | 0.810464 | 1.947300e-50 | 3.363312e-48 |
MsaG018149 | MsaG027621 | 0.811431 | 1.204988e-50 | 2.130980e-48 |
MsaG018214 | MsaG027621 | 0.817141 | 6.687965e-52 | 1.365427e-49 |
MsaG018598 | MsaG027621 | 0.847579 | 1.997589e-59 | 9.974036e-57 |
MsaG018633 | MsaG027621 | 0.850436 | 3.240397e-60 | 1.782605e-57 |
MsaG018735 | MsaG027621 | 0.848751 | 9.518485e-60 | 4.943601e-57 |
MsaG018751 | MsaG027621 | 0.823720 | 2.103528e-53 | 5.110298e-51 |
MsaG018795 | MsaG027621 | 0.833172 | 1.126067e-55 | 3.572902e-53 |
MsaG018960 | MsaG027621 | 0.813706 | 3.854335e-51 | 7.212240e-49 |
MsaG019183 | MsaG027621 | 0.830939 | 3.987931e-55 | 1.185581e-52 |
MsaG019187 | MsaG027621 | 0.808069 | 6.316874e-50 | 1.029691e-47 |
MsaG019188 | MsaG027621 | 0.866866 | 4.190067e-65 | 4.268457e-62 |
MsaG019275 | MsaG027621 | 0.828413 | 1.631626e-54 | 4.514014e-52 |
MsaG019308 | MsaG027621 | 0.853462 | 4.523932e-61 | 2.766661e-58 |
MsaG019421 | MsaG027621 | 0.831265 | 3.320540e-55 | 9.964277e-53 |
MsaG019657 | MsaG027621 | 0.809401 | 3.289491e-50 | 5.536768e-48 |
MsaG019721 | MsaG027621 | 0.802237 | 1.036306e-48 | 1.473922e-46 |
MsaG019806 | MsaG027621 | 0.861588 | 1.823304e-63 | 1.506021e-60 |
MsaG020003 | MsaG027621 | 0.822218 | 4.693124e-53 | 1.094730e-50 |
MsaG020149 | MsaG027621 | 0.824369 | 1.483798e-53 | 3.668869e-51 |
MsaG020202 | MsaG027621 | 0.805028 | 2.748374e-49 | 4.169564e-47 |
MsaG020245 | MsaG027621 | 0.842812 | 3.832253e-58 | 1.635595e-55 |
MsaG020732 | MsaG027621 | 0.834831 | 4.347211e-56 | 1.448829e-53 |
MsaG020716 | MsaG027621 | 0.838022 | 6.759336e-57 | 2.480757e-54 |
MsaG020834 | MsaG027621 | 0.803671 | 5.254266e-49 | 7.724047e-47 |
MsaG021321 | MsaG027621 | 0.803636 | 5.342693e-49 | 7.847473e-47 |
MsaG021650 | MsaG027621 | 0.803407 | 5.956052e-49 | 8.702327e-47 |
MsaG022627 | MsaG027621 | 0.838400 | 5.409814e-57 | 2.008732e-54 |
MsaG022933 | MsaG027621 | 0.800498 | 2.343242e-48 | 3.204004e-46 |
MsaG023095 | MsaG027621 | 0.800266 | 2.611801e-48 | 3.552476e-46 |
MsaG023268 | MsaG027621 | 0.842820 | 3.812660e-58 | 1.627652e-55 |
MsaG023406 | MsaG027621 | 0.815316 | 1.703963e-51 | 3.320323e-49 |
MsaG023416 | MsaG027621 | 0.830936 | 3.994462e-55 | 1.187424e-52 |
MsaG023561 | MsaG027621 | 0.824558 | 1.340057e-53 | 3.330454e-51 |
MsaG023641 | MsaG027621 | 0.827885 | 2.183461e-54 | 5.951829e-52 |
MsaG023648 | MsaG027621 | 0.842660 | 4.203730e-58 | 1.785544e-55 |
MsaG023796 | MsaG027621 | 0.822459 | 4.127128e-53 | 9.689801e-51 |
MsaG023962 | MsaG027621 | 0.809965 | 2.491677e-50 | 4.251410e-48 |
MsaG024008 | MsaG027621 | 0.816410 | 9.736823e-52 | 1.950766e-49 |
MsaG024480 | MsaG027621 | 0.807985 | 6.580086e-50 | 1.070453e-47 |
MsaG024642 | MsaG027621 | 0.803275 | 6.341238e-49 | 9.237066e-47 |
MsaG026480 | MsaG027621 | 0.823757 | 2.062144e-53 | 5.014788e-51 |
MsaG026754 | MsaG027621 | 0.834642 | 4.846482e-56 | 1.606164e-53 |
MsaG026961 | MsaG027621 | 0.827610 | 2.540645e-54 | 6.872229e-52 |
MsaG026987 | MsaG027621 | 0.821385 | 7.298764e-53 | 1.665184e-50 |
MsaG027248 | MsaG027621 | 0.801119 | 1.752580e-48 | 2.430166e-46 |
MsaG027395 | MsaG027621 | 0.808140 | 6.100925e-50 | 9.961825e-48 |
MsaG027505 | MsaG027621 | 0.857116 | 3.954613e-62 | 2.759447e-59 |
MsaG027557 | MsaG027621 | 0.872123 | 8.295218e-67 | 1.052349e-63 |
MsaG027590 | MsaG027621 | 0.825226 | 9.336998e-54 | 2.363351e-51 |
MsaG027621 | MsaG027725 | 0.813434 | 4.420244e-51 | 8.215166e-49 |
MsaG027621 | MsaG027762 | 0.800137 | 2.773727e-48 | 3.761748e-46 |
MsaG027621 | MsaG027845 | 0.817341 | 6.033262e-52 | 1.238086e-49 |
MsaG027621 | MsaG028248 | 0.816785 | 8.034344e-52 | 1.625263e-49 |
MsaG027621 | MsaG028324 | 0.817695 | 5.025989e-52 | 1.040780e-49 |
MsaG027621 | MsaG028480 | 0.804118 | 4.246576e-49 | 6.307831e-47 |
MsaG027621 | MsaG028620 | 0.807409 | 8.711329e-50 | 1.397677e-47 |
MsaG027621 | MsaG028661 | 0.811847 | 9.793307e-51 | 1.749708e-48 |
MsaG027621 | MsaG028802 | 0.820978 | 9.049858e-53 | 2.042618e-50 |
MsaG027621 | MsaG028844 | 0.819672 | 1.797525e-52 | 3.918952e-50 |
MsaG027621 | MsaG029054 | 0.802001 | 1.158302e-48 | 1.638582e-46 |
MsaG027621 | MsaG029063 | 0.827064 | 3.428186e-54 | 9.131669e-52 |
MsaG027621 | MsaG029093 | 0.821300 | 7.635053e-53 | 1.737997e-50 |
MsaG027621 | MsaG029152 | 0.803642 | 5.326950e-49 | 7.825446e-47 |
MsaG027621 | MsaG029147 | 0.825787 | 6.887877e-54 | 1.770708e-51 |
MsaG027621 | MsaG029307 | 0.800878 | 1.961764e-48 | 2.705520e-46 |
MsaG027621 | MsaG029464 | 0.828435 | 1.611811e-54 | 4.462037e-52 |
MsaG027621 | MsaG029580 | 0.821376 | 7.333761e-53 | 1.672749e-50 |
MsaG027621 | MsaG029792 | 0.808279 | 5.699900e-50 | 9.338367e-48 |
MsaG027621 | MsaG030039 | 0.821583 | 6.573009e-53 | 1.507445e-50 |
MsaG027621 | MsaG030196 | 0.827325 | 2.970628e-54 | 7.971345e-52 |
MsaG027621 | MsaG030231 | 0.808079 | 6.286246e-50 | 1.024942e-47 |
MsaG027621 | MsaG031007 | 0.803956 | 4.587936e-49 | 6.789204e-47 |
MsaG027621 | MsaG031494 | 0.820803 | 9.923421e-53 | 2.229302e-50 |
MsaG027621 | MsaG032286 | 0.813619 | 4.026267e-51 | 7.517633e-49 |
MsaG027621 | MsaG032279 | 0.811152 | 1.384482e-50 | 2.431697e-48 |
MsaG027621 | MsaG032491 | 0.845916 | 5.662808e-59 | 2.674440e-56 |
MsaG027621 | MsaG032915 | 0.800600 | 2.234886e-48 | 3.062959e-46 |
MsaG027621 | MsaG033029 | 0.818462 | 3.377166e-52 | 7.133504e-50 |
MsaG027621 | MsaG033231 | 0.821990 | 5.296980e-53 | 1.228084e-50 |
MsaG027621 | MsaG034590 | 0.813493 | 4.290207e-51 | 7.985071e-49 |
MsaG027621 | MsaG035530 | 0.814962 | 2.040193e-51 | 3.940067e-49 |
MsaG027621 | MsaG039573 | 0.807714 | 7.510605e-50 | 1.213885e-47 |
MsaG027621 | MsaG039901 | 0.801323 | 1.592402e-48 | 2.218345e-46 |
MsaG027621 | MsaG040095 | 0.844526 | 1.339959e-58 | 6.044672e-56 |
MsaG027621 | MsaG040728 | 0.824438 | 1.429518e-53 | 3.541239e-51 |
MsaG027621 | MsaG041072 | 0.844779 | 1.146283e-58 | 5.214680e-56 |
MsaG027621 | MsaG041299 | 0.860327 | 4.388214e-63 | 3.455382e-60 |
MsaG027621 | MsaG041453 | 0.809272 | 3.504362e-50 | 5.879978e-48 |
MsaG027621 | MsaG041985 | 0.834557 | 5.091918e-56 | 1.683120e-53 |
MsaG027621 | MsaG042000 | 0.807037 | 1.043428e-49 | 1.659387e-47 |
MsaG027621 | MsaG042102 | 0.803465 | 5.794220e-49 | 8.477301e-47 |
MsaG027621 | MsaG043550 | 0.811221 | 1.337872e-50 | 2.353833e-48 |
MsaG027621 | MsaG043695 | 0.801741 | 1.309058e-48 | 1.840986e-46 |
MsaG027621 | MsaG043890 | 0.820940 | 9.230861e-53 | 2.081379e-50 |
MsaG027621 | MsaG044107 | 0.803842 | 4.843034e-49 | 7.147742e-47 |
MsaG027621 | MsaG044499 | 0.840902 | 1.217448e-57 | 4.889090e-55 |
MsaG027621 | MsaG044516 | 0.820151 | 1.398398e-52 | 3.087999e-50 |
MsaG027621 | MsaG044546 | 0.846452 | 4.051753e-59 | 1.947960e-56 |
MsaG027621 | MsaG044916 | 0.811753 | 1.026187e-50 | 1.829177e-48 |
MsaG027621 | MsaG044918 | 0.820003 | 1.511442e-52 | 3.324488e-50 |
MsaG027621 | MsaG044957 | 0.820428 | 1.208903e-52 | 2.689186e-50 |
MsaG027621 | MsaG045028 | 0.806252 | 1.525527e-49 | 2.381660e-47 |
MsaG027621 | MsaG045360 | 0.810041 | 2.399885e-50 | 4.102366e-48 |
MsaG027621 | MsaG045387 | 0.824377 | 1.477681e-53 | 3.654492e-51 |
MsaG027621 | MsaG045510 | 0.810613 | 1.808414e-50 | 3.134747e-48 |
MsaG027621 | MsaG045518 | 0.838916 | 3.985621e-57 | 1.504057e-54 |
MsaG027621 | MsaG045739 | 0.812793 | 6.100055e-51 | 1.115679e-48 |
MsaG027621 | MsaG045820 | 0.819414 | 2.056430e-52 | 4.453514e-50 |
MsaG027621 | MsaG045822 | 0.872251 | 7.524913e-67 | 9.598208e-64 |
MsaG027621 | MsaG045986 | 0.838047 | 6.663307e-57 | 2.447290e-54 |
MsaG027621 | MsaG046054 | 0.869005 | 8.671993e-66 | 9.640142e-63 |
MsaG027621 | MsaG046104 | 0.816464 | 9.472496e-52 | 1.900413e-49 |
MsaG027621 | MsaG046167 | 0.808452 | 5.237514e-50 | 8.616524e-48 |
MsaG027621 | MsaG046540 | 0.855114 | 1.515820e-61 | 9.832553e-59 |
MsaG027621 | MsaG046528 | 0.824255 | 1.577520e-53 | 3.888337e-51 |
MsaG027621 | MsaG046503 | 0.801584 | 1.409048e-48 | 1.974507e-46 |
MsaG027621 | MsaG046555 | 0.821795 | 5.874399e-53 | 1.354810e-50 |
MsaG027621 | MsaG046660 | 0.847499 | 2.101325e-59 | 1.046376e-56 |
MsaG027621 | MsaG046754 | 0.806455 | 1.382968e-49 | 2.169521e-47 |
MsaG027621 | MsaG046780 | 0.804770 | 3.109609e-49 | 4.689283e-47 |
MsaG027621 | MsaG047011 | 0.844903 | 1.061775e-58 | 4.850647e-56 |
MsaG027621 | MsaG047077 | 0.800430 | 2.418779e-48 | 3.302280e-46 |
MsaG027621 | MsaG001966 | 0.826473 | 4.738395e-54 | 1.241650e-51 |
MsaG027621 | MsaG002630 | 0.809239 | 3.562536e-50 | 5.972718e-48 |
MsaG027621 | MsaG002000 | 0.801856 | 1.239762e-48 | 1.748126e-46 |
MsaG027621 | MsaG002578 | 0.827879 | 2.190229e-54 | 5.969249e-52 |
MsaG027621 | MsaG001072 | 0.813637 | 3.990514e-51 | 7.454183e-49 |
MsaG027621 | MsaG002954 | 0.848043 | 1.490653e-59 | 7.560361e-57 |
MsaG027621 | MsaG008811 | 0.814707 | 2.321429e-51 | 4.454438e-49 |
MsaG027621 | MsaG009124 | 0.835544 | 2.877794e-56 | 9.797938e-54 |
MsaG027621 | MsaG010554 | 0.869359 | 6.661342e-66 | 7.514776e-63 |
MsaG027621 | MsaG014278 | 0.853633 | 4.041799e-61 | 2.486716e-58 |
MsaG027621 | MsaG013546 | 0.864706 | 2.000418e-64 | 1.867930e-61 |
MsaG027621 | MsaG014406 | 0.817269 | 6.261826e-52 | 1.282641e-49 |
MsaG027621 | MsaG014164 | 0.825899 | 6.477983e-54 | 1.670647e-51 |
MsaG027621 | MsaG013859 | 0.813036 | 5.398501e-51 | 9.934087e-49 |
MsaG027621 | MsaG014017 | 0.826081 | 5.868645e-54 | 1.521144e-51 |
MsaG027621 | MsaG013041 | 0.802371 | 9.727502e-49 | 1.387842e-46 |
MsaG027621 | MsaG011821 | 0.858579 | 1.461572e-62 | 1.076972e-59 |
MsaG027621 | MsaG019817 | 0.803485 | 5.739490e-49 | 8.401058e-47 |
MsaG027621 | MsaG019915 | 0.837961 | 7.008561e-57 | 2.567400e-54 |
MsaG027621 | MsaG020283 | 0.813746 | 3.777417e-51 | 7.075483e-49 |
MsaG027621 | MsaG027695 | 0.811858 | 9.739059e-51 | 1.740493e-48 |
MsaG027621 | MsaG028782 | 0.816911 | 7.529639e-52 | 1.528131e-49 |
MsaG027621 | MsaG027201 | 0.829014 | 1.169018e-54 | 3.289131e-52 |
MsaG027621 | MsaG027840 | 0.850158 | 3.872374e-60 | 2.109907e-57 |
MsaG027621 | MsaG032924 | 0.800568 | 2.267590e-48 | 3.105584e-46 |
MsaG027621 | MsaG033619 | 0.817705 | 4.998822e-52 | 1.035430e-49 |
MsaG027621 | MsaG030607 | 0.854794 | 1.874655e-61 | 1.202181e-58 |
MsaG027621 | MsaG032991 | 0.800950 | 1.896627e-48 | 2.619924e-46 |
MsaG027621 | MsaG034732 | 0.803287 | 6.305232e-49 | 9.187056e-47 |
MsaG027621 | MsaG031964 | 0.818155 | 3.961227e-52 | 8.301114e-50 |
MsaG027621 | MsaG029994 | 0.831666 | 2.648045e-55 | 8.041148e-53 |
MsaG027621 | MsaG032683 | 0.826233 | 5.401649e-54 | 1.405964e-51 |
MsaG027621 | MsaG031508 | 0.821881 | 5.611607e-53 | 1.297241e-50 |
MsaG027621 | MsaG032664 | 0.816202 | 1.083349e-51 | 2.159030e-49 |
MsaG027621 | MsaG033449 | 0.800644 | 2.188711e-48 | 3.002722e-46 |
MsaG027621 | MsaG033259 | 0.807147 | 9.891410e-50 | 1.577160e-47 |
MsaG027621 | MsaG039733 | 0.822125 | 4.929509e-53 | 1.147029e-50 |
MsaG027621 | MsaG039696 | 0.821376 | 7.333761e-53 | 1.672749e-50 |
MsaG027621 | MsaG039788 | 0.826884 | 3.783804e-54 | 1.002887e-51 |
MsaG027621 | MsaG038172 | 0.815080 | 1.921205e-51 | 3.721276e-49 |
MsaG027621 | MsaG038591 | 0.819306 | 2.176146e-52 | 4.699415e-50 |
MsaG027621 | MsaG035248 | 0.808053 | 6.365095e-50 | 1.037155e-47 |
MsaG027621 | MsaG037051 | 0.817919 | 4.475223e-52 | 9.321320e-50 |
MsaG027621 | MsaG037447 | 0.802243 | 1.033346e-48 | 1.469916e-46 |
MsaG027621 | MsaG036928 | 0.806269 | 1.513346e-49 | 2.363591e-47 |
MsaG027621 | MsaG036408 | 0.826971 | 3.607713e-54 | 9.585280e-52 |
MsaG027621 | MsaG042683 | 0.816744 | 8.203053e-52 | 1.657676e-49 |
MsaG027621 | MsaG040992 | 0.809245 | 3.551375e-50 | 5.954978e-48 |
MsaG027621 | MsaG046854 | 0.802735 | 8.189304e-49 | 1.178121e-46 |
MsaG027621 | MsaG047025 | 0.817405 | 5.837783e-52 | 1.199957e-49 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG027621 | MtrunA17_Chr5g0424861 | 96.379 | 359 | 12 | 1 | 16 | 373 | 1 | 359 | 0.0 | 719 |
MsaG027621 | MtrunA17_Chr3g0115371 | 65.143 | 350 | 114 | 4 | 16 | 361 | 1 | 346 | 1.05e-157 | 447 |
MsaG027621 | MtrunA17_Chr5g0424851 | 80.603 | 232 | 44 | 1 | 141 | 371 | 1 | 232 | 3.35e-131 | 382 |
MsaG027621 | MtrunA17_Chr5g0424851 | 74.882 | 211 | 53 | 0 | 146 | 356 | 220 | 430 | 9.68e-109 | 325 |
MsaG027621 | MtrunA17_Chr3g0124601 | 49.587 | 363 | 172 | 3 | 4 | 361 | 2 | 358 | 2.71e-117 | 344 |
MsaG027621 | MtrunA17_Chr8g0382861 | 47.126 | 348 | 177 | 4 | 14 | 361 | 13 | 353 | 2.23e-99 | 298 |
MsaG027621 | MtrunA17_Chr8g0353501 | 51.568 | 287 | 128 | 2 | 82 | 361 | 181 | 463 | 1.26e-89 | 277 |
MsaG027621 | MtrunA17_Chr7g0256211 | 50.871 | 287 | 130 | 3 | 82 | 361 | 167 | 449 | 7.33e-89 | 275 |
MsaG027621 | MtrunA17_Chr2g0321431 | 51.429 | 280 | 129 | 2 | 82 | 361 | 194 | 466 | 7.59e-89 | 276 |
MsaG027621 | MtrunA17_Chr7g0258321 | 47.020 | 302 | 149 | 3 | 69 | 361 | 161 | 460 | 4.79e-88 | 273 |
MsaG027621 | MtrunA17_Chr1g0174701 | 42.037 | 383 | 196 | 7 | 4 | 361 | 122 | 503 | 1.60e-85 | 268 |
MsaG027621 | MtrunA17_Chr4g0026401 | 45.981 | 311 | 155 | 5 | 52 | 361 | 160 | 458 | 1.89e-83 | 262 |
MsaG027621 | MtrunA17_Chr5g0422771 | 44.631 | 298 | 154 | 2 | 71 | 361 | 168 | 461 | 4.01e-78 | 248 |
MsaG027621 | MtrunA17_Chr1g0210151 | 46.367 | 289 | 149 | 3 | 77 | 360 | 49 | 336 | 2.90e-77 | 241 |
MsaG027621 | MtrunA17_Chr3g0093451 | 43.827 | 162 | 84 | 3 | 84 | 238 | 48 | 209 | 1.76e-40 | 142 |
MsaG027621 | MtrunA17_Chr1g0196951 | 31.000 | 200 | 115 | 5 | 163 | 357 | 59 | 240 | 3.49e-15 | 74.3 |
MsaG027621 | MtrunA17_Chr7g0242651 | 25.698 | 179 | 117 | 3 | 188 | 354 | 45 | 219 | 2.27e-11 | 63.2 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG027621 | AT1G77920.1 | 52.785 | 377 | 148 | 6 | 1 | 361 | 1 | 363 | 6.79e-123 | 359 |
MsaG027621 | AT1G22070.1 | 50.538 | 372 | 159 | 4 | 14 | 365 | 17 | 383 | 8.01e-118 | 347 |
MsaG027621 | AT5G10030.5 | 50.416 | 361 | 173 | 3 | 4 | 361 | 2 | 359 | 8.59e-116 | 341 |
MsaG027621 | AT5G10030.3 | 50.416 | 361 | 173 | 3 | 4 | 361 | 2 | 359 | 8.59e-116 | 341 |
MsaG027621 | AT5G10030.1 | 50.416 | 361 | 173 | 3 | 4 | 361 | 2 | 359 | 8.59e-116 | 341 |
MsaG027621 | AT5G10030.4 | 50.416 | 361 | 173 | 3 | 4 | 361 | 2 | 359 | 8.59e-116 | 341 |
MsaG027621 | AT5G10030.2 | 50.416 | 361 | 173 | 3 | 4 | 361 | 2 | 359 | 8.59e-116 | 341 |
MsaG027621 | AT5G65210.5 | 48.919 | 370 | 182 | 4 | 4 | 369 | 2 | 368 | 3.07e-115 | 340 |
MsaG027621 | AT5G65210.7 | 48.919 | 370 | 182 | 4 | 4 | 369 | 2 | 368 | 3.07e-115 | 340 |
MsaG027621 | AT5G65210.3 | 48.919 | 370 | 182 | 4 | 4 | 369 | 2 | 368 | 3.07e-115 | 340 |
MsaG027621 | AT5G65210.1 | 48.919 | 370 | 182 | 4 | 4 | 369 | 2 | 368 | 3.07e-115 | 340 |
MsaG027621 | AT5G65210.2 | 48.919 | 370 | 182 | 4 | 4 | 369 | 2 | 368 | 3.07e-115 | 340 |
MsaG027621 | AT5G65210.4 | 48.919 | 370 | 182 | 4 | 4 | 369 | 2 | 368 | 3.07e-115 | 340 |
MsaG027621 | AT5G65210.6 | 53.512 | 299 | 135 | 2 | 72 | 369 | 3 | 298 | 3.82e-105 | 311 |
MsaG027621 | AT1G08320.2 | 47.095 | 327 | 154 | 6 | 46 | 361 | 8 | 326 | 2.03e-91 | 278 |
MsaG027621 | AT1G08320.5 | 47.095 | 327 | 154 | 6 | 46 | 361 | 8 | 326 | 2.03e-91 | 278 |
MsaG027621 | AT1G08320.1 | 47.095 | 327 | 154 | 6 | 46 | 361 | 132 | 450 | 6.47e-90 | 279 |
MsaG027621 | AT1G08320.4 | 47.095 | 327 | 154 | 6 | 46 | 361 | 132 | 450 | 6.47e-90 | 279 |
MsaG027621 | AT1G08320.3 | 47.095 | 327 | 154 | 6 | 46 | 361 | 132 | 450 | 6.47e-90 | 279 |
MsaG027621 | AT5G06839.1 | 45.322 | 342 | 166 | 5 | 37 | 361 | 75 | 412 | 6.23e-86 | 266 |
MsaG027621 | AT5G06950.2 | 48.951 | 286 | 136 | 2 | 82 | 361 | 46 | 327 | 7.05e-86 | 263 |
MsaG027621 | AT5G06950.4 | 48.951 | 286 | 136 | 2 | 82 | 361 | 46 | 327 | 7.05e-86 | 263 |
MsaG027621 | AT5G06950.1 | 48.951 | 286 | 136 | 2 | 82 | 361 | 46 | 327 | 7.05e-86 | 263 |
MsaG027621 | AT5G06950.5 | 48.951 | 286 | 136 | 2 | 82 | 361 | 46 | 327 | 7.05e-86 | 263 |
MsaG027621 | AT5G06950.3 | 48.951 | 286 | 136 | 2 | 82 | 361 | 46 | 327 | 7.05e-86 | 263 |
MsaG027621 | AT5G06839.3 | 47.213 | 305 | 146 | 2 | 72 | 361 | 151 | 455 | 1.33e-85 | 267 |
MsaG027621 | AT5G06839.2 | 44.606 | 343 | 168 | 5 | 37 | 361 | 75 | 413 | 9.09e-85 | 263 |
MsaG027621 | AT3G12250.5 | 48.601 | 286 | 137 | 2 | 82 | 361 | 19 | 300 | 2.20e-84 | 259 |
MsaG027621 | AT3G12250.6 | 48.601 | 286 | 137 | 2 | 82 | 361 | 46 | 327 | 3.91e-84 | 259 |
MsaG027621 | AT3G12250.2 | 48.601 | 286 | 137 | 2 | 82 | 361 | 46 | 327 | 3.91e-84 | 259 |
MsaG027621 | AT3G12250.7 | 48.601 | 286 | 137 | 2 | 82 | 361 | 46 | 327 | 3.91e-84 | 259 |
MsaG027621 | AT3G12250.1 | 48.601 | 286 | 137 | 2 | 82 | 361 | 46 | 327 | 3.91e-84 | 259 |
MsaG027621 | AT3G12250.3 | 48.601 | 286 | 137 | 2 | 82 | 361 | 40 | 321 | 4.95e-84 | 258 |
MsaG027621 | AT3G12250.4 | 48.601 | 286 | 137 | 2 | 82 | 361 | 71 | 352 | 1.98e-83 | 258 |
MsaG027621 | AT5G06960.2 | 48.252 | 286 | 138 | 2 | 82 | 361 | 46 | 327 | 5.48e-83 | 256 |
MsaG027621 | AT5G06960.1 | 48.252 | 286 | 138 | 2 | 82 | 361 | 46 | 327 | 5.48e-83 | 256 |
MsaG027621 | AT5G06960.3 | 48.252 | 286 | 138 | 2 | 82 | 361 | 26 | 307 | 5.68e-83 | 255 |
MsaG027621 | AT1G68640.1 | 44.631 | 298 | 153 | 3 | 72 | 361 | 156 | 449 | 1.60e-72 | 233 |
MsaG027621 | AT1G58330.1 | 29.381 | 194 | 114 | 6 | 178 | 354 | 36 | 223 | 1.94e-12 | 66.6 |
Find 65 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
TTTATTGGATGTCGGTTATA+TGG | 0.184139 | 5:-49000826 | MsaT027621.1:CDS |
TCTTTGTTTGAAATTGAATA+TGG | 0.229069 | 5:-49000696 | MsaT027621.1:CDS |
CAAGCTGATCCCTTGGATTT+CGG | 0.267505 | 5:-48999873 | MsaT027621.1:CDS |
TTTATACAGAAACAGTTTAT+TGG | 0.277561 | 5:-49000841 | MsaT027621.1:CDS |
TGCTCAAGGCTTGTTGGCTA+TGG | 0.316587 | 5:-48999541 | MsaT027621.1:CDS |
ATCCTCCTATCCAAAGAAAA+AGG | 0.354680 | 5:+49000475 | None:intergenic |
TTATGTTCATCTTCAACATT+GGG | 0.356119 | 5:+49001748 | None:intergenic |
TCATTCAAATTCTCAAGTTT+CGG | 0.363992 | 5:+49000002 | None:intergenic |
GCTGAAGATGCACTGTCAAT+AGG | 0.369583 | 5:-48999933 | MsaT027621.1:CDS |
CTTATGTTCATCTTCAACAT+TGG | 0.379233 | 5:+49001747 | None:intergenic |
GCTCAAGGCTTGTTGGCTAT+GGG | 0.379556 | 5:-48999540 | MsaT027621.1:CDS |
CTAACCTGAGTTTATTGTTC+CGG | 0.383626 | 5:+49000797 | None:intergenic |
CTCAACTAATCGCGCCGAAA+AGG | 0.387136 | 5:-49001857 | MsaT027621.1:CDS |
TCAAGCTGCTCAAGGCTTGT+TGG | 0.395796 | 5:-48999547 | MsaT027621.1:CDS |
ACAGGCTTATGTTCAACAAC+TGG | 0.406023 | 5:-49001026 | MsaT027621.1:intron |
CTTTCAGATGGCTGCTGCCA+TGG | 0.412683 | 5:-48999841 | MsaT027621.1:CDS |
TATCGAGAAAACAAGAAAAC+AGG | 0.417815 | 5:-49000966 | MsaT027621.1:intron |
CTTTGCAGGCAGATCACCTT+AGG | 0.420677 | 5:-48999611 | MsaT027621.1:intron |
TTATTGGATGTCGGTTATAT+GGG | 0.423086 | 5:-49000825 | MsaT027621.1:CDS |
CCTCCCACATAGTCACTTGA+AGG | 0.428980 | 5:+49001814 | None:intergenic |
AAGGTTCTCTTGATTCTTGA+GGG | 0.435161 | 5:+49001599 | None:intergenic |
CCCTTGGATTTCGGAAACTA+CGG | 0.436857 | 5:-48999864 | MsaT027621.1:CDS |
CAAGAATCAAGAGAACCTTC+TGG | 0.437311 | 5:-49001595 | MsaT027621.1:CDS |
TACTGCTTCTCCTTTGTCCA+TGG | 0.443791 | 5:+48999824 | None:intergenic |
CTGAAGATGCACTGTCAATA+GGG | 0.444666 | 5:-48999932 | MsaT027621.1:CDS |
GACAAAGGAGAAGCAGTAGA+AGG | 0.456711 | 5:-48999819 | MsaT027621.1:CDS |
AGTGTTGAGTAGGGTAGAAA+TGG | 0.460652 | 5:+48999460 | None:intergenic |
CAACATTCAAGCTGATCCCT+TGG | 0.462368 | 5:-48999880 | MsaT027621.1:CDS |
TCTTAATTTGAGTGTTGAGT+AGG | 0.465347 | 5:+48999450 | None:intergenic |
GTCGGTTATATGGGAACGTC+CGG | 0.469360 | 5:-49000816 | MsaT027621.1:CDS |
GAAGGTTCTCTTGATTCTTG+AGG | 0.474792 | 5:+49001598 | None:intergenic |
TGTTGTTGATCATACTCTGC+TGG | 0.478454 | 5:+48999898 | None:intergenic |
TCTATTTAATCTCTGGCGTA+TGG | 0.481044 | 5:-49000515 | MsaT027621.1:CDS |
ATGTCACGCATCTTATCAAT+TGG | 0.485700 | 5:-48999570 | MsaT027621.1:CDS |
CTCAAGGCTTGTTGGCTATG+GGG | 0.490238 | 5:-48999539 | MsaT027621.1:CDS |
CTTAATTTGAGTGTTGAGTA+GGG | 0.496496 | 5:+48999451 | None:intergenic |
CATAAGTAGCATGGAGAACA+AGG | 0.509417 | 5:-49001730 | MsaT027621.1:intron |
CACATAGTCACTTGAAGGAA+TGG | 0.522645 | 5:+49001819 | None:intergenic |
CATTCCTTCAAGTGACTATG+TGG | 0.523116 | 5:-49001818 | MsaT027621.1:CDS |
TCAAGGCTTGTTGGCTATGG+GGG | 0.523504 | 5:-48999538 | MsaT027621.1:CDS |
AGATGCACTGTCAATAGGGT+TGG | 0.527361 | 5:-48999928 | MsaT027621.1:CDS |
ATAACAGAGTTTGTTGCCTA+AGG | 0.529419 | 5:+48999595 | None:intergenic |
TTGAAATTGAATATGGACGT+TGG | 0.536052 | 5:-49000689 | MsaT027621.1:CDS |
TCAATTGGTCAAGCTGCTCA+AGG | 0.536456 | 5:-48999555 | MsaT027621.1:CDS |
TTCGCACTCTTAGTTCATTG+TGG | 0.540430 | 5:-48999500 | MsaT027621.1:CDS |
TATTCAAGAACCTGTTCCTA+AGG | 0.542554 | 5:-49001557 | MsaT027621.1:intron |
TAGATTGAAGCTCATGCAGT+TGG | 0.542577 | 5:-49000996 | MsaT027621.1:CDS |
CGGAAACTACGGCTTTCAGA+TGG | 0.543160 | 5:-48999853 | MsaT027621.1:CDS |
AATGAAAGCAGAAGCTGCAA+AGG | 0.554661 | 5:-49000547 | MsaT027621.1:CDS |
AGAAACAGTTTATTGGATGT+CGG | 0.555658 | 5:-49000834 | MsaT027621.1:CDS |
GCCGTAGTTTCCGAAATCCA+AGG | 0.586415 | 5:+48999863 | None:intergenic |
GAAGATGAACATAAGTAGCA+TGG | 0.592197 | 5:-49001739 | MsaT027621.1:CDS |
TGTACATTTAGAATTTGTGA+TGG | 0.598170 | 5:+49000447 | None:intergenic |
GCGCGGCTGCTCGAAAATGT+CGG | 0.599361 | 5:-49001130 | MsaT027621.1:CDS |
ATGGCTGCTGCCATGGACAA+AGG | 0.602885 | 5:-48999834 | MsaT027621.1:CDS |
GTCTCTTGATCATCTCCAGA+AGG | 0.603267 | 5:+49001580 | None:intergenic |
CTCTGGCGTATGGAAATCAC+CGG | 0.616184 | 5:-49000505 | MsaT027621.1:CDS |
TTCATCTACTTGTCGAGAGT+AGG | 0.630773 | 5:-49000596 | MsaT027621.1:CDS |
CCGTAGTTTCCGAAATCCAA+GGG | 0.636532 | 5:+48999864 | None:intergenic |
CCTTCAAGTGACTATGTGGG+AGG | 0.650193 | 5:-49001814 | MsaT027621.1:CDS |
ATTCCTTCAAGTGACTATGT+GGG | 0.664208 | 5:-49001817 | MsaT027621.1:CDS |
ACGTCCGGAACAATAAACTC+AGG | 0.666698 | 5:-49000801 | MsaT027621.1:intron |
CTTGCTGAGATGATAAACGC+AGG | 0.683767 | 5:+48999955 | None:intergenic |
TATGTTCATCTTCAACATTG+GGG | 0.698417 | 5:+49001749 | None:intergenic |
ACGTCAAGCACAGAATCGCG+CGG | 0.719929 | 5:-49001147 | MsaT027621.1:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr5 | gene | 48999452 | 49001901 | 48999452 | ID=MsaG027621 |
Chr5 | mRNA | 48999452 | 49001901 | 48999452 | ID=MsaT027621.1;Parent=MsaG027621 |
Chr5 | exon | 48999452 | 48999625 | 48999452 | ID=MsaT027621.1.exon8;Parent=MsaT027621.1 |
Chr5 | CDS | 48999452 | 48999625 | 48999452 | ID=cds.MsaT027621.1;Parent=MsaT027621.1 |
Chr5 | exon | 48999806 | 49000033 | 48999806 | ID=MsaT027621.1.exon7;Parent=MsaT027621.1 |
Chr5 | CDS | 48999806 | 49000033 | 48999806 | ID=cds.MsaT027621.1;Parent=MsaT027621.1 |
Chr5 | exon | 49000452 | 49000723 | 49000452 | ID=MsaT027621.1.exon6;Parent=MsaT027621.1 |
Chr5 | CDS | 49000452 | 49000723 | 49000452 | ID=cds.MsaT027621.1;Parent=MsaT027621.1 |
Chr5 | exon | 49000802 | 49000865 | 49000802 | ID=MsaT027621.1.exon5;Parent=MsaT027621.1 |
Chr5 | CDS | 49000802 | 49000865 | 49000802 | ID=cds.MsaT027621.1;Parent=MsaT027621.1 |
Chr5 | exon | 49000967 | 49001044 | 49000967 | ID=MsaT027621.1.exon4;Parent=MsaT027621.1 |
Chr5 | CDS | 49000967 | 49001044 | 49000967 | ID=cds.MsaT027621.1;Parent=MsaT027621.1 |
Chr5 | exon | 49001118 | 49001177 | 49001118 | ID=MsaT027621.1.exon3;Parent=MsaT027621.1 |
Chr5 | CDS | 49001118 | 49001177 | 49001118 | ID=cds.MsaT027621.1;Parent=MsaT027621.1 |
Chr5 | exon | 49001558 | 49001632 | 49001558 | ID=MsaT027621.1.exon2;Parent=MsaT027621.1 |
Chr5 | CDS | 49001558 | 49001632 | 49001558 | ID=cds.MsaT027621.1;Parent=MsaT027621.1 |
Chr5 | exon | 49001731 | 49001901 | 49001731 | ID=MsaT027621.1.exon1;Parent=MsaT027621.1 |
Chr5 | CDS | 49001731 | 49001901 | 49001731 | ID=cds.MsaT027621.1;Parent=MsaT027621.1 |
Gene Sequence |
Protein sequence |