Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG028669 | XP_039690713.1 | 85.036 | 274 | 32 | 1 | 1 | 265 | 1 | 274 | 1.49e-171 | 484 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG028669 | sp|Q8L3W1|VRN1_ARATH | 48.485 | 99 | 51 | 0 | 21 | 119 | 6 | 104 | 4.85e-25 | 104 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG028669 | tr|G7KE59|G7KE59_MEDTR | 85.036 | 274 | 32 | 1 | 1 | 265 | 1 | 274 | 7.14e-172 | 484 |
| Gene ID | Type | Classification |
|---|---|---|
| MsaG028669 | TF | B3 |
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| MsaG000213 | MsaG028669 | 0.817670 | 5.090649e-52 | 1.053488e-49 |
| MsaG000491 | MsaG028669 | 0.882846 | 1.577892e-70 | 3.257063e-67 |
| MsaG000671 | MsaG028669 | 0.857190 | 3.761993e-62 | 2.632005e-59 |
| MsaG000730 | MsaG028669 | 0.852045 | 1.143357e-60 | 6.652846e-58 |
| MsaG000733 | MsaG028669 | 0.847831 | 1.704377e-59 | 8.582945e-57 |
| MsaG000858 | MsaG028669 | 0.812514 | 7.016158e-51 | 1.274396e-48 |
| MsaG002560 | MsaG028669 | 0.822345 | 4.384847e-53 | 1.026365e-50 |
| MsaG002563 | MsaG028669 | 0.821161 | 8.214591e-53 | 1.863140e-50 |
| MsaG003090 | MsaG028669 | 0.847345 | 2.314386e-59 | 1.146516e-56 |
| MsaG003269 | MsaG028669 | 0.853379 | 4.777864e-61 | 2.913378e-58 |
| MsaG003399 | MsaG028669 | 0.800139 | 2.770427e-48 | 3.757491e-46 |
| MsaG003520 | MsaG028669 | 0.881929 | 3.391129e-70 | 6.699160e-67 |
| MsaG003565 | MsaG028669 | 0.835480 | 2.986321e-56 | 1.014811e-53 |
| MsaG003631 | MsaG028669 | 0.846071 | 5.142839e-59 | 2.441408e-56 |
| MsaG003658 | MsaG028669 | 0.825148 | 9.739587e-54 | 2.459943e-51 |
| MsaG003828 | MsaG028669 | 0.917316 | 1.550435e-85 | 2.408832e-81 |
| MsaG003968 | MsaG028669 | 0.841656 | 7.728968e-58 | 3.178974e-55 |
| MsaG003974 | MsaG028669 | 0.808306 | 5.625686e-50 | 9.222532e-48 |
| MsaG004115 | MsaG028669 | 0.840036 | 2.046121e-57 | 7.996755e-55 |
| MsaG004116 | MsaG028669 | 0.884135 | 5.326183e-71 | 1.169761e-67 |
| MsaG004340 | MsaG028669 | 0.806081 | 1.656874e-49 | 2.576155e-47 |
| MsaG004422 | MsaG028669 | 0.862776 | 7.906698e-64 | 6.840458e-61 |
| MsaG004759 | MsaG028669 | 0.848654 | 1.012331e-59 | 5.240651e-57 |
| MsaG004780 | MsaG028669 | 0.800225 | 2.661499e-48 | 3.616800e-46 |
| MsaG004923 | MsaG028669 | 0.868837 | 9.826174e-66 | 1.084749e-62 |
| MsaG004912 | MsaG028669 | 0.872170 | 8.001518e-67 | 1.017095e-63 |
| MsaG005447 | MsaG028669 | 0.882827 | 1.603420e-70 | 3.306837e-67 |
| MsaG005451 | MsaG028669 | 0.904718 | 2.155093e-79 | 1.459649e-75 |
| MsaG005618 | MsaG028669 | 0.831265 | 3.320540e-55 | 9.964277e-53 |
| MsaG005591 | MsaG028669 | 0.851967 | 1.202841e-60 | 6.979937e-58 |
| MsaG006160 | MsaG028669 | 0.814143 | 3.090411e-51 | 5.846462e-49 |
| MsaG006338 | MsaG028669 | 0.800184 | 2.713288e-48 | 3.683693e-46 |
| MsaG006407 | MsaG028669 | 0.804635 | 3.317575e-49 | 4.987132e-47 |
| MsaG006510 | MsaG028669 | 0.899647 | 3.697032e-77 | 1.852353e-73 |
| MsaG006752 | MsaG028669 | 0.888063 | 1.793435e-72 | 4.784476e-69 |
| MsaG006843 | MsaG028669 | 0.834466 | 5.364317e-56 | 1.768402e-53 |
| MsaG006862 | MsaG028669 | 0.811248 | 1.319443e-50 | 2.322977e-48 |
| MsaG006893 | MsaG028669 | 0.804549 | 3.456657e-49 | 5.185939e-47 |
| MsaG006891 | MsaG028669 | 0.850563 | 2.984605e-60 | 1.649279e-57 |
| MsaG006934 | MsaG028669 | 0.815629 | 1.452593e-51 | 2.853052e-49 |
| MsaG006981 | MsaG028669 | 0.830252 | 5.865064e-55 | 1.709600e-52 |
| MsaG007222 | MsaG028669 | 0.850322 | 3.486208e-60 | 1.910188e-57 |
| MsaG007334 | MsaG028669 | 0.894216 | 6.804708e-75 | 2.512051e-71 |
| MsaG007500 | MsaG028669 | 0.875395 | 6.609595e-68 | 9.671772e-65 |
| MsaG007713 | MsaG028669 | 0.813600 | 4.064467e-51 | 7.585498e-49 |
| MsaG008171 | MsaG028669 | 0.878404 | 6.052110e-69 | 1.014584e-65 |
| MsaG008404 | MsaG028669 | 0.858156 | 1.951204e-62 | 1.415204e-59 |
| MsaG008428 | MsaG028669 | 0.853027 | 6.020707e-61 | 3.626091e-58 |
| MsaG008896 | MsaG028669 | 0.909053 | 2.094124e-81 | 1.862004e-77 |
| MsaG009071 | MsaG028669 | 0.805126 | 2.621769e-49 | 3.986491e-47 |
| MsaG010243 | MsaG028669 | 0.842294 | 5.249355e-58 | 2.203504e-55 |
| MsaG010245 | MsaG028669 | 0.852048 | 1.141457e-60 | 6.642375e-58 |
| MsaG010448 | MsaG028669 | 0.812555 | 6.873928e-51 | 1.249823e-48 |
| MsaG010862 | MsaG028669 | 0.802846 | 7.769786e-49 | 1.120610e-46 |
| MsaG010945 | MsaG028669 | 0.824690 | 1.248109e-53 | 3.113039e-51 |
| MsaG011125 | MsaG028669 | 0.824653 | 1.273327e-53 | 3.172658e-51 |
| MsaG011242 | MsaG028669 | 0.845727 | 6.369889e-59 | 2.989789e-56 |
| MsaG011426 | MsaG028669 | 0.932952 | 1.092590e-94 | 5.681297e-90 |
| MsaG011534 | MsaG028669 | 0.894104 | 7.548422e-75 | 2.769780e-71 |
| MsaG011808 | MsaG028669 | 0.925728 | 3.279643e-90 | 9.518028e-86 |
| MsaG011884 | MsaG028669 | 0.843326 | 2.799918e-58 | 1.214924e-55 |
| MsaG012084 | MsaG028669 | 0.814467 | 2.622167e-51 | 5.001261e-49 |
| MsaG012182 | MsaG028669 | 0.815331 | 1.690706e-51 | 3.295756e-49 |
| MsaG012377 | MsaG028669 | 0.933597 | 4.116392e-95 | 2.260312e-90 |
| MsaG012469 | MsaG028669 | 0.803152 | 6.723498e-49 | 9.765840e-47 |
| MsaG013867 | MsaG028669 | 0.819633 | 1.834629e-52 | 3.995698e-50 |
| MsaG013878 | MsaG028669 | 0.920743 | 2.231226e-87 | 4.437899e-83 |
| MsaG014144 | MsaG028669 | 0.823064 | 2.989047e-53 | 7.133521e-51 |
| MsaG014220 | MsaG028669 | 0.809943 | 2.518207e-50 | 4.294432e-48 |
| MsaG015359 | MsaG028669 | 0.806504 | 1.350895e-49 | 2.121601e-47 |
| MsaG016552 | MsaG028669 | 0.830156 | 6.187564e-55 | 1.798750e-52 |
| MsaG016655 | MsaG028669 | 0.837671 | 8.312509e-57 | 3.018016e-54 |
| MsaG016767 | MsaG028669 | 0.804216 | 4.052325e-49 | 6.033041e-47 |
| MsaG018165 | MsaG028669 | 0.841355 | 9.265087e-58 | 3.774494e-55 |
| MsaG018254 | MsaG028669 | 0.842312 | 5.192666e-58 | 2.181016e-55 |
| MsaG018483 | MsaG028669 | 0.800652 | 2.181289e-48 | 2.993020e-46 |
| MsaG018500 | MsaG028669 | 0.866937 | 3.979567e-65 | 4.065705e-62 |
| MsaG018653 | MsaG028669 | 0.875852 | 4.615539e-68 | 6.894484e-65 |
| MsaG018689 | MsaG028669 | 0.827408 | 2.838901e-54 | 7.635352e-52 |
| MsaG019578 | MsaG028669 | 0.908769 | 2.859559e-81 | 2.495118e-77 |
| MsaG020532 | MsaG028669 | 0.805455 | 2.239493e-49 | 3.431240e-47 |
| MsaG020565 | MsaG028669 | 0.921888 | 5.186132e-88 | 1.121279e-83 |
| MsaG020952 | MsaG028669 | 0.894299 | 6.296818e-75 | 2.335204e-71 |
| MsaG021301 | MsaG028669 | 0.855534 | 1.145189e-61 | 7.543193e-59 |
| MsaG021314 | MsaG028669 | 0.808437 | 5.277145e-50 | 8.678552e-48 |
| MsaG021969 | MsaG028669 | 0.802218 | 1.045611e-48 | 1.486515e-46 |
| MsaG023325 | MsaG028669 | 0.849862 | 4.683087e-60 | 2.526010e-57 |
| MsaG023405 | MsaG028669 | 0.851092 | 2.121711e-60 | 1.194029e-57 |
| MsaG023741 | MsaG028669 | 0.810333 | 2.076943e-50 | 3.575887e-48 |
| MsaG023698 | MsaG028669 | 0.823981 | 1.828753e-53 | 4.474057e-51 |
| MsaG023764 | MsaG028669 | 0.849803 | 4.864329e-60 | 2.618609e-57 |
| MsaG023963 | MsaG028669 | 0.923739 | 4.669254e-89 | 1.161720e-84 |
| MsaG023939 | MsaG028669 | 0.877534 | 1.215842e-68 | 1.958991e-65 |
| MsaG024283 | MsaG028669 | 0.846725 | 3.415913e-59 | 1.657481e-56 |
| MsaG024484 | MsaG028669 | 0.806504 | 1.350895e-49 | 2.121601e-47 |
| MsaG024573 | MsaG028669 | 0.808691 | 4.659563e-50 | 7.710323e-48 |
| MsaG026598 | MsaG028669 | 0.873109 | 3.899017e-67 | 5.161773e-64 |
| MsaG026584 | MsaG028669 | 0.840970 | 1.168829e-57 | 4.704013e-55 |
| MsaG026763 | MsaG028669 | 0.900800 | 1.176796e-77 | 6.313413e-74 |
| MsaG026931 | MsaG028669 | 0.801989 | 1.164438e-48 | 1.646863e-46 |
| MsaG027149 | MsaG028669 | 0.867082 | 3.577721e-65 | 3.676475e-62 |
| MsaG027252 | MsaG028669 | 0.960933 | 1.463882e-118 | 8.067868e-113 |
| MsaG027423 | MsaG028669 | 0.833706 | 8.298718e-56 | 2.674714e-53 |
| MsaG027648 | MsaG028669 | 0.893922 | 8.949309e-75 | 3.250769e-71 |
| MsaG027858 | MsaG028669 | 0.857085 | 4.038197e-62 | 2.814480e-59 |
| MsaG027861 | MsaG028669 | 0.831178 | 3.487056e-55 | 1.043803e-52 |
| MsaG028149 | MsaG028669 | 0.839888 | 2.235499e-57 | 8.696344e-55 |
| MsaG028266 | MsaG028669 | 0.826449 | 4.801011e-54 | 1.257249e-51 |
| MsaG028669 | MsaG028881 | 0.822845 | 3.360102e-53 | 7.971571e-51 |
| MsaG028669 | MsaG029058 | 0.815185 | 1.820872e-51 | 3.536434e-49 |
| MsaG028669 | MsaG029297 | 0.815013 | 1.987284e-51 | 3.842924e-49 |
| MsaG028669 | MsaG029673 | 0.804380 | 3.746945e-49 | 5.599543e-47 |
| MsaG028669 | MsaG029846 | 0.825878 | 6.553017e-54 | 1.688981e-51 |
| MsaG028669 | MsaG029852 | 0.808071 | 6.308646e-50 | 1.028415e-47 |
| MsaG028669 | MsaG030864 | 0.856026 | 8.239278e-62 | 5.524399e-59 |
| MsaG028669 | MsaG031195 | 0.896422 | 8.473642e-76 | 3.530871e-72 |
| MsaG028669 | MsaG031845 | 0.836638 | 1.523182e-56 | 5.359071e-54 |
| MsaG028669 | MsaG033403 | 0.811375 | 1.239245e-50 | 2.188524e-48 |
| MsaG028669 | MsaG033645 | 0.927330 | 3.658010e-91 | 1.204662e-86 |
| MsaG028669 | MsaG033805 | 0.804038 | 4.411351e-49 | 6.540651e-47 |
| MsaG028669 | MsaG033823 | 0.838634 | 4.708969e-57 | 1.761454e-54 |
| MsaG028669 | MsaG034327 | 0.870723 | 2.397518e-66 | 2.864014e-63 |
| MsaG028669 | MsaG034330 | 0.826092 | 5.832069e-54 | 1.512124e-51 |
| MsaG028669 | MsaG034570 | 0.836517 | 1.634230e-56 | 5.729022e-54 |
| MsaG028669 | MsaG034745 | 0.810536 | 1.879206e-50 | 3.251401e-48 |
| MsaG028669 | MsaG035534 | 0.829649 | 8.211127e-55 | 2.352669e-52 |
| MsaG028669 | MsaG035551 | 0.849926 | 4.496416e-60 | 2.430756e-57 |
| MsaG028669 | MsaG036055 | 0.846345 | 4.332766e-59 | 2.075763e-56 |
| MsaG028669 | MsaG036126 | 0.832480 | 1.670099e-55 | 5.192467e-53 |
| MsaG028669 | MsaG038751 | 0.885462 | 1.717270e-71 | 4.022828e-68 |
| MsaG028669 | MsaG039929 | 0.850236 | 3.683336e-60 | 2.012321e-57 |
| MsaG028669 | MsaG040676 | 0.877835 | 9.562503e-69 | 1.561973e-65 |
| MsaG028669 | MsaG040834 | 0.809258 | 3.529156e-50 | 5.919512e-48 |
| MsaG028669 | MsaG041532 | 0.810327 | 2.083513e-50 | 3.586573e-48 |
| MsaG028669 | MsaG041790 | 0.834439 | 5.447772e-56 | 1.794521e-53 |
| MsaG028669 | MsaG041791 | 0.874446 | 1.386524e-67 | 1.946422e-64 |
| MsaG028669 | MsaG041792 | 0.864147 | 2.984277e-64 | 2.725293e-61 |
| MsaG028669 | MsaG041863 | 0.829254 | 1.023155e-54 | 2.898250e-52 |
| MsaG028669 | MsaG042094 | 0.861750 | 1.627445e-63 | 1.352662e-60 |
| MsaG028669 | MsaG042711 | 0.803598 | 5.439614e-49 | 7.982898e-47 |
| MsaG028669 | MsaG043809 | 0.889478 | 5.128293e-73 | 1.470904e-69 |
| MsaG028669 | MsaG043810 | 0.894916 | 3.531083e-75 | 1.353777e-71 |
| MsaG028669 | MsaG044065 | 0.905184 | 1.323480e-79 | 9.222586e-76 |
| MsaG028669 | MsaG044658 | 0.829471 | 9.068199e-55 | 2.584921e-52 |
| MsaG028669 | MsaG045049 | 0.842316 | 5.179960e-58 | 2.175985e-55 |
| MsaG028669 | MsaG045270 | 0.851691 | 1.439134e-60 | 8.269227e-58 |
| MsaG028669 | MsaG045786 | 0.882155 | 2.809904e-70 | 5.609934e-67 |
| MsaG028669 | MsaG045989 | 0.865393 | 1.220035e-64 | 1.170868e-61 |
| MsaG028669 | MsaG046060 | 0.832444 | 1.704371e-55 | 5.293586e-53 |
| MsaG028669 | MsaG046330 | 0.883757 | 7.334344e-71 | 1.581792e-67 |
| MsaG028669 | MsaG046426 | 0.805765 | 1.928916e-49 | 2.976897e-47 |
| MsaG028669 | MsaG046502 | 0.858995 | 1.099811e-62 | 8.230802e-60 |
| MsaG028669 | MsaG046652 | 0.803441 | 5.859129e-49 | 8.567606e-47 |
| MsaG028669 | MsaG046735 | 0.862073 | 1.297184e-63 | 1.091767e-60 |
| MsaG028669 | MsaG046839 | 0.935627 | 1.789065e-96 | 1.159195e-91 |
| MsaG028669 | MsaG046852 | 0.846467 | 4.016314e-59 | 1.931798e-56 |
| MsaG028669 | MsaG046909 | 0.907652 | 9.602240e-81 | 7.805471e-77 |
| MsaG028669 | MsaG046910 | 0.954325 | 1.278025e-111 | 4.079739e-106 |
| MsaG028669 | MsaG047018 | 0.846519 | 3.886903e-59 | 1.872880e-56 |
| MsaG028669 | MsaG047022 | 0.858807 | 1.250652e-62 | 9.293945e-60 |
| MsaG028669 | MsaG047066 | 0.829859 | 7.302673e-55 | 2.105001e-52 |
| MsaG028669 | MsaG001526 | 0.816105 | 1.138571e-51 | 2.263424e-49 |
| MsaG028669 | MsaG002244 | 0.879515 | 2.465700e-69 | 4.352168e-66 |
| MsaG028669 | MsaG004323 | 0.808975 | 4.053790e-50 | 6.753717e-48 |
| MsaG028669 | MsaG003533 | 0.848168 | 1.377153e-59 | 7.013526e-57 |
| MsaG028669 | MsaG002661 | 0.834812 | 4.394271e-56 | 1.463698e-53 |
| MsaG028669 | MsaG006041 | 0.841529 | 8.342857e-58 | 3.417730e-55 |
| MsaG028669 | MsaG008439 | 0.820083 | 1.448971e-52 | 3.193881e-50 |
| MsaG028669 | MsaG007339 | 0.868007 | 1.814371e-65 | 1.935921e-62 |
| MsaG028669 | MsaG009038 | 0.818204 | 3.861144e-52 | 8.101711e-50 |
| MsaG028669 | MsaG011924 | 0.815498 | 1.552895e-51 | 3.039863e-49 |
| MsaG028669 | MsaG014196 | 0.807055 | 1.034114e-49 | 1.645280e-47 |
| MsaG028669 | MsaG013731 | 0.882468 | 2.164673e-70 | 4.386687e-67 |
| MsaG028669 | MsaG013042 | 0.803626 | 5.367042e-49 | 7.881478e-47 |
| MsaG028669 | MsaG019050 | 0.924566 | 1.562431e-89 | 4.142637e-85 |
| MsaG028669 | MsaG020453 | 0.827091 | 3.378128e-54 | 9.005461e-52 |
| MsaG028669 | MsaG018938 | 0.813753 | 3.762834e-51 | 7.049508e-49 |
| MsaG028669 | MsaG027609 | 0.845206 | 8.803341e-59 | 4.061011e-56 |
| MsaG028669 | MsaG027456 | 0.820836 | 9.751954e-53 | 2.192672e-50 |
| MsaG028669 | MsaG026953 | 0.813389 | 4.521143e-51 | 8.393257e-49 |
| MsaG028669 | MsaG026814 | 0.808262 | 5.749170e-50 | 9.415157e-48 |
| MsaG028669 | MsaG033429 | 0.848646 | 1.017465e-59 | 5.265753e-57 |
| MsaG028669 | MsaG034042 | 0.890759 | 1.625206e-73 | 4.983596e-70 |
| MsaG028669 | MsaG030637 | 0.823365 | 2.544680e-53 | 6.122747e-51 |
| MsaG028669 | MsaG034688 | 0.879227 | 3.113708e-69 | 5.423726e-66 |
| MsaG028669 | MsaG031967 | 0.877730 | 1.039894e-68 | 1.690448e-65 |
| MsaG028669 | MsaG032953 | 0.891870 | 5.928614e-74 | 1.928181e-70 |
| MsaG028669 | MsaG033067 | 0.837205 | 1.093076e-56 | 3.912444e-54 |
| MsaG028669 | MsaG035307 | 0.916579 | 3.768212e-85 | 5.548784e-81 |
| MsaG028669 | MsaG036522 | 0.811788 | 1.008354e-50 | 1.798942e-48 |
| MsaG028669 | MsaG036002 | 0.802264 | 1.023174e-48 | 1.456166e-46 |
| MsaG028669 | MsaG035492 | 0.832540 | 1.613361e-55 | 5.024937e-53 |
| MsaG028669 | MsaG039594 | 0.820037 | 1.484229e-52 | 3.267654e-50 |
| MsaG028669 | MsaG044083 | 0.804171 | 4.140605e-49 | 6.157888e-47 |
| MsaG028669 | MsaG045742 | 0.883005 | 1.381697e-70 | 2.874014e-67 |
| MsaG028669 | MsaG043095 | 0.883629 | 8.169457e-71 | 1.751111e-67 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG028669 | MtrunA17_Chr5g0429931 | 85.356 | 239 | 26 | 1 | 36 | 265 | 10 | 248 | 6.35e-152 | 423 |
| MsaG028669 | MtrunA17_Chr3g0077451 | 69.295 | 241 | 54 | 3 | 35 | 265 | 10 | 240 | 1.25e-113 | 326 |
| MsaG028669 | MtrunA17_Chr3g0077411 | 64.045 | 267 | 79 | 3 | 16 | 265 | 257 | 523 | 9.06e-113 | 334 |
| MsaG028669 | MtrunA17_Chr3g0077411 | 54.135 | 266 | 86 | 5 | 1 | 253 | 1 | 243 | 1.25e-84 | 262 |
| MsaG028669 | MtrunA17_Chr3g0077431 | 67.299 | 211 | 49 | 3 | 65 | 265 | 1 | 201 | 1.39e-94 | 276 |
| MsaG028669 | MtrunA17_Chr3g0077421 | 64.762 | 210 | 53 | 3 | 65 | 263 | 1 | 200 | 4.55e-89 | 263 |
| MsaG028669 | MtrunA17_Chr3g0077441 | 64.762 | 210 | 53 | 3 | 65 | 263 | 1 | 200 | 4.55e-89 | 263 |
| MsaG028669 | MtrunA17_Chr3g0077361 | 54.682 | 267 | 88 | 4 | 1 | 256 | 20 | 264 | 8.46e-88 | 270 |
| MsaG028669 | MtrunA17_Chr3g0077361 | 52.555 | 274 | 84 | 3 | 3 | 265 | 269 | 507 | 3.17e-85 | 263 |
| MsaG028669 | MtrunA17_Chr4g0009491 | 58.667 | 225 | 83 | 3 | 3 | 217 | 206 | 430 | 2.20e-82 | 253 |
| MsaG028669 | MtrunA17_Chr4g0009491 | 50.704 | 213 | 74 | 2 | 35 | 238 | 11 | 201 | 2.54e-61 | 199 |
| MsaG028669 | MtrunA17_Chr3g0077381 | 58.716 | 218 | 87 | 2 | 3 | 217 | 228 | 445 | 8.02e-81 | 250 |
| MsaG028669 | MtrunA17_Chr3g0077381 | 48.069 | 233 | 66 | 4 | 35 | 256 | 34 | 222 | 7.52e-58 | 191 |
| MsaG028669 | MtrunA17_Chr3g0077461 | 54.000 | 250 | 93 | 8 | 16 | 257 | 232 | 467 | 8.34e-78 | 243 |
| MsaG028669 | MtrunA17_Chr3g0077461 | 49.789 | 237 | 79 | 4 | 36 | 262 | 22 | 228 | 1.07e-67 | 216 |
| MsaG028669 | MtrunA17_Chr1g0162441 | 48.485 | 99 | 51 | 0 | 21 | 119 | 7 | 105 | 7.90e-30 | 116 |
| MsaG028669 | MtrunA17_Chr3g0103171 | 28.244 | 262 | 148 | 5 | 36 | 258 | 5 | 265 | 2.68e-26 | 103 |
| MsaG028669 | MtrunA17_Chr4g0033961 | 36.025 | 161 | 97 | 2 | 18 | 173 | 3 | 162 | 3.69e-26 | 105 |
| MsaG028669 | MtrunA17_Chr3g0103181 | 28.364 | 275 | 155 | 6 | 20 | 258 | 11 | 279 | 7.23e-25 | 100 |
| MsaG028669 | MtrunA17_Chr7g0233521 | 27.985 | 268 | 148 | 7 | 37 | 262 | 2 | 266 | 1.15e-24 | 99.8 |
| MsaG028669 | MtrunA17_Chr3g0131891 | 26.644 | 289 | 166 | 6 | 20 | 262 | 18 | 306 | 1.25e-24 | 100 |
| MsaG028669 | MtrunA17_Chr1g0162411 | 48.889 | 90 | 46 | 0 | 21 | 110 | 7 | 96 | 2.80e-24 | 100 |
| MsaG028669 | MtrunA17_Chr7g0233561 | 27.070 | 314 | 169 | 8 | 7 | 262 | 4 | 315 | 5.57e-23 | 95.9 |
| MsaG028669 | MtrunA17_Chr8g0390841 | 23.569 | 297 | 165 | 6 | 21 | 259 | 39 | 331 | 7.33e-21 | 91.7 |
| MsaG028669 | MtrunA17_Chr7g0233531 | 28.253 | 269 | 146 | 8 | 37 | 262 | 2 | 266 | 3.33e-20 | 87.4 |
| MsaG028669 | MtrunA17_Chr5g0419201 | 29.697 | 165 | 105 | 2 | 21 | 185 | 16 | 169 | 3.55e-20 | 85.5 |
| MsaG028669 | MtrunA17_Chr1g0163071 | 24.913 | 289 | 148 | 6 | 37 | 259 | 2 | 287 | 6.41e-20 | 87.0 |
| MsaG028669 | MtrunA17_Chr7g0233571 | 33.571 | 140 | 81 | 1 | 13 | 140 | 2 | 141 | 6.55e-20 | 85.5 |
| MsaG028669 | MtrunA17_Chr7g0233541 | 25.965 | 285 | 149 | 7 | 37 | 262 | 2 | 283 | 1.67e-19 | 85.9 |
| MsaG028669 | MtrunA17_Chr1g0154161 | 23.404 | 282 | 169 | 6 | 20 | 258 | 29 | 306 | 8.74e-19 | 84.3 |
| MsaG028669 | MtrunA17_Chr1g0208771 | 24.199 | 281 | 156 | 8 | 36 | 260 | 12 | 291 | 9.77e-19 | 85.1 |
| MsaG028669 | MtrunA17_Chr3g0103151 | 40.000 | 100 | 58 | 1 | 20 | 119 | 11 | 108 | 6.66e-18 | 78.6 |
| MsaG028669 | MtrunA17_Chr1g0162421 | 50.000 | 58 | 29 | 0 | 35 | 92 | 7 | 64 | 7.56e-18 | 75.5 |
| MsaG028669 | MtrunA17_Chr3g0103191 | 29.469 | 207 | 113 | 4 | 21 | 199 | 12 | 213 | 9.45e-18 | 80.1 |
| MsaG028669 | MtrunA17_Chr1g0163221 | 25.685 | 292 | 169 | 9 | 12 | 258 | 2 | 290 | 5.78e-17 | 79.3 |
| MsaG028669 | MtrunA17_Chr5g0421921 | 39.623 | 106 | 54 | 2 | 167 | 263 | 8 | 112 | 4.32e-16 | 72.4 |
| MsaG028669 | MtrunA17_Chr5g0421731 | 39.623 | 106 | 54 | 2 | 167 | 263 | 8 | 112 | 4.32e-16 | 72.4 |
| MsaG028669 | MtrunA17_Chr5g0421851 | 39.623 | 106 | 54 | 2 | 167 | 263 | 83 | 187 | 4.23e-15 | 71.6 |
| MsaG028669 | MtrunA17_Chr6g0467351 | 31.655 | 139 | 91 | 2 | 20 | 154 | 14 | 152 | 7.49e-15 | 72.0 |
| MsaG028669 | MtrunA17_Chr4g0067431 | 24.917 | 301 | 161 | 8 | 20 | 258 | 14 | 311 | 1.72e-14 | 72.0 |
| MsaG028669 | MtrunA17_Chr3g0103201 | 25.339 | 221 | 118 | 6 | 80 | 258 | 5 | 220 | 6.88e-13 | 66.2 |
| MsaG028669 | MtrunA17_Chr1g0154041 | 30.928 | 97 | 66 | 1 | 20 | 116 | 15 | 110 | 1.68e-12 | 67.0 |
| MsaG028669 | MtrunA17_Chr1g0163061 | 30.769 | 130 | 80 | 2 | 20 | 139 | 14 | 143 | 3.67e-12 | 65.1 |
| MsaG028669 | MtrunA17_Chr1g0163251 | 21.691 | 272 | 170 | 8 | 30 | 261 | 14 | 282 | 3.76e-12 | 65.9 |
| MsaG028669 | MtrunA17_Chr1g0154101 | 31.579 | 95 | 65 | 0 | 20 | 114 | 24 | 118 | 1.14e-11 | 64.7 |
| MsaG028669 | MtrunA17_Chr1g0154101 | 34.737 | 95 | 60 | 2 | 20 | 114 | 183 | 275 | 2.41e-11 | 63.5 |
| MsaG028669 | MtrunA17_Chr1g0154191 | 33.684 | 95 | 63 | 0 | 20 | 114 | 21 | 115 | 4.56e-11 | 62.4 |
| MsaG028669 | MtrunA17_Chr1g0154171 | 36.709 | 79 | 50 | 0 | 33 | 111 | 34 | 112 | 5.68e-11 | 62.0 |
| MsaG028669 | MtrunA17_Chr1g0154071 | 33.684 | 95 | 62 | 1 | 20 | 114 | 27 | 120 | 7.87e-11 | 62.0 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG028669 | AT3G18990.1 | 48.485 | 99 | 51 | 0 | 21 | 119 | 6 | 104 | 4.93e-26 | 104 |
| MsaG028669 | AT3G18990.2 | 48.485 | 99 | 51 | 0 | 21 | 119 | 6 | 104 | 7.93e-26 | 104 |
| MsaG028669 | AT4G01580.1 | 37.302 | 126 | 71 | 1 | 4 | 121 | 5 | 130 | 1.04e-19 | 84.7 |
| MsaG028669 | AT3G18960.2 | 38.835 | 103 | 63 | 0 | 19 | 121 | 28 | 130 | 3.64e-18 | 80.5 |
| MsaG028669 | AT3G18960.1 | 38.835 | 103 | 63 | 0 | 19 | 121 | 28 | 130 | 5.61e-18 | 80.5 |
| MsaG028669 | AT1G49475.1 | 37.037 | 135 | 75 | 2 | 4 | 129 | 8 | 141 | 1.30e-17 | 79.0 |
| MsaG028669 | AT3G18960.3 | 38.636 | 88 | 54 | 0 | 34 | 121 | 6 | 93 | 2.28e-13 | 67.0 |
| MsaG028669 | AT4G31690.1 | 25.000 | 236 | 156 | 7 | 19 | 248 | 12 | 232 | 2.22e-12 | 65.9 |
| MsaG028669 | AT4G31640.1 | 23.846 | 260 | 152 | 9 | 18 | 259 | 11 | 242 | 6.09e-11 | 62.4 |
Find 51 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| ACTGCCCTCCATGAGAATTT+TGG | 0.201758 | 5:+66822629 | None:intergenic |
| AGTGAAGCTTACTATTTCTT+TGG | 0.240401 | 5:+66824452 | None:intergenic |
| GATGAATTTATATCAAGATT+TGG | 0.269670 | 5:-66823213 | MsaT028669.1:CDS |
| CAACGAAAATAAGGGTTGTT+TGG | 0.270085 | 5:+66822811 | None:intergenic |
| TACTATTTCTTTGGAATGAA+TGG | 0.303913 | 5:+66824461 | None:intergenic |
| AGATGGTCGTGTCTGGAAAA+TGG | 0.306967 | 5:-66823154 | MsaT028669.1:CDS |
| TTATAGGAACATTTGGCTTC+AGG | 0.316899 | 5:+66822656 | None:intergenic |
| ATGAATTTATATCAAGATTT+GGG | 0.336114 | 5:-66823212 | MsaT028669.1:CDS |
| CCTTCTCCGCCGCTGATGTC+TGG | 0.353245 | 5:+66824520 | None:intergenic |
| ATGAATGGGTGAGGGAAGTA+TGG | 0.359095 | 5:+66824476 | None:intergenic |
| TCCCTTCATATTTGAAAGAA+AGG | 0.361097 | 5:+66823046 | None:intergenic |
| ATTATCCTAGTTCTAGAAAA+AGG | 0.363374 | 5:-66822930 | MsaT028669.1:CDS |
| TGGAGCTTTATAGGAACATT+TGG | 0.363518 | 5:+66822649 | None:intergenic |
| AACGAAAATAAGGGTTGTTT+GGG | 0.366185 | 5:+66822812 | None:intergenic |
| GAATACTATTCTATAGGATA+TGG | 0.373789 | 5:-66823075 | MsaT028669.1:CDS |
| ATGTGAGAGGCGTGGGAAAA+AGG | 0.385584 | 5:-66822893 | MsaT028669.1:CDS |
| TTCCTTTCTTTCAAATATGA+AGG | 0.389522 | 5:-66823048 | MsaT028669.1:CDS |
| AATCTTGATATAAATTCATC+TGG | 0.413169 | 5:+66823216 | None:intergenic |
| CTGTTCCAGATGGTCGTGTC+TGG | 0.416931 | 5:-66823161 | MsaT028669.1:CDS |
| GTTGTTTGGGTTGAGTTCCT+TGG | 0.432159 | 5:+66822825 | None:intergenic |
| ACTATTTCTTTGGAATGAAT+GGG | 0.437997 | 5:+66824462 | None:intergenic |
| TTTGTAGAATACTATTCTAT+AGG | 0.438154 | 5:-66823081 | MsaT028669.1:CDS |
| GGAGGGCAGTGGGAAGTGTT+TGG | 0.442028 | 5:-66822616 | MsaT028669.1:CDS |
| TTCTTTGGAATGAATGGGTG+AGG | 0.464859 | 5:+66824467 | None:intergenic |
| CCTCTCACATGTTTCAACCT+TGG | 0.481695 | 5:+66822906 | None:intergenic |
| CCAGACATCAGCGGCGGAGA+AGG | 0.489663 | 5:-66824520 | MsaT028669.1:CDS |
| ATAAAGCTCCAAAATTCTCA+TGG | 0.500218 | 5:-66822637 | MsaT028669.1:CDS |
| AAAATTCTCATGGAGGGCAG+TGG | 0.508854 | 5:-66822627 | MsaT028669.1:CDS |
| TCCTTTCTTTCAAATATGAA+GGG | 0.512330 | 5:-66823047 | MsaT028669.1:CDS |
| TTGCAACAATGCAGCCTCGC+CGG | 0.517685 | 5:-66824554 | None:intergenic |
| TTCAAAACTTCAAGTACTAA+CGG | 0.531313 | 5:-66822967 | MsaT028669.1:CDS |
| TCTTTGGAATGAATGGGTGA+GGG | 0.542125 | 5:+66824468 | None:intergenic |
| TTGAAACATGTGAGAGGCGT+GGG | 0.548958 | 5:-66822900 | MsaT028669.1:CDS |
| TTTCGTTGCAAAATCGTCAA+GGG | 0.551442 | 5:-66822796 | MsaT028669.1:CDS |
| AGCTCCAAAATTCTCATGGA+GGG | 0.568287 | 5:-66822633 | MsaT028669.1:CDS |
| AAGAGTAGAGAATGCTGCCA+AGG | 0.581714 | 5:-66822842 | MsaT028669.1:CDS |
| AAATTCTCATGGAGGGCAGT+GGG | 0.584828 | 5:-66822626 | MsaT028669.1:CDS |
| ATCAGCAATGCAAATAGTGA+GGG | 0.596191 | 5:-66822572 | MsaT028669.1:CDS |
| GTTGAAACATGTGAGAGGCG+TGG | 0.612877 | 5:-66822901 | MsaT028669.1:CDS |
| GCTACAATTACTGTTCCAGA+TGG | 0.621864 | 5:-66823171 | MsaT028669.1:CDS |
| ATGTCTGGACACACTTTCGC+CGG | 0.627588 | 5:+66824535 | None:intergenic |
| CATCAGCAATGCAAATAGTG+AGG | 0.629339 | 5:-66822573 | MsaT028669.1:CDS |
| TGGACACACTTTCGCCGGCG+AGG | 0.634315 | 5:+66824540 | None:intergenic |
| AAGCTCCAAAATTCTCATGG+AGG | 0.639241 | 5:-66822634 | MsaT028669.1:CDS |
| GTGTGTTTGAGCTGATCAAG+AGG | 0.642202 | 5:-66822501 | MsaT028669.1:CDS |
| AGGGACAACAAACTGTCACA+TGG | 0.650637 | 5:-66822532 | MsaT028669.1:CDS |
| CCAAGGTTGAAACATGTGAG+AGG | 0.654125 | 5:-66822906 | MsaT028669.1:CDS |
| GTGTGTCCAGACATCAGCGG+CGG | 0.681356 | 5:-66824526 | MsaT028669.1:CDS |
| AATCGTCAAGGGAAAATATG+CGG | 0.692781 | 5:-66822785 | MsaT028669.1:intron |
| TCAGCAATGCAAATAGTGAG+GGG | 0.699768 | 5:-66822571 | MsaT028669.1:CDS |
| AAAGTGTGTCCAGACATCAG+CGG | 0.761993 | 5:-66824529 | MsaT028669.1:CDS |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| Chr5 | gene | 66822447 | 66824568 | 66822447 | ID=MsaG028669 |
| Chr5 | mRNA | 66822447 | 66824568 | 66822447 | ID=MsaT028669.1;Parent=MsaG028669 |
| Chr5 | exon | 66822447 | 66822680 | 66822447 | ID=MsaT028669.1.exon3;Parent=MsaT028669.1 |
| Chr5 | CDS | 66822447 | 66822680 | 66822447 | ID=cds.MsaT028669.1;Parent=MsaT028669.1 |
| Chr5 | exon | 66822786 | 66823244 | 66822786 | ID=MsaT028669.1.exon2;Parent=MsaT028669.1 |
| Chr5 | CDS | 66822786 | 66823244 | 66822786 | ID=cds.MsaT028669.1;Parent=MsaT028669.1 |
| Chr5 | exon | 66824464 | 66824568 | 66824464 | ID=MsaT028669.1.exon1;Parent=MsaT028669.1 |
| Chr5 | CDS | 66824464 | 66824568 | 66824464 | ID=cds.MsaT028669.1;Parent=MsaT028669.1 |
| Gene Sequence |
| Protein sequence |