Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG028501 | XP_003616034.2 | 86.599 | 694 | 22 | 4 | 1 | 623 | 1 | 694 | 0.0 | 1181 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG028501 | sp|Q5CCK4|VAL2_ARATH | 39.230 | 701 | 300 | 17 | 3 | 623 | 4 | 658 | 2.17e-144 | 442 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG028501 | tr|G7K0T7|G7K0T7_MEDTR | 86.599 | 694 | 22 | 4 | 1 | 623 | 1 | 694 | 0.0 | 1181 |
Gene ID | Type | Classification |
---|---|---|
MsaG028501 | TF | B3 |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000157 | MsaG028501 | 0.803087 | 6.932201e-49 | 1.005423e-46 |
MsaG000281 | MsaG028501 | 0.819289 | 2.195245e-52 | 4.738646e-50 |
MsaG000288 | MsaG028501 | 0.811771 | 1.017036e-50 | 1.813667e-48 |
MsaG000326 | MsaG028501 | 0.833245 | 1.080132e-55 | 3.434535e-53 |
MsaG000342 | MsaG028501 | 0.801824 | 1.258573e-48 | 1.773364e-46 |
MsaG000382 | MsaG028501 | 0.840048 | 2.030824e-57 | 7.940003e-55 |
MsaG000431 | MsaG028501 | 0.832369 | 1.778571e-55 | 5.511931e-53 |
MsaG000456 | MsaG028501 | 0.862852 | 7.491609e-64 | 6.500444e-61 |
MsaG000646 | MsaG028501 | 0.837319 | 1.022080e-56 | 3.671113e-54 |
MsaG000683 | MsaG028501 | 0.809664 | 2.889852e-50 | 4.895176e-48 |
MsaG000832 | MsaG028501 | 0.834579 | 5.025656e-56 | 1.662381e-53 |
MsaG000855 | MsaG028501 | 0.836163 | 2.009259e-56 | 6.969257e-54 |
MsaG001084 | MsaG028501 | 0.849750 | 5.031019e-60 | 2.703725e-57 |
MsaG001086 | MsaG028501 | 0.818356 | 3.568366e-52 | 7.516616e-50 |
MsaG001178 | MsaG028501 | 0.813215 | 4.934286e-51 | 9.120430e-49 |
MsaG001237 | MsaG028501 | 0.872341 | 7.024468e-67 | 8.995087e-64 |
MsaG001279 | MsaG028501 | 0.832473 | 1.676565e-55 | 5.211586e-53 |
MsaG001654 | MsaG028501 | 0.805567 | 2.122321e-49 | 3.260130e-47 |
MsaG001672 | MsaG028501 | 0.880257 | 1.345690e-69 | 2.457707e-66 |
MsaG001727 | MsaG028501 | 0.805232 | 2.492130e-49 | 3.798677e-47 |
MsaG001859 | MsaG028501 | 0.812562 | 6.850455e-51 | 1.245777e-48 |
MsaG002001 | MsaG028501 | 0.825874 | 6.567507e-54 | 1.692541e-51 |
MsaG002002 | MsaG028501 | 0.822726 | 3.580008e-53 | 8.466196e-51 |
MsaG002009 | MsaG028501 | 0.810827 | 1.626466e-50 | 2.834137e-48 |
MsaG002013 | MsaG028501 | 0.886894 | 4.987508e-72 | 1.254345e-68 |
MsaG002218 | MsaG028501 | 0.832215 | 1.940562e-55 | 5.987193e-53 |
MsaG002273 | MsaG028501 | 0.806506 | 1.349624e-49 | 2.119718e-47 |
MsaG002866 | MsaG028501 | 0.877179 | 1.613639e-68 | 2.558182e-65 |
MsaG003210 | MsaG028501 | 0.863065 | 6.446486e-64 | 5.640707e-61 |
MsaG003200 | MsaG028501 | 0.835829 | 2.440013e-56 | 8.378369e-54 |
MsaG003201 | MsaG028501 | 0.836719 | 1.452219e-56 | 5.121991e-54 |
MsaG003202 | MsaG028501 | 0.837369 | 9.927080e-57 | 3.571056e-54 |
MsaG003203 | MsaG028501 | 0.836954 | 1.266379e-56 | 4.498182e-54 |
MsaG003315 | MsaG028501 | 0.823275 | 2.670513e-53 | 6.409879e-51 |
MsaG003389 | MsaG028501 | 0.832248 | 1.904450e-55 | 5.881349e-53 |
MsaG003394 | MsaG028501 | 0.850940 | 2.341496e-60 | 1.310864e-57 |
MsaG003468 | MsaG028501 | 0.827709 | 2.406017e-54 | 6.526060e-52 |
MsaG004040 | MsaG028501 | 0.811209 | 1.345271e-50 | 2.366177e-48 |
MsaG004105 | MsaG028501 | 0.811793 | 1.006102e-50 | 1.795125e-48 |
MsaG004150 | MsaG028501 | 0.824154 | 1.665678e-53 | 4.094307e-51 |
MsaG004204 | MsaG028501 | 0.824831 | 1.156390e-53 | 2.895483e-51 |
MsaG004301 | MsaG028501 | 0.821983 | 5.315517e-53 | 1.232173e-50 |
MsaG004319 | MsaG028501 | 0.815600 | 1.474212e-51 | 2.893411e-49 |
MsaG004373 | MsaG028501 | 0.838498 | 5.103246e-57 | 1.900829e-54 |
MsaG005000 | MsaG028501 | 0.889465 | 5.185117e-73 | 1.486203e-69 |
MsaG005018 | MsaG028501 | 0.841472 | 8.633753e-58 | 3.530572e-55 |
MsaG005031 | MsaG028501 | 0.818591 | 3.158750e-52 | 6.694499e-50 |
MsaG005154 | MsaG028501 | 0.827903 | 2.162136e-54 | 5.896644e-52 |
MsaG005373 | MsaG028501 | 0.865201 | 1.401840e-64 | 1.335197e-61 |
MsaG005343 | MsaG028501 | 0.823607 | 2.234602e-53 | 5.412243e-51 |
MsaG005401 | MsaG028501 | 0.816604 | 8.814786e-52 | 1.774840e-49 |
MsaG005435 | MsaG028501 | 0.854995 | 1.639985e-61 | 1.059284e-58 |
MsaG005438 | MsaG028501 | 0.844178 | 1.659966e-58 | 7.403775e-56 |
MsaG005442 | MsaG028501 | 0.879311 | 2.907825e-69 | 5.084348e-66 |
MsaG005443 | MsaG028501 | 0.904342 | 3.185954e-79 | 2.109560e-75 |
MsaG005444 | MsaG028501 | 0.891502 | 8.292926e-74 | 2.643959e-70 |
MsaG005506 | MsaG028501 | 0.874564 | 1.265006e-67 | 1.784959e-64 |
MsaG005508 | MsaG028501 | 0.867263 | 3.133917e-65 | 3.243640e-62 |
MsaG005582 | MsaG028501 | 0.871687 | 1.156499e-66 | 1.439761e-63 |
MsaG005683 | MsaG028501 | 0.825088 | 1.006078e-53 | 2.536967e-51 |
MsaG005838 | MsaG028501 | 0.837243 | 1.068961e-56 | 3.830517e-54 |
MsaG005839 | MsaG028501 | 0.812037 | 8.909292e-51 | 1.599181e-48 |
MsaG005806 | MsaG028501 | 0.812460 | 7.209970e-51 | 1.307820e-48 |
MsaG005864 | MsaG028501 | 0.897842 | 2.162113e-76 | 9.765824e-73 |
MsaG006051 | MsaG028501 | 0.826621 | 4.371044e-54 | 1.150037e-51 |
MsaG006175 | MsaG028501 | 0.838488 | 5.134531e-57 | 1.911870e-54 |
MsaG006331 | MsaG028501 | 0.860990 | 2.768507e-63 | 2.234922e-60 |
MsaG006518 | MsaG028501 | 0.816325 | 1.017324e-51 | 2.033818e-49 |
MsaG006865 | MsaG028501 | 0.805955 | 1.760217e-49 | 2.728712e-47 |
MsaG006902 | MsaG028501 | 0.877493 | 1.257030e-68 | 2.021507e-65 |
MsaG006926 | MsaG028501 | 0.812517 | 7.004732e-51 | 1.272421e-48 |
MsaG006936 | MsaG028501 | 0.812325 | 7.713715e-51 | 1.394462e-48 |
MsaG007287 | MsaG028501 | 0.814573 | 2.484835e-51 | 4.751826e-49 |
MsaG007326 | MsaG028501 | 0.806083 | 1.655105e-49 | 2.573552e-47 |
MsaG007353 | MsaG028501 | 0.844601 | 1.279192e-58 | 5.785066e-56 |
MsaG007387 | MsaG028501 | 0.817902 | 4.515529e-52 | 9.401010e-50 |
MsaG007846 | MsaG028501 | 0.806253 | 1.524743e-49 | 2.380516e-47 |
MsaG007729 | MsaG028501 | 0.844253 | 1.585359e-58 | 7.088449e-56 |
MsaG007833 | MsaG028501 | 0.868661 | 1.118854e-65 | 1.226378e-62 |
MsaG008101 | MsaG028501 | 0.820245 | 1.330617e-52 | 2.945785e-50 |
MsaG008218 | MsaG028501 | 0.818495 | 3.320382e-52 | 7.019478e-50 |
MsaG008324 | MsaG028501 | 0.800423 | 2.427165e-48 | 3.313192e-46 |
MsaG008461 | MsaG028501 | 0.849121 | 7.520055e-60 | 3.955525e-57 |
MsaG008534 | MsaG028501 | 0.871072 | 1.842778e-66 | 2.234454e-63 |
MsaG008535 | MsaG028501 | 0.879838 | 1.895066e-69 | 3.394422e-66 |
MsaG008536 | MsaG028501 | 0.880070 | 1.567562e-69 | 2.838132e-66 |
MsaG008542 | MsaG028501 | 0.829160 | 1.078423e-54 | 3.046726e-52 |
MsaG008551 | MsaG028501 | 0.817448 | 5.708569e-52 | 1.174715e-49 |
MsaG008552 | MsaG028501 | 0.922244 | 3.279966e-88 | 7.289715e-84 |
MsaG008565 | MsaG028501 | 0.829921 | 7.054126e-55 | 2.036959e-52 |
MsaG008569 | MsaG028501 | 0.826709 | 4.165410e-54 | 1.098663e-51 |
MsaG008996 | MsaG028501 | 0.820355 | 1.255928e-52 | 2.788453e-50 |
MsaG008999 | MsaG028501 | 0.815125 | 1.877832e-51 | 3.641301e-49 |
MsaG009138 | MsaG028501 | 0.847308 | 2.369642e-59 | 1.172433e-56 |
MsaG009212 | MsaG028501 | 0.802089 | 1.110892e-48 | 1.574723e-46 |
MsaG009390 | MsaG028501 | 0.836089 | 2.097857e-56 | 7.260115e-54 |
MsaG009409 | MsaG028501 | 0.809130 | 3.758191e-50 | 6.284651e-48 |
MsaG009501 | MsaG028501 | 0.881373 | 5.376083e-70 | 1.034444e-66 |
MsaG009578 | MsaG028501 | 0.841040 | 1.120116e-57 | 4.518108e-55 |
MsaG010031 | MsaG028501 | 0.849727 | 5.107174e-60 | 2.742380e-57 |
MsaG010053 | MsaG028501 | 0.850662 | 2.800643e-60 | 1.552898e-57 |
MsaG010066 | MsaG028501 | 0.842722 | 4.048470e-58 | 1.722948e-55 |
MsaG010394 | MsaG028501 | 0.804025 | 4.439599e-49 | 6.580434e-47 |
MsaG010508 | MsaG028501 | 0.830826 | 4.249267e-55 | 1.259173e-52 |
MsaG010517 | MsaG028501 | 0.834684 | 4.731498e-56 | 1.570032e-53 |
MsaG010521 | MsaG028501 | 0.840000 | 2.090885e-57 | 8.162320e-55 |
MsaG010664 | MsaG028501 | 0.805437 | 2.258727e-49 | 3.459269e-47 |
MsaG010835 | MsaG028501 | 0.819246 | 2.244966e-52 | 4.840382e-50 |
MsaG010894 | MsaG028501 | 0.837947 | 7.066687e-57 | 2.587558e-54 |
MsaG010906 | MsaG028501 | 0.814297 | 2.858189e-51 | 5.428328e-49 |
MsaG010899 | MsaG028501 | 0.837415 | 9.664905e-57 | 3.481817e-54 |
MsaG011314 | MsaG028501 | 0.824332 | 1.513850e-53 | 3.739398e-51 |
MsaG011275 | MsaG028501 | 0.887278 | 3.568026e-72 | 9.149492e-69 |
MsaG011319 | MsaG028501 | 0.819090 | 2.435741e-52 | 5.230267e-50 |
MsaG011490 | MsaG028501 | 0.837385 | 9.836526e-57 | 3.540251e-54 |
MsaG011599 | MsaG028501 | 0.833178 | 1.122278e-55 | 3.561505e-53 |
MsaG011806 | MsaG028501 | 0.876582 | 2.593041e-68 | 4.001954e-65 |
MsaG012304 | MsaG028501 | 0.815926 | 1.248032e-51 | 2.469813e-49 |
MsaG012380 | MsaG028501 | 0.864290 | 2.695618e-64 | 2.475774e-61 |
MsaG012382 | MsaG028501 | 0.874053 | 1.881480e-67 | 2.595721e-64 |
MsaG012422 | MsaG028501 | 0.889607 | 4.567359e-73 | 1.319243e-69 |
MsaG012931 | MsaG028501 | 0.822090 | 5.022364e-53 | 1.167516e-50 |
MsaG012941 | MsaG028501 | 0.805425 | 2.271785e-49 | 3.478246e-47 |
MsaG012942 | MsaG028501 | 0.800055 | 2.881606e-48 | 3.900965e-46 |
MsaG012943 | MsaG028501 | 0.860947 | 2.852663e-63 | 2.299140e-60 |
MsaG012944 | MsaG028501 | 0.810035 | 2.406430e-50 | 4.113025e-48 |
MsaG012894 | MsaG028501 | 0.835670 | 2.675364e-56 | 9.142957e-54 |
MsaG013325 | MsaG028501 | 0.819554 | 1.911454e-52 | 4.154498e-50 |
MsaG013621 | MsaG028501 | 0.857822 | 2.448976e-62 | 1.754315e-59 |
MsaG013644 | MsaG028501 | 0.821282 | 7.706025e-53 | 1.753365e-50 |
MsaG013645 | MsaG028501 | 0.831939 | 2.269263e-55 | 6.945888e-53 |
MsaG013646 | MsaG028501 | 0.800036 | 2.906345e-48 | 3.932794e-46 |
MsaG013657 | MsaG028501 | 0.836629 | 1.531343e-56 | 5.386280e-54 |
MsaG013909 | MsaG028501 | 0.832594 | 1.565202e-55 | 4.882470e-53 |
MsaG013962 | MsaG028501 | 0.815426 | 1.610688e-51 | 3.147388e-49 |
MsaG013993 | MsaG028501 | 0.874124 | 1.781350e-67 | 2.465206e-64 |
MsaG014014 | MsaG028501 | 0.836372 | 1.778723e-56 | 6.208812e-54 |
MsaG014110 | MsaG028501 | 0.848052 | 1.482201e-59 | 7.519769e-57 |
MsaG014184 | MsaG028501 | 0.874186 | 1.697584e-67 | 2.355494e-64 |
MsaG014421 | MsaG028501 | 0.833230 | 1.089647e-55 | 3.463266e-53 |
MsaG014422 | MsaG028501 | 0.837326 | 1.017896e-56 | 3.656863e-54 |
MsaG014439 | MsaG028501 | 0.866657 | 4.881811e-65 | 4.930381e-62 |
MsaG014810 | MsaG028501 | 0.884142 | 5.295425e-71 | 1.163422e-67 |
MsaG014953 | MsaG028501 | 0.847384 | 2.258498e-59 | 1.120313e-56 |
MsaG014926 | MsaG028501 | 0.838712 | 4.497767e-57 | 1.686499e-54 |
MsaG014927 | MsaG028501 | 0.825434 | 8.341133e-54 | 2.123380e-51 |
MsaG015176 | MsaG028501 | 0.851665 | 1.464185e-60 | 8.405423e-58 |
MsaG015216 | MsaG028501 | 0.852716 | 7.377996e-61 | 4.395015e-58 |
MsaG015188 | MsaG028501 | 0.849226 | 7.030321e-60 | 3.711291e-57 |
MsaG015202 | MsaG028501 | 0.845843 | 5.927285e-59 | 2.792518e-56 |
MsaG015267 | MsaG028501 | 0.814712 | 2.315900e-51 | 4.444348e-49 |
MsaG015269 | MsaG028501 | 0.851448 | 1.685381e-60 | 9.602273e-58 |
MsaG015705 | MsaG028501 | 0.810796 | 1.651854e-50 | 2.876206e-48 |
MsaG016006 | MsaG028501 | 0.823500 | 2.366334e-53 | 5.714398e-51 |
MsaG016149 | MsaG028501 | 0.828804 | 1.313831e-54 | 3.674706e-52 |
MsaG016115 | MsaG028501 | 0.817576 | 5.345002e-52 | 1.103481e-49 |
MsaG016348 | MsaG028501 | 0.840278 | 1.770571e-57 | 6.972435e-55 |
MsaG016568 | MsaG028501 | 0.814218 | 2.975810e-51 | 5.640447e-49 |
MsaG016724 | MsaG028501 | 0.812995 | 5.511840e-51 | 1.013201e-48 |
MsaG016685 | MsaG028501 | 0.857718 | 2.628580e-62 | 1.875724e-59 |
MsaG016708 | MsaG028501 | 0.850366 | 3.388975e-60 | 1.859827e-57 |
MsaG016821 | MsaG028501 | 0.802363 | 9.761753e-49 | 1.392494e-46 |
MsaG017013 | MsaG028501 | 0.840930 | 1.197336e-57 | 4.812672e-55 |
MsaG017058 | MsaG028501 | 0.832834 | 1.365089e-55 | 4.288213e-53 |
MsaG017209 | MsaG028501 | 0.860283 | 4.525069e-63 | 3.557138e-60 |
MsaG017329 | MsaG028501 | 0.848501 | 1.115439e-59 | 5.743884e-57 |
MsaG017337 | MsaG028501 | 0.810145 | 2.279762e-50 | 3.906914e-48 |
MsaG017718 | MsaG028501 | 0.872219 | 7.712645e-67 | 9.823407e-64 |
MsaG017820 | MsaG028501 | 0.888970 | 8.051786e-73 | 2.249430e-69 |
MsaG017798 | MsaG028501 | 0.803740 | 5.083364e-49 | 7.484977e-47 |
MsaG018134 | MsaG028501 | 0.817561 | 5.385286e-52 | 1.111398e-49 |
MsaG018243 | MsaG028501 | 0.850749 | 2.648254e-60 | 1.472761e-57 |
MsaG018248 | MsaG028501 | 0.813246 | 4.857742e-51 | 8.985796e-49 |
MsaG018380 | MsaG028501 | 0.849486 | 5.957735e-60 | 3.173130e-57 |
MsaG018372 | MsaG028501 | 0.828914 | 1.235782e-54 | 3.467151e-52 |
MsaG018636 | MsaG028501 | 0.848730 | 9.644665e-60 | 5.005563e-57 |
MsaG018773 | MsaG028501 | 0.829611 | 8.390659e-55 | 2.401476e-52 |
MsaG018791 | MsaG028501 | 0.811404 | 1.221226e-50 | 2.158290e-48 |
MsaG019095 | MsaG028501 | 0.805008 | 2.774549e-49 | 4.207246e-47 |
MsaG019180 | MsaG028501 | 0.808078 | 6.289090e-50 | 1.025390e-47 |
MsaG019235 | MsaG028501 | 0.809244 | 3.553828e-50 | 5.958860e-48 |
MsaG019420 | MsaG028501 | 0.818489 | 3.329502e-52 | 7.037829e-50 |
MsaG019731 | MsaG028501 | 0.879434 | 2.631752e-69 | 4.627900e-66 |
MsaG019834 | MsaG028501 | 0.834379 | 5.639036e-56 | 1.854204e-53 |
MsaG020029 | MsaG028501 | 0.847897 | 1.635021e-59 | 8.251692e-57 |
MsaG020033 | MsaG028501 | 0.839166 | 3.435708e-57 | 1.306586e-54 |
MsaG020290 | MsaG028501 | 0.805300 | 2.412786e-49 | 3.683431e-47 |
MsaG020580 | MsaG028501 | 0.844749 | 1.167582e-58 | 5.306260e-56 |
MsaG020843 | MsaG028501 | 0.845362 | 7.991177e-59 | 3.705657e-56 |
MsaG020846 | MsaG028501 | 0.814997 | 2.003768e-51 | 3.873223e-49 |
MsaG020874 | MsaG028501 | 0.874074 | 1.851464e-67 | 2.556692e-64 |
MsaG020875 | MsaG028501 | 0.876811 | 2.163619e-68 | 3.373229e-65 |
MsaG020983 | MsaG028501 | 0.884706 | 3.279627e-71 | 7.403367e-68 |
MsaG020984 | MsaG028501 | 0.882847 | 1.577126e-70 | 3.255631e-67 |
MsaG021012 | MsaG028501 | 0.826844 | 3.868178e-54 | 1.024095e-51 |
MsaG021016 | MsaG028501 | 0.804224 | 4.036491e-49 | 6.010611e-47 |
MsaG021286 | MsaG028501 | 0.830296 | 5.720645e-55 | 1.669661e-52 |
MsaG021405 | MsaG028501 | 0.812164 | 8.358221e-51 | 1.504945e-48 |
MsaG021448 | MsaG028501 | 0.820870 | 9.578760e-53 | 2.155752e-50 |
MsaG021575 | MsaG028501 | 0.819761 | 1.715096e-52 | 3.748138e-50 |
MsaG021863 | MsaG028501 | 0.838283 | 5.797954e-57 | 2.145114e-54 |
MsaG021896 | MsaG028501 | 0.806240 | 1.533989e-49 | 2.394247e-47 |
MsaG022010 | MsaG028501 | 0.834033 | 6.879901e-56 | 2.238773e-53 |
MsaG022011 | MsaG028501 | 0.817638 | 5.176147e-52 | 1.070298e-49 |
MsaG022370 | MsaG028501 | 0.866437 | 5.727333e-65 | 5.731725e-62 |
MsaG022382 | MsaG028501 | 0.809749 | 2.770897e-50 | 4.703384e-48 |
MsaG022387 | MsaG028501 | 0.816871 | 7.684958e-52 | 1.558046e-49 |
MsaG022465 | MsaG028501 | 0.830403 | 5.387604e-55 | 1.577330e-52 |
MsaG022628 | MsaG028501 | 0.890611 | 1.857415e-73 | 5.652254e-70 |
MsaG023271 | MsaG028501 | 0.803794 | 4.955118e-49 | 7.305048e-47 |
MsaG023339 | MsaG028501 | 0.851045 | 2.186995e-60 | 1.228827e-57 |
MsaG023578 | MsaG028501 | 0.824664 | 1.265672e-53 | 3.154639e-51 |
MsaG023595 | MsaG028501 | 0.824213 | 1.613722e-53 | 3.972990e-51 |
MsaG023743 | MsaG028501 | 0.862114 | 1.260869e-63 | 1.062808e-60 |
MsaG023762 | MsaG028501 | 0.811824 | 9.904948e-51 | 1.768683e-48 |
MsaG023882 | MsaG028501 | 0.823229 | 2.736822e-53 | 6.560652e-51 |
MsaG023884 | MsaG028501 | 0.870891 | 2.112373e-66 | 2.542029e-63 |
MsaG024228 | MsaG028501 | 0.840450 | 1.596728e-57 | 6.321906e-55 |
MsaG025148 | MsaG028501 | 0.873308 | 3.344764e-67 | 4.466059e-64 |
MsaG025574 | MsaG028501 | 0.832964 | 1.267785e-55 | 3.997806e-53 |
MsaG025575 | MsaG028501 | 0.885384 | 1.836083e-71 | 4.285024e-68 |
MsaG025691 | MsaG028501 | 0.865218 | 1.384291e-64 | 1.319405e-61 |
MsaG026261 | MsaG028501 | 0.813163 | 5.064570e-51 | 9.349132e-49 |
MsaG026262 | MsaG028501 | 0.803153 | 6.719025e-49 | 9.759715e-47 |
MsaG026721 | MsaG028501 | 0.838030 | 6.730676e-57 | 2.470770e-54 |
MsaG026714 | MsaG028501 | 0.877726 | 1.043291e-68 | 1.695666e-65 |
MsaG026859 | MsaG028501 | 0.819446 | 2.022343e-52 | 4.383335e-50 |
MsaG026863 | MsaG028501 | 0.822101 | 4.993675e-53 | 1.161181e-50 |
MsaG026970 | MsaG028501 | 0.827220 | 3.147239e-54 | 8.420153e-52 |
MsaG027039 | MsaG028501 | 0.842691 | 4.124393e-58 | 1.753576e-55 |
MsaG027800 | MsaG028501 | 0.824823 | 1.161397e-53 | 2.907402e-51 |
MsaG027780 | MsaG028501 | 0.819561 | 1.904500e-52 | 4.140183e-50 |
MsaG028034 | MsaG028501 | 0.817095 | 6.848829e-52 | 1.396604e-49 |
MsaG028257 | MsaG028501 | 0.825500 | 8.049884e-54 | 2.052990e-51 |
MsaG028374 | MsaG028501 | 0.881979 | 3.253577e-70 | 6.442712e-67 |
MsaG028375 | MsaG028501 | 0.816542 | 9.101546e-52 | 1.829649e-49 |
MsaG028351 | MsaG028501 | 0.864336 | 2.607817e-64 | 2.399420e-61 |
MsaG028442 | MsaG028501 | 0.846478 | 3.986992e-59 | 1.918495e-56 |
MsaG028456 | MsaG028501 | 0.812997 | 5.505731e-51 | 1.012140e-48 |
MsaG028457 | MsaG028501 | 0.840946 | 1.185889e-57 | 4.769060e-55 |
MsaG028485 | MsaG028501 | 0.907712 | 9.000395e-81 | 7.343966e-77 |
MsaG028489 | MsaG028501 | 0.841698 | 7.533054e-58 | 3.102548e-55 |
MsaG028494 | MsaG028501 | 0.876311 | 3.213702e-68 | 4.900264e-65 |
MsaG028500 | MsaG028501 | 0.972051 | 1.650912e-133 | 2.064902e-127 |
MsaG028501 | MsaG028503 | 0.938148 | 3.142072e-98 | 2.511386e-93 |
MsaG028501 | MsaG028715 | 0.849369 | 6.418404e-60 | 3.404967e-57 |
MsaG028501 | MsaG028716 | 0.887372 | 3.286201e-72 | 8.469507e-69 |
MsaG028501 | MsaG028811 | 0.845258 | 8.522205e-59 | 3.938129e-56 |
MsaG028501 | MsaG028843 | 0.842717 | 4.058866e-58 | 1.727139e-55 |
MsaG028501 | MsaG028979 | 0.824420 | 1.443894e-53 | 3.574976e-51 |
MsaG028501 | MsaG028929 | 0.855069 | 1.562082e-61 | 1.011634e-58 |
MsaG028501 | MsaG029186 | 0.808200 | 5.925386e-50 | 9.689255e-48 |
MsaG028501 | MsaG029282 | 0.822571 | 3.888709e-53 | 9.157532e-51 |
MsaG028501 | MsaG029319 | 0.876963 | 1.916634e-68 | 3.009163e-65 |
MsaG028501 | MsaG029320 | 0.927105 | 4.991933e-91 | 1.616010e-86 |
MsaG028501 | MsaG029324 | 0.803362 | 6.083624e-49 | 8.879712e-47 |
MsaG028501 | MsaG029461 | 0.830765 | 4.397885e-55 | 1.300923e-52 |
MsaG028501 | MsaG029581 | 0.822190 | 4.763679e-53 | 1.110340e-50 |
MsaG028501 | MsaG029745 | 0.864184 | 2.906993e-64 | 2.658636e-61 |
MsaG028501 | MsaG029863 | 0.805153 | 2.588634e-49 | 3.938533e-47 |
MsaG028501 | MsaG029907 | 0.820728 | 1.032146e-52 | 2.314146e-50 |
MsaG028501 | MsaG029899 | 0.831462 | 2.971113e-55 | 8.967721e-53 |
MsaG028501 | MsaG029948 | 0.813865 | 3.557196e-51 | 6.683035e-49 |
MsaG028501 | MsaG029926 | 0.805413 | 2.285228e-49 | 3.497866e-47 |
MsaG028501 | MsaG030010 | 0.831806 | 2.446151e-55 | 7.458596e-53 |
MsaG028501 | MsaG030016 | 0.807821 | 7.129385e-50 | 1.155217e-47 |
MsaG028501 | MsaG030084 | 0.873219 | 3.583344e-67 | 4.766188e-64 |
MsaG028501 | MsaG030332 | 0.842959 | 3.503229e-58 | 1.502273e-55 |
MsaG028501 | MsaG030336 | 0.858210 | 1.880670e-62 | 1.366769e-59 |
MsaG028501 | MsaG030471 | 0.842020 | 6.198196e-58 | 2.579307e-55 |
MsaG028501 | MsaG030501 | 0.845193 | 8.874687e-59 | 4.092179e-56 |
MsaG028501 | MsaG030507 | 0.852104 | 1.100370e-60 | 6.415814e-58 |
MsaG028501 | MsaG030801 | 0.827015 | 3.522527e-54 | 9.370198e-52 |
MsaG028501 | MsaG031277 | 0.886214 | 8.991621e-72 | 2.186479e-68 |
MsaG028501 | MsaG031295 | 0.831213 | 3.418282e-55 | 1.024248e-52 |
MsaG028501 | MsaG031288 | 0.897530 | 2.923320e-76 | 1.297546e-72 |
MsaG028501 | MsaG031624 | 0.820190 | 1.370224e-52 | 3.028944e-50 |
MsaG028501 | MsaG031735 | 0.837836 | 7.546279e-57 | 2.753654e-54 |
MsaG028501 | MsaG032062 | 0.870321 | 3.245431e-66 | 3.811793e-63 |
MsaG028501 | MsaG032146 | 0.802588 | 8.780945e-49 | 1.259035e-46 |
MsaG028501 | MsaG032147 | 0.827976 | 2.076371e-54 | 5.674336e-52 |
MsaG028501 | MsaG032148 | 0.809542 | 3.068886e-50 | 5.183279e-48 |
MsaG028501 | MsaG032555 | 0.805047 | 2.724109e-49 | 4.134504e-47 |
MsaG028501 | MsaG033022 | 0.855637 | 1.068653e-61 | 7.065307e-59 |
MsaG028501 | MsaG033249 | 0.873188 | 3.669004e-67 | 4.873659e-64 |
MsaG028501 | MsaG033481 | 0.819602 | 1.864043e-52 | 4.056562e-50 |
MsaG028501 | MsaG033492 | 0.844554 | 1.317419e-58 | 5.948514e-56 |
MsaG028501 | MsaG033693 | 0.800114 | 2.803608e-48 | 3.800319e-46 |
MsaG028501 | MsaG033769 | 0.808621 | 4.821744e-50 | 7.964857e-48 |
MsaG028501 | MsaG033812 | 0.822809 | 3.425829e-53 | 8.119731e-51 |
MsaG028501 | MsaG033831 | 0.839212 | 3.342471e-57 | 1.272963e-54 |
MsaG028501 | MsaG033959 | 0.800980 | 1.870939e-48 | 2.586125e-46 |
MsaG028501 | MsaG034049 | 0.812772 | 6.166116e-51 | 1.127164e-48 |
MsaG028501 | MsaG034259 | 0.831086 | 3.671061e-55 | 1.096032e-52 |
MsaG028501 | MsaG034415 | 0.805528 | 2.162307e-49 | 3.318562e-47 |
MsaG028501 | MsaG034827 | 0.916718 | 3.187318e-85 | 4.741877e-81 |
MsaG028501 | MsaG034828 | 0.912217 | 6.137771e-83 | 6.706183e-79 |
MsaG028501 | MsaG034829 | 0.924411 | 1.918640e-89 | 5.023119e-85 |
MsaG028501 | MsaG034842 | 0.908152 | 5.589979e-81 | 4.689056e-77 |
MsaG028501 | MsaG034975 | 0.836508 | 1.642919e-56 | 5.758021e-54 |
MsaG028501 | MsaG035057 | 0.829158 | 1.079669e-54 | 3.050027e-52 |
MsaG028501 | MsaG035210 | 0.822076 | 5.060148e-53 | 1.175855e-50 |
MsaG028501 | MsaG035860 | 0.802459 | 9.331689e-49 | 1.334047e-46 |
MsaG028501 | MsaG036332 | 0.898761 | 8.834835e-77 | 4.203804e-73 |
MsaG028501 | MsaG036377 | 0.805076 | 2.685486e-49 | 4.078589e-47 |
MsaG028501 | MsaG036973 | 0.806063 | 1.671075e-49 | 2.597201e-47 |
MsaG028501 | MsaG037074 | 0.802141 | 1.083990e-48 | 1.538382e-46 |
MsaG028501 | MsaG037861 | 0.874979 | 9.150773e-68 | 1.314696e-64 |
MsaG028501 | MsaG037865 | 0.817845 | 4.651063e-52 | 9.668970e-50 |
MsaG028501 | MsaG037866 | 0.830176 | 6.118292e-55 | 1.779636e-52 |
MsaG028501 | MsaG037867 | 0.813964 | 3.383572e-51 | 6.372606e-49 |
MsaG028501 | MsaG037948 | 0.805221 | 2.505480e-49 | 3.818033e-47 |
MsaG028501 | MsaG038016 | 0.849314 | 6.650144e-60 | 3.520954e-57 |
MsaG028501 | MsaG038269 | 0.810040 | 2.401357e-50 | 4.104785e-48 |
MsaG028501 | MsaG038263 | 0.822828 | 3.390870e-53 | 8.040992e-51 |
MsaG028501 | MsaG038983 | 0.853480 | 4.471720e-61 | 2.736426e-58 |
MsaG028501 | MsaG039206 | 0.835109 | 3.703118e-56 | 1.244450e-53 |
MsaG028501 | MsaG039621 | 0.868215 | 1.556305e-65 | 1.674987e-62 |
MsaG028501 | MsaG039724 | 0.806018 | 1.707829e-49 | 2.651366e-47 |
MsaG028501 | MsaG040077 | 0.823487 | 2.383995e-53 | 5.754923e-51 |
MsaG028501 | MsaG040649 | 0.842898 | 3.635737e-58 | 1.556083e-55 |
MsaG028501 | MsaG040669 | 0.805587 | 2.101225e-49 | 3.229318e-47 |
MsaG028501 | MsaG040800 | 0.845693 | 6.504382e-59 | 3.049529e-56 |
MsaG028501 | MsaG040980 | 0.837854 | 7.462706e-57 | 2.724710e-54 |
MsaG028501 | MsaG040982 | 0.865058 | 1.553090e-64 | 1.470757e-61 |
MsaG028501 | MsaG040985 | 0.812485 | 7.119178e-51 | 1.292164e-48 |
MsaG028501 | MsaG041071 | 0.827807 | 2.279760e-54 | 6.200746e-52 |
MsaG028501 | MsaG041116 | 0.805666 | 2.023012e-49 | 3.114890e-47 |
MsaG028501 | MsaG041271 | 0.809615 | 2.960696e-50 | 5.009264e-48 |
MsaG028501 | MsaG041300 | 0.876053 | 3.938371e-68 | 5.935766e-65 |
MsaG028501 | MsaG041517 | 0.854646 | 2.069334e-61 | 1.320025e-58 |
MsaG028501 | MsaG041685 | 0.869516 | 5.927755e-66 | 6.730990e-63 |
MsaG028501 | MsaG041684 | 0.830996 | 3.862304e-55 | 1.150129e-52 |
MsaG028501 | MsaG041686 | 0.842827 | 3.796513e-58 | 1.621155e-55 |
MsaG028501 | MsaG041687 | 0.820098 | 1.437755e-52 | 3.170471e-50 |
MsaG028501 | MsaG041644 | 0.812300 | 7.811480e-51 | 1.411245e-48 |
MsaG028501 | MsaG041888 | 0.807247 | 9.423071e-50 | 1.506004e-47 |
MsaG028501 | MsaG041899 | 0.878342 | 6.363061e-69 | 1.063834e-65 |
MsaG028501 | MsaG041900 | 0.893597 | 1.210275e-74 | 4.319930e-71 |
MsaG028501 | MsaG041901 | 0.895388 | 2.262421e-75 | 8.896314e-72 |
MsaG028501 | MsaG041902 | 0.895975 | 1.296701e-75 | 5.269016e-72 |
MsaG028501 | MsaG041903 | 0.865512 | 1.120264e-64 | 1.080279e-61 |
MsaG028501 | MsaG041904 | 0.859825 | 6.211919e-63 | 4.797528e-60 |
MsaG028501 | MsaG042382 | 0.864311 | 2.654481e-64 | 2.439980e-61 |
MsaG028501 | MsaG042632 | 0.830492 | 5.125642e-55 | 1.504316e-52 |
MsaG028501 | MsaG043177 | 0.840232 | 1.819405e-57 | 7.154344e-55 |
MsaG028501 | MsaG043227 | 0.815271 | 1.743337e-51 | 3.393217e-49 |
MsaG028501 | MsaG043415 | 0.827465 | 2.752089e-54 | 7.413645e-52 |
MsaG028501 | MsaG043659 | 0.828668 | 1.416805e-54 | 3.947680e-52 |
MsaG028501 | MsaG043663 | 0.823315 | 2.614046e-53 | 6.280983e-51 |
MsaG028501 | MsaG043980 | 0.824515 | 1.371137e-53 | 3.403770e-51 |
MsaG028501 | MsaG044097 | 0.805443 | 2.251998e-49 | 3.449458e-47 |
MsaG028501 | MsaG044284 | 0.812505 | 7.047441e-51 | 1.279807e-48 |
MsaG028501 | MsaG044336 | 0.860840 | 3.072353e-63 | 2.466524e-60 |
MsaG028501 | MsaG044354 | 0.834289 | 5.937800e-56 | 1.947148e-53 |
MsaG028501 | MsaG044384 | 0.881969 | 3.279281e-70 | 6.490360e-67 |
MsaG028501 | MsaG044386 | 0.801064 | 1.798177e-48 | 2.490277e-46 |
MsaG028501 | MsaG044387 | 0.808014 | 6.486937e-50 | 1.056049e-47 |
MsaG028501 | MsaG044439 | 0.892187 | 4.438699e-74 | 1.468357e-70 |
MsaG028501 | MsaG044547 | 0.831294 | 3.266271e-55 | 9.809992e-53 |
MsaG028501 | MsaG044588 | 0.802040 | 1.136859e-48 | 1.609717e-46 |
MsaG028501 | MsaG044606 | 0.814850 | 2.159234e-51 | 4.158247e-49 |
MsaG028501 | MsaG044919 | 0.903129 | 1.113737e-78 | 6.859553e-75 |
MsaG028501 | MsaG045021 | 0.827517 | 2.674222e-54 | 7.214464e-52 |
MsaG028501 | MsaG045072 | 0.808183 | 5.974695e-50 | 9.765870e-48 |
MsaG028501 | MsaG045125 | 0.828846 | 1.283595e-54 | 3.594293e-52 |
MsaG028501 | MsaG045222 | 0.836293 | 1.862846e-56 | 6.486779e-54 |
MsaG028501 | MsaG045278 | 0.827840 | 2.238421e-54 | 6.094012e-52 |
MsaG028501 | MsaG045339 | 0.831517 | 2.879985e-55 | 8.706886e-53 |
MsaG028501 | MsaG045380 | 0.808483 | 5.160798e-50 | 8.496684e-48 |
MsaG028501 | MsaG045376 | 0.819787 | 1.692432e-52 | 3.701158e-50 |
MsaG028501 | MsaG045403 | 0.859915 | 5.837703e-63 | 4.523828e-60 |
MsaG028501 | MsaG045445 | 0.859696 | 6.789268e-63 | 5.217769e-60 |
MsaG028501 | MsaG045446 | 0.825338 | 8.788568e-54 | 2.231432e-51 |
MsaG028501 | MsaG045460 | 0.829004 | 1.175709e-54 | 3.306934e-52 |
MsaG028501 | MsaG045522 | 0.837094 | 1.166697e-56 | 4.161906e-54 |
MsaG028501 | MsaG045611 | 0.830897 | 4.084382e-55 | 1.212786e-52 |
MsaG028501 | MsaG046040 | 0.847826 | 1.709662e-59 | 8.608307e-57 |
MsaG028501 | MsaG046043 | 0.819063 | 2.470503e-52 | 5.301149e-50 |
MsaG028501 | MsaG046053 | 0.906172 | 4.672518e-80 | 3.458323e-76 |
MsaG028501 | MsaG046120 | 0.858439 | 1.609194e-62 | 1.179611e-59 |
MsaG028501 | MsaG046226 | 0.813584 | 4.098036e-51 | 7.645053e-49 |
MsaG028501 | MsaG046423 | 0.830231 | 5.932653e-55 | 1.728318e-52 |
MsaG028501 | MsaG046383 | 0.874477 | 1.354165e-67 | 1.903401e-64 |
MsaG028501 | MsaG046427 | 0.805700 | 1.990395e-49 | 3.067128e-47 |
MsaG028501 | MsaG046588 | 0.870955 | 2.013275e-66 | 2.429418e-63 |
MsaG028501 | MsaG046630 | 0.802175 | 1.067011e-48 | 1.515459e-46 |
MsaG028501 | MsaG046816 | 0.823314 | 2.614211e-53 | 6.281350e-51 |
MsaG028501 | MsaG046862 | 0.816540 | 9.111057e-52 | 1.831477e-49 |
MsaG028501 | MsaG047054 | 0.869073 | 8.244077e-66 | 9.190393e-63 |
MsaG028501 | MsaG047055 | 0.829409 | 9.388186e-55 | 2.671317e-52 |
MsaG028501 | MsaG047194 | 0.806526 | 1.336140e-49 | 2.099543e-47 |
MsaG028501 | MsaG001257 | 0.807807 | 7.177867e-50 | 1.162696e-47 |
MsaG028501 | MsaG002437 | 0.902057 | 3.320858e-78 | 1.917281e-74 |
MsaG028501 | MsaG000067 | 0.822243 | 4.629539e-53 | 1.080651e-50 |
MsaG028501 | MsaG005390 | 0.833249 | 1.077432e-55 | 3.426361e-53 |
MsaG028501 | MsaG002583 | 0.829849 | 7.345198e-55 | 2.116593e-52 |
MsaG028501 | MsaG007590 | 0.830733 | 4.478112e-55 | 1.323393e-52 |
MsaG028501 | MsaG008937 | 0.805656 | 2.033472e-49 | 3.130250e-47 |
MsaG028501 | MsaG007674 | 0.809331 | 3.404772e-50 | 5.720919e-48 |
MsaG028501 | MsaG008796 | 0.851154 | 2.038543e-60 | 1.149679e-57 |
MsaG028501 | MsaG009037 | 0.868438 | 1.319830e-65 | 1.433594e-62 |
MsaG028501 | MsaG013401 | 0.839777 | 2.387849e-57 | 9.256492e-55 |
MsaG028501 | MsaG014449 | 0.808452 | 5.237986e-50 | 8.617256e-48 |
MsaG028501 | MsaG013066 | 0.851974 | 1.197501e-60 | 6.950727e-58 |
MsaG028501 | MsaG011742 | 0.824526 | 1.363650e-53 | 3.386164e-51 |
MsaG028501 | MsaG014180 | 0.866823 | 4.325041e-65 | 4.397828e-62 |
MsaG028501 | MsaG015534 | 0.854257 | 2.677586e-61 | 1.684751e-58 |
MsaG028501 | MsaG014275 | 0.887357 | 3.329926e-72 | 8.574865e-69 |
MsaG028501 | MsaG011840 | 0.807973 | 6.618789e-50 | 1.076435e-47 |
MsaG028501 | MsaG013405 | 0.814506 | 2.571116e-51 | 4.908682e-49 |
MsaG028501 | MsaG016847 | 0.805333 | 2.373972e-49 | 3.627025e-47 |
MsaG028501 | MsaG013014 | 0.854067 | 3.036025e-61 | 1.897160e-58 |
MsaG028501 | MsaG016403 | 0.836329 | 1.823823e-56 | 6.357758e-54 |
MsaG028501 | MsaG012695 | 0.815768 | 1.352839e-51 | 2.666450e-49 |
MsaG028501 | MsaG018815 | 0.833349 | 1.017991e-55 | 3.246607e-53 |
MsaG028501 | MsaG020796 | 0.814490 | 2.592294e-51 | 4.947070e-49 |
MsaG028501 | MsaG020038 | 0.814617 | 2.429900e-51 | 4.651984e-49 |
MsaG028501 | MsaG028139 | 0.814734 | 2.290690e-51 | 4.398379e-49 |
MsaG028501 | MsaG031950 | 0.856343 | 6.658850e-62 | 4.517435e-59 |
MsaG028501 | MsaG032410 | 0.897423 | 3.242091e-76 | 1.430423e-72 |
MsaG028501 | MsaG030439 | 0.813000 | 5.497948e-51 | 1.010782e-48 |
MsaG028501 | MsaG031807 | 0.805252 | 2.468678e-49 | 3.764606e-47 |
MsaG028501 | MsaG032931 | 0.811889 | 9.591914e-51 | 1.715504e-48 |
MsaG028501 | MsaG032367 | 0.807299 | 9.186894e-50 | 1.470130e-47 |
MsaG028501 | MsaG033467 | 0.861630 | 1.770221e-63 | 1.464455e-60 |
MsaG028501 | MsaG032980 | 0.849860 | 4.690033e-60 | 2.529613e-57 |
MsaG028501 | MsaG032243 | 0.844403 | 1.445847e-58 | 6.496134e-56 |
MsaG028501 | MsaG032845 | 0.849869 | 4.661339e-60 | 2.514877e-57 |
MsaG028501 | MsaG033345 | 0.843443 | 2.606259e-58 | 1.135138e-55 |
MsaG028501 | MsaG031316 | 0.848403 | 1.186481e-59 | 6.089831e-57 |
MsaG028501 | MsaG033234 | 0.819904 | 1.591872e-52 | 3.492119e-50 |
MsaG028501 | MsaG033148 | 0.814761 | 2.259073e-51 | 4.340749e-49 |
MsaG028501 | MsaG030874 | 0.817714 | 4.976790e-52 | 1.031102e-49 |
MsaG028501 | MsaG033325 | 0.884046 | 5.745879e-71 | 1.256700e-67 |
MsaG028501 | MsaG030922 | 0.807006 | 1.059299e-49 | 1.683407e-47 |
MsaG028501 | MsaG033582 | 0.809936 | 2.527539e-50 | 4.309573e-48 |
MsaG028501 | MsaG037271 | 0.865864 | 8.682692e-65 | 8.491356e-62 |
MsaG028501 | MsaG038765 | 0.884201 | 5.035511e-71 | 1.109531e-67 |
MsaG028501 | MsaG037384 | 0.854223 | 2.738600e-61 | 1.720892e-58 |
MsaG028501 | MsaG037729 | 0.866360 | 6.059915e-65 | 6.045705e-62 |
MsaG028501 | MsaG037156 | 0.809648 | 2.913060e-50 | 4.932600e-48 |
MsaG028501 | MsaG035542 | 0.819957 | 1.547953e-52 | 3.400709e-50 |
MsaG028501 | MsaG040703 | 0.845030 | 9.814231e-59 | 4.502192e-56 |
MsaG028501 | MsaG037480 | 0.857993 | 2.180058e-62 | 1.571640e-59 |
MsaG028501 | MsaG039226 | 0.829096 | 1.117000e-54 | 3.150100e-52 |
MsaG028501 | MsaG039736 | 0.852233 | 1.011621e-60 | 5.924728e-58 |
MsaG028501 | MsaG035272 | 0.830052 | 6.556465e-55 | 1.900360e-52 |
MsaG028501 | MsaG036984 | 0.864033 | 3.239246e-64 | 2.944527e-61 |
MsaG028501 | MsaG045440 | 0.810407 | 2.002431e-50 | 3.453816e-48 |
MsaG028501 | MsaG045876 | 0.821037 | 8.769485e-53 | 1.982488e-50 |
MsaG028501 | MsaG043312 | 0.825009 | 1.049922e-53 | 2.641782e-51 |
MsaG028501 | MsaG043458 | 0.809764 | 2.750655e-50 | 4.670702e-48 |
MsaG028501 | MsaG043831 | 0.828070 | 1.971422e-54 | 5.401662e-52 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG028501 | MtrunA17_Chr5g0432721 | 86.599 | 694 | 22 | 4 | 1 | 623 | 1 | 694 | 0.0 | 1181 |
MsaG028501 | MtrunA17_Chr3g0107701 | 50.931 | 752 | 235 | 13 | 1 | 623 | 1 | 747 | 0.0 | 667 |
MsaG028501 | MtrunA17_Chr4g0012861 | 38.978 | 744 | 313 | 12 | 1 | 623 | 1 | 724 | 4.95e-154 | 468 |
MsaG028501 | MtrunA17_Chr2g0281191 | 40.662 | 423 | 155 | 9 | 283 | 623 | 314 | 722 | 1.87e-84 | 284 |
MsaG028501 | MtrunA17_Chr2g0281191 | 43.066 | 137 | 60 | 5 | 6 | 135 | 31 | 156 | 3.57e-23 | 105 |
MsaG028501 | MtrunA17_Chr7g0244871 | 58.065 | 93 | 39 | 0 | 314 | 406 | 5 | 97 | 1.86e-32 | 120 |
MsaG028501 | MtrunA17_Chr7g0251891 | 48.235 | 85 | 43 | 1 | 321 | 404 | 16 | 100 | 1.50e-19 | 87.4 |
MsaG028501 | MtrunA17_Chr7g0237841 | 36.029 | 136 | 83 | 3 | 321 | 454 | 623 | 756 | 3.46e-16 | 82.8 |
MsaG028501 | MtrunA17_Chr1g0178071 | 37.037 | 135 | 64 | 6 | 302 | 422 | 54 | 181 | 8.92e-15 | 76.3 |
MsaG028501 | MtrunA17_Chr5g0422501 | 41.818 | 110 | 47 | 4 | 321 | 417 | 235 | 340 | 6.13e-14 | 74.3 |
MsaG028501 | MtrunA17_Chr7g0276471 | 38.462 | 91 | 51 | 3 | 321 | 408 | 117 | 205 | 1.99e-13 | 73.2 |
MsaG028501 | MtrunA17_Chr7g0266821 | 41.176 | 102 | 50 | 5 | 326 | 421 | 65 | 162 | 8.34e-13 | 69.7 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG028501 | AT4G32010.2 | 39.455 | 697 | 300 | 16 | 3 | 623 | 4 | 654 | 3.17e-147 | 447 |
MsaG028501 | AT4G32010.1 | 39.230 | 701 | 300 | 17 | 3 | 623 | 4 | 658 | 2.20e-145 | 442 |
MsaG028501 | AT2G30470.1 | 42.402 | 533 | 244 | 12 | 1 | 508 | 6 | 500 | 9.78e-121 | 379 |
MsaG028501 | AT2G30470.1 | 52.381 | 84 | 37 | 1 | 540 | 623 | 598 | 678 | 2.12e-21 | 99.8 |
MsaG028501 | AT4G21550.2 | 32.567 | 522 | 298 | 11 | 5 | 509 | 16 | 500 | 1.90e-76 | 254 |
MsaG028501 | AT4G21550.3 | 32.567 | 522 | 298 | 11 | 5 | 509 | 16 | 500 | 9.03e-76 | 253 |
MsaG028501 | AT4G21550.1 | 32.630 | 521 | 297 | 11 | 6 | 509 | 17 | 500 | 5.58e-75 | 255 |
MsaG028501 | AT3G26790.1 | 45.882 | 85 | 45 | 1 | 321 | 404 | 91 | 175 | 6.11e-18 | 85.9 |
MsaG028501 | AT3G24650.1 | 41.176 | 102 | 58 | 2 | 321 | 420 | 571 | 672 | 7.80e-16 | 82.0 |
MsaG028501 | AT1G28300.1 | 41.000 | 100 | 57 | 2 | 321 | 419 | 170 | 268 | 2.04e-15 | 79.0 |
MsaG028501 | AT2G36080.4 | 39.815 | 108 | 56 | 4 | 321 | 421 | 37 | 142 | 3.27e-15 | 74.7 |
MsaG028501 | AT2G36080.2 | 39.815 | 108 | 56 | 4 | 321 | 421 | 37 | 142 | 3.27e-15 | 74.7 |
MsaG028501 | AT4G01500.1 | 43.820 | 89 | 47 | 2 | 321 | 408 | 35 | 121 | 3.56e-15 | 77.8 |
MsaG028501 | AT5G06250.5 | 37.302 | 126 | 60 | 5 | 310 | 421 | 37 | 157 | 3.78e-15 | 76.6 |
MsaG028501 | AT5G06250.4 | 37.302 | 126 | 60 | 5 | 310 | 421 | 37 | 157 | 4.25e-15 | 76.6 |
MsaG028501 | AT5G06250.2 | 37.302 | 126 | 60 | 5 | 310 | 421 | 37 | 157 | 5.07e-15 | 76.6 |
MsaG028501 | AT5G06250.3 | 37.302 | 126 | 60 | 5 | 310 | 421 | 37 | 157 | 5.82e-15 | 76.3 |
MsaG028501 | AT5G06250.1 | 37.302 | 126 | 60 | 5 | 310 | 421 | 37 | 157 | 6.50e-15 | 75.9 |
MsaG028501 | AT2G46870.1 | 40.659 | 91 | 49 | 3 | 321 | 408 | 34 | 122 | 7.77e-15 | 76.3 |
MsaG028501 | AT2G36080.3 | 39.815 | 108 | 56 | 4 | 321 | 421 | 37 | 142 | 7.89e-15 | 75.1 |
MsaG028501 | AT2G36080.1 | 39.815 | 108 | 56 | 4 | 321 | 421 | 37 | 142 | 8.61e-15 | 75.1 |
MsaG028501 | AT1G13260.1 | 42.391 | 92 | 47 | 3 | 321 | 408 | 187 | 276 | 9.05e-15 | 76.6 |
MsaG028501 | AT3G25730.1 | 38.318 | 107 | 57 | 4 | 321 | 420 | 182 | 286 | 3.67e-14 | 74.7 |
MsaG028501 | AT3G61970.1 | 38.298 | 94 | 50 | 3 | 321 | 408 | 22 | 113 | 8.38e-14 | 73.2 |
MsaG028501 | AT1G68840.2 | 41.935 | 93 | 47 | 3 | 321 | 408 | 187 | 277 | 1.78e-13 | 72.8 |
MsaG028501 | AT1G68840.1 | 41.935 | 93 | 47 | 3 | 321 | 408 | 187 | 277 | 1.78e-13 | 72.8 |
MsaG028501 | AT3G11580.4 | 36.752 | 117 | 55 | 5 | 321 | 421 | 28 | 141 | 3.15e-13 | 70.1 |
MsaG028501 | AT3G11580.2 | 36.752 | 117 | 55 | 5 | 321 | 421 | 28 | 141 | 3.15e-13 | 70.1 |
MsaG028501 | AT3G11580.5 | 36.752 | 117 | 55 | 5 | 321 | 421 | 28 | 141 | 3.15e-13 | 70.1 |
MsaG028501 | AT1G01030.2 | 40.860 | 93 | 46 | 4 | 321 | 408 | 55 | 143 | 5.39e-13 | 71.2 |
MsaG028501 | AT1G01030.1 | 40.860 | 93 | 46 | 4 | 321 | 408 | 55 | 143 | 6.32e-13 | 71.2 |
MsaG028501 | AT3G11580.1 | 36.752 | 117 | 55 | 5 | 321 | 421 | 28 | 141 | 1.30e-12 | 68.9 |
MsaG028501 | AT3G11580.3 | 36.752 | 117 | 55 | 5 | 321 | 421 | 28 | 141 | 1.39e-11 | 67.4 |
Find 165 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
CCTCAACAAACAAGAGTTTA+AGG | 0.167452 | 5:+63242373 | MsaT028501.1:CDS |
ATTCAAGAACACAAGCTTTC+AGG | 0.213336 | 5:+63237615 | MsaT028501.1:CDS |
ACTTAACACCTTCTCAAATA+AGG | 0.237548 | 5:-63235682 | None:intergenic |
CCCGCATTTGTTGCAGAGTT+TGG | 0.256841 | 5:-63233136 | None:intergenic |
ATCAGTTACTTTCTCGATAC+TGG | 0.269074 | 5:+63235221 | MsaT028501.1:CDS |
TTTACAGTTCCAAGATATAA+TGG | 0.271409 | 5:+63235908 | MsaT028501.1:CDS |
TATACCTCAGCACACGCTTT+TGG | 0.274011 | 5:-63235741 | None:intergenic |
TGAAGACTTTCTTGTTCCTT+TGG | 0.285526 | 5:-63237208 | None:intergenic |
AAGAAGAGGTCTCGCAATAT+TGG | 0.296576 | 5:+63236563 | MsaT028501.1:CDS |
TAGCAGGAACCTTACTTAAA+TGG | 0.299211 | 5:+63236428 | MsaT028501.1:intron |
TACATCCTACTGTTGTTATT+AGG | 0.308177 | 5:-63235963 | None:intergenic |
CAATTAAATGCTGGTGATAC+TGG | 0.325898 | 5:+63236023 | MsaT028501.1:CDS |
AATGTAGTAAATGCTGTTAA+AGG | 0.330641 | 5:-63234917 | None:intergenic |
TTACAGTTCCAAGATATAAT+GGG | 0.352438 | 5:+63235909 | MsaT028501.1:CDS |
AGGATACTGAAAATCATAAT+AGG | 0.362554 | 5:+63234642 | MsaT028501.1:intron |
GCAAACATCTCAGTCTATAT+TGG | 0.370039 | 5:+63235099 | MsaT028501.1:CDS |
AAATTCCACCGTCATGAAAC+TGG | 0.376289 | 5:+63234252 | MsaT028501.1:CDS |
GATGGCATGGTTTCATGTAT+TGG | 0.377424 | 5:+63234818 | MsaT028501.1:CDS |
AAGTCTTCAAAGAACCAAAA+AGG | 0.381624 | 5:+63237222 | MsaT028501.1:CDS |
CTTGTTCCTTTGGACCGAGC+TGG | 0.382544 | 5:-63237198 | None:intergenic |
AAAACCAGTGCCTCTCCATC+AGG | 0.394979 | 5:+63236853 | MsaT028501.1:CDS |
ACATTCAGAACATCTGCGTT+TGG | 0.398523 | 5:+63236451 | MsaT028501.1:CDS |
GAACATCTGCGTTTGGGTAA+TGG | 0.398608 | 5:+63236458 | MsaT028501.1:CDS |
CAATGGTCCATTGCAGCAAC+TGG | 0.398704 | 5:+63236526 | MsaT028501.1:CDS |
CAATTCTACACAACTGCATA+AGG | 0.399404 | 5:-63234754 | None:intergenic |
CCGAGTGATGCAGGTCGAAT+TGG | 0.400991 | 5:+63235705 | MsaT028501.1:CDS |
CATTCAGAACATCTGCGTTT+GGG | 0.404927 | 5:+63236452 | MsaT028501.1:CDS |
AACAATGCAAGTGATCGATA+TGG | 0.408713 | 5:+63234683 | MsaT028501.1:CDS |
ATGAGTCTTGAAACAAATAA+AGG | 0.410706 | 5:+63235148 | MsaT028501.1:CDS |
ATTCCAGCTGACGACTCATC+AGG | 0.413891 | 5:-63237687 | None:intergenic |
AGAAGAGGTCTCGCAATATT+GGG | 0.416834 | 5:+63236564 | MsaT028501.1:CDS |
CTGCCGTTGGCCACTGAGAT+TGG | 0.423759 | 5:+63235031 | MsaT028501.1:CDS |
TAAGCCCTCCCAGCTTTGTC+TGG | 0.424644 | 5:+63234485 | MsaT028501.1:CDS |
TCGTTCGAGTACCTTGATTT+CGG | 0.425356 | 5:+63234438 | MsaT028501.1:CDS |
AGGCAAGGCAAGTGCATGTC+GGG | 0.425926 | 5:-63237791 | None:intergenic |
ACTCGTTCCCCATTATATCT+TGG | 0.426035 | 5:-63235917 | None:intergenic |
CTTAACACCTTCTCAAATAA+GGG | 0.428464 | 5:-63235681 | None:intergenic |
GAATTGACACTTAACTTCTT+CGG | 0.430100 | 5:-63234849 | None:intergenic |
TCTGAATGTCCATTTAAGTA+AGG | 0.433067 | 5:-63236437 | None:intergenic |
CTTATGCAGTTGTGTAGAAT+TGG | 0.437808 | 5:+63234755 | MsaT028501.1:CDS |
TATTGTAAGGAAGGTTCAAC+TGG | 0.440184 | 5:+63233072 | MsaT028501.1:CDS |
CAACAGTAGGATGTATGTAT+TGG | 0.441536 | 5:+63235971 | MsaT028501.1:CDS |
CTCTTTGAGCTTGTGACCAA+CGG | 0.442148 | 5:-63234796 | None:intergenic |
GGGTGGTCTTTGATCTCTGG+TGG | 0.449691 | 5:+63233108 | MsaT028501.1:CDS |
ACATTTAGTCGGATAGATCC+TGG | 0.451349 | 5:+63236126 | MsaT028501.1:CDS |
AAAGGGTGGTCTTTGATCTC+TGG | 0.456650 | 5:+63233105 | MsaT028501.1:CDS |
ACAGAAAAGTGAATTCTCAT+AGG | 0.458212 | 5:-63234226 | None:intergenic |
CAAGAGCTGGAGAAATTGTC+CGG | 0.461047 | 5:+63235259 | MsaT028501.1:CDS |
CTGCATTGGCAAGAGCATCT+AGG | 0.465149 | 5:-63237638 | None:intergenic |
ATGAATAATTATTGTAAGGA+AGG | 0.465785 | 5:+63233063 | MsaT028501.1:CDS |
GACCCTGATGAGTCGTCAGC+TGG | 0.471030 | 5:+63237684 | MsaT028501.1:CDS |
GTCTATTGAATAGATGCAAT+TGG | 0.475888 | 5:+63242333 | MsaT028501.1:intron |
AAGAAATTCTGTTCTGCCGT+TGG | 0.479555 | 5:+63235018 | MsaT028501.1:CDS |
GATAAGAATAAGACAAAGCT+TGG | 0.482276 | 5:+63242744 | MsaT028501.1:CDS |
CCAAACTCTGCAACAAATGC+GGG | 0.482509 | 5:+63233136 | MsaT028501.1:CDS |
CATTCAACCACCAAGTGGAC+AGG | 0.483217 | 5:+63237758 | MsaT028501.1:CDS |
TGGGTAATGGAACTGCTGAT+TGG | 0.484375 | 5:+63236471 | MsaT028501.1:CDS |
TTTATTTGTTTCAAGACTCA+TGG | 0.486601 | 5:-63235146 | None:intergenic |
CTATGGAATTGAGACTTACA+TGG | 0.489129 | 5:+63236624 | MsaT028501.1:CDS |
TTTAACAGCATTTACTACAT+TGG | 0.491046 | 5:+63234919 | MsaT028501.1:CDS |
CCTTCACATCAGCAGGTGGC+CGG | 0.497637 | 5:-63235192 | None:intergenic |
CATTCATAGCGAAGATGCTA+TGG | 0.498765 | 5:+63236607 | MsaT028501.1:CDS |
GTGTATGAATAATTATTGTA+AGG | 0.498958 | 5:+63233059 | MsaT028501.1:CDS |
ATTGCCTAAAACTGCTGCAT+TGG | 0.500146 | 5:-63237652 | None:intergenic |
AACTTATACCACCGAAATCA+AGG | 0.500512 | 5:-63234449 | None:intergenic |
CCGGCCACCTGCTGATGTGA+AGG | 0.500794 | 5:+63235192 | MsaT028501.1:CDS |
GTGTTAAGTCCGAGTGATGC+AGG | 0.501935 | 5:+63235696 | MsaT028501.1:CDS |
TCAGCAGGTGGCCGGCGTGG+TGG | 0.502029 | 5:-63235184 | None:intergenic |
CCTTAAACTCTTGTTTGTTG+AGG | 0.503448 | 5:-63242373 | None:intergenic |
GGTGGTCTTTGATCTCTGGT+GGG | 0.503585 | 5:+63233109 | MsaT028501.1:CDS |
CAGTAGGATGTATGTATTGG+AGG | 0.506980 | 5:+63235974 | MsaT028501.1:CDS |
TTACCCTGATGGAGAGGCAC+TGG | 0.511162 | 5:-63236857 | None:intergenic |
TGTTTGTTGAGGTAACCTCT+TGG | 0.512869 | 5:-63242362 | None:intergenic |
ATTATATCTTGGAACTGTAA+AGG | 0.513021 | 5:-63235906 | None:intergenic |
TCAACTGGTGAATGGAAGAA+AGG | 0.514062 | 5:+63233087 | MsaT028501.1:CDS |
CGGCCACCTGCTGATGTGAA+GGG | 0.515875 | 5:+63235193 | MsaT028501.1:CDS |
TTAACCTTACCAGACAAAGC+TGG | 0.516700 | 5:-63234494 | None:intergenic |
ATTGGAGAAGGTAAACTTGA+GGG | 0.521191 | 5:+63235049 | MsaT028501.1:CDS |
AGCTCTTGATCAGTAATCCT+TGG | 0.521679 | 5:-63235244 | None:intergenic |
GGTATATAATCTTACCCTGA+TGG | 0.522702 | 5:-63236868 | None:intergenic |
AAACATCCGAGGCATCGTCC+TGG | 0.526966 | 5:+63237717 | MsaT028501.1:CDS |
AGGAAGGTTCAACTGGTGAA+TGG | 0.526974 | 5:+63233079 | MsaT028501.1:CDS |
CGATATGGTGAACATATTGA+TGG | 0.528805 | 5:+63234698 | MsaT028501.1:CDS |
TTGTTACAGTAACATTTAGT+CGG | 0.530093 | 5:+63236115 | MsaT028501.1:intron |
TGAAACGCTTTCACTAAAGA+TGG | 0.532158 | 5:+63234979 | MsaT028501.1:CDS |
CCAATTCGACCTGCATCACT+CGG | 0.532323 | 5:-63235705 | None:intergenic |
TTTCAGTTTCAGAGAAGAAG+AGG | 0.532408 | 5:+63236549 | MsaT028501.1:CDS |
ACTGAAACCAGTTGCTGCAA+TGG | 0.534324 | 5:-63236533 | None:intergenic |
TTGGCTCAACTATCAAAGAC+TGG | 0.539999 | 5:+63235118 | MsaT028501.1:CDS |
CGCTAAGAGTCTCACAGGCA+AGG | 0.543664 | 5:-63237806 | None:intergenic |
ATCACCAGCATTTAATTGCA+AGG | 0.546441 | 5:-63236018 | None:intergenic |
CAGTCCTTGCAATTAAATGC+TGG | 0.547662 | 5:+63236014 | MsaT028501.1:CDS |
AGACTACTGGTGGAACAAGC+TGG | 0.549005 | 5:+63234722 | MsaT028501.1:CDS |
TAACCTTACCAGACAAAGCT+GGG | 0.549034 | 5:-63234493 | None:intergenic |
GTGCATCCAGGACGATGCCT+CGG | 0.549949 | 5:-63237723 | None:intergenic |
TACTTTCTCGATACTGGCCA+AGG | 0.550936 | 5:+63235227 | MsaT028501.1:CDS |
AAGAGCTGGAGAAATTGTCC+GGG | 0.551015 | 5:+63235260 | MsaT028501.1:CDS |
TGTTGAGGTAACCTCTTGGA+AGG | 0.556022 | 5:-63242358 | None:intergenic |
TTCGAGTACCTTGATTTCGG+TGG | 0.557929 | 5:+63234441 | MsaT028501.1:CDS |
CAACTGGTGAATGGAAGAAA+GGG | 0.559758 | 5:+63233088 | MsaT028501.1:CDS |
TGTAGTGCCCTTATTTGAGA+AGG | 0.560033 | 5:+63235674 | MsaT028501.1:CDS |
ATTGACTTCTGTTGTTACAC+AGG | 0.561453 | 5:+63236179 | MsaT028501.1:CDS |
TCCATCCAGTTTCATGACGG+TGG | 0.564496 | 5:-63234257 | None:intergenic |
AATTGCAAGGACTGTATGCA+AGG | 0.565036 | 5:-63236005 | None:intergenic |
ACTATACATCCACTGTGGAT+AGG | 0.566036 | 5:-63234405 | None:intergenic |
GGAAAATAATAGACCAACAT+GGG | 0.566824 | 5:+63234940 | MsaT028501.1:CDS |
AAGGATTACTGATCAAGAGC+TGG | 0.569540 | 5:+63235246 | MsaT028501.1:CDS |
GCCAAACTCTGCAACAAATG+CGG | 0.571705 | 5:+63233135 | MsaT028501.1:CDS |
ATCAGACCAGCTCGGTCCAA+AGG | 0.576061 | 5:+63237192 | MsaT028501.1:CDS |
TCCTCCATCCAGTTTCATGA+CGG | 0.576172 | 5:-63234260 | None:intergenic |
CACACGATACAAGTGCATCC+AGG | 0.576195 | 5:-63237735 | None:intergenic |
TTTGGCCTAATAACAACAGT+AGG | 0.577022 | 5:+63235958 | MsaT028501.1:CDS |
TTCCCCTTCACATCAGCAGG+TGG | 0.578031 | 5:-63235196 | None:intergenic |
TAAGTGTCAATTCAACAAAG+AGG | 0.581056 | 5:+63234859 | MsaT028501.1:CDS |
CTTACCAGACAAAGCTGGGA+GGG | 0.582135 | 5:-63234489 | None:intergenic |
ACATCAGCAGGTGGCCGGCG+TGG | 0.583280 | 5:-63235187 | None:intergenic |
CATTTAGTCGGATAGATCCT+GGG | 0.586278 | 5:+63236127 | MsaT028501.1:CDS |
AACCGCGCTAAGAGTCTCAC+AGG | 0.587012 | 5:-63237811 | None:intergenic |
GCTTAAAACTGCACATAGTG+AGG | 0.592237 | 5:+63236493 | MsaT028501.1:CDS |
CTTTCACTAAAGATGGCTCT+AGG | 0.593793 | 5:+63234986 | MsaT028501.1:CDS |
ACAAGCTCAAAGAGATGGCA+TGG | 0.595112 | 5:+63234805 | MsaT028501.1:CDS |
CTGGTGGAACAAGCTGGCAA+AGG | 0.598804 | 5:+63234728 | MsaT028501.1:CDS |
TATTGATGGTAGACTACTGG+TGG | 0.600333 | 5:+63234712 | MsaT028501.1:CDS |
GGCCACCTGCTGATGTGAAG+GGG | 0.601780 | 5:+63235194 | MsaT028501.1:CDS |
TGGTCACAAGCTCAAAGAGA+TGG | 0.603653 | 5:+63234800 | MsaT028501.1:CDS |
CAGGCAAGGCAAGTGCATGT+CGG | 0.603970 | 5:-63237792 | None:intergenic |
ACATATTGATGGTAGACTAC+TGG | 0.604398 | 5:+63234709 | MsaT028501.1:CDS |
CCTTTCTGCTAAAAGAAACA+AGG | 0.604401 | 5:+63242412 | MsaT028501.1:CDS |
TCCACCGTCATGAAACTGGA+TGG | 0.604497 | 5:+63234256 | MsaT028501.1:CDS |
ATTGCAAGGACTGTATGCAA+GGG | 0.607548 | 5:-63236004 | None:intergenic |
ATATTGGGACGAAAACTAAG+AGG | 0.609627 | 5:+63236579 | MsaT028501.1:CDS |
AAGATATAATGGGGAACGAG+TGG | 0.614024 | 5:+63235919 | MsaT028501.1:CDS |
AGTAGGATGTATGTATTGGA+GGG | 0.615364 | 5:+63235975 | MsaT028501.1:CDS |
GAAATCAAGGTACTCGAACG+AGG | 0.619957 | 5:-63234436 | None:intergenic |
TTGTGTAGAATTGGTGAAGT+CGG | 0.620883 | 5:+63234764 | MsaT028501.1:CDS |
TACAGTTCCAAGATATAATG+GGG | 0.621280 | 5:+63235910 | MsaT028501.1:CDS |
TTGGCCACTGAGATTGGAGA+AGG | 0.621905 | 5:+63235037 | MsaT028501.1:CDS |
AAACCAGTGCCTCTCCATCA+GGG | 0.622368 | 5:+63236854 | MsaT028501.1:CDS |
TGATCTCTCATCCACCACGC+CGG | 0.630532 | 5:+63235173 | MsaT028501.1:CDS |
ATAATCTTACCCTGATGGAG+AGG | 0.631070 | 5:-63236863 | None:intergenic |
TTCCAGCTGACGACTCATCA+GGG | 0.634723 | 5:-63237686 | None:intergenic |
ATTCAACCACCAAGTGGACA+GGG | 0.641900 | 5:+63237759 | MsaT028501.1:CDS |
AAGTCGGTGAATCAAGCCGT+TGG | 0.642223 | 5:+63234780 | MsaT028501.1:CDS |
GGTTCTGCATCAGACCAGCT+CGG | 0.642711 | 5:+63237184 | MsaT028501.1:CDS |
TGGAAAATAATAGACCAACA+TGG | 0.644227 | 5:+63234939 | MsaT028501.1:CDS |
CTGGTGAATGGAAGAAAGGG+TGG | 0.646177 | 5:+63233091 | MsaT028501.1:CDS |
TGCAATTGGTGCCTTCCAAG+AGG | 0.654948 | 5:+63242347 | MsaT028501.1:CDS |
GTGTGCATTCAACCACCAAG+TGG | 0.657426 | 5:+63237753 | MsaT028501.1:CDS |
TCTCCAATCTCAGTGGCCAA+CGG | 0.657815 | 5:-63235034 | None:intergenic |
CCTTCTGATTGCAAAATACG+AGG | 0.659510 | 5:-63235879 | None:intergenic |
TTGCAAGGACTGTATGCAAG+GGG | 0.665717 | 5:-63236003 | None:intergenic |
TAAAACTGCACATAGTGAGG+AGG | 0.667263 | 5:+63236496 | MsaT028501.1:CDS |
GAAATGCAGCAATTGCAGCA+AGG | 0.667427 | 5:+63234281 | MsaT028501.1:CDS |
GATTGGAGAAGGTAAACTTG+AGG | 0.667659 | 5:+63235048 | MsaT028501.1:CDS |
TGCCTGTGAGACTCTTAGCG+CGG | 0.672994 | 5:+63237809 | MsaT028501.1:CDS |
ACCGTCATGAAACTGGATGG+AGG | 0.674066 | 5:+63234259 | MsaT028501.1:CDS |
AGTGAGGAGGAAATGAACAA+TGG | 0.681817 | 5:+63236509 | MsaT028501.1:CDS |
TATGGAATTGAGACTTACAT+GGG | 0.685466 | 5:+63236625 | MsaT028501.1:CDS |
AAGCTGGGAGGGCTTAACAC+AGG | 0.686823 | 5:-63234478 | None:intergenic |
GAATCACCACAAAACATCCG+AGG | 0.699635 | 5:+63237706 | MsaT028501.1:CDS |
TTTACCTTCTCCAATCTCAG+TGG | 0.700030 | 5:-63235041 | None:intergenic |
CCTTACCAGACAAAGCTGGG+AGG | 0.709735 | 5:-63234490 | None:intergenic |
AGAGCTGGAGAAATTGTCCG+GGG | 0.721199 | 5:+63235261 | MsaT028501.1:CDS |
GCTCCCAAAAGCGTGTGCTG+AGG | 0.736724 | 5:+63235737 | MsaT028501.1:CDS |
TTGATACTATACATCCACTG+TGG | 0.738079 | 5:-63234410 | None:intergenic |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr5 | gene | 63233045 | 63242776 | 63233045 | ID=MsaG028501 |
Chr5 | mRNA | 63233045 | 63242776 | 63233045 | ID=MsaT028501.1;Parent=MsaG028501 |
Chr5 | exon | 63233045 | 63233157 | 63233045 | ID=MsaT028501.1.exon1;Parent=MsaT028501.1 |
Chr5 | CDS | 63233045 | 63233157 | 63233045 | ID=cds.MsaT028501.1;Parent=MsaT028501.1 |
Chr5 | exon | 63234221 | 63234302 | 63234221 | ID=MsaT028501.1.exon2;Parent=MsaT028501.1 |
Chr5 | CDS | 63234221 | 63234302 | 63234221 | ID=cds.MsaT028501.1;Parent=MsaT028501.1 |
Chr5 | exon | 63234405 | 63234506 | 63234405 | ID=MsaT028501.1.exon3;Parent=MsaT028501.1 |
Chr5 | CDS | 63234405 | 63234506 | 63234405 | ID=cds.MsaT028501.1;Parent=MsaT028501.1 |
Chr5 | exon | 63234644 | 63235284 | 63234644 | ID=MsaT028501.1.exon4;Parent=MsaT028501.1 |
Chr5 | CDS | 63234644 | 63235284 | 63234644 | ID=cds.MsaT028501.1;Parent=MsaT028501.1 |
Chr5 | exon | 63235662 | 63235758 | 63235662 | ID=MsaT028501.1.exon5;Parent=MsaT028501.1 |
Chr5 | CDS | 63235662 | 63235758 | 63235662 | ID=cds.MsaT028501.1;Parent=MsaT028501.1 |
Chr5 | exon | 63235870 | 63236044 | 63235870 | ID=MsaT028501.1.exon6;Parent=MsaT028501.1 |
Chr5 | CDS | 63235870 | 63236044 | 63235870 | ID=cds.MsaT028501.1;Parent=MsaT028501.1 |
Chr5 | exon | 63236124 | 63236200 | 63236124 | ID=MsaT028501.1.exon7;Parent=MsaT028501.1 |
Chr5 | CDS | 63236124 | 63236200 | 63236124 | ID=cds.MsaT028501.1;Parent=MsaT028501.1 |
Chr5 | exon | 63236431 | 63236668 | 63236431 | ID=MsaT028501.1.exon8;Parent=MsaT028501.1 |
Chr5 | CDS | 63236431 | 63236668 | 63236431 | ID=cds.MsaT028501.1;Parent=MsaT028501.1 |
Chr5 | exon | 63236839 | 63236875 | 63236839 | ID=MsaT028501.1.exon9;Parent=MsaT028501.1 |
Chr5 | CDS | 63236839 | 63236875 | 63236839 | ID=cds.MsaT028501.1;Parent=MsaT028501.1 |
Chr5 | exon | 63237177 | 63237243 | 63237177 | ID=MsaT028501.1.exon10;Parent=MsaT028501.1 |
Chr5 | CDS | 63237177 | 63237243 | 63237177 | ID=cds.MsaT028501.1;Parent=MsaT028501.1 |
Chr5 | exon | 63237585 | 63237850 | 63237585 | ID=MsaT028501.1.exon11;Parent=MsaT028501.1 |
Chr5 | CDS | 63237585 | 63237850 | 63237585 | ID=cds.MsaT028501.1;Parent=MsaT028501.1 |
Chr5 | exon | 63242346 | 63242433 | 63242346 | ID=MsaT028501.1.exon12;Parent=MsaT028501.1 |
Chr5 | CDS | 63242346 | 63242433 | 63242346 | ID=cds.MsaT028501.1;Parent=MsaT028501.1 |
Chr5 | exon | 63242735 | 63242776 | 63242735 | ID=MsaT028501.1.exon13;Parent=MsaT028501.1 |
Chr5 | CDS | 63242735 | 63242776 | 63242735 | ID=cds.MsaT028501.1;Parent=MsaT028501.1 |
Gene Sequence |
Protein sequence |