Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG028847 | KHN31315.1 | 84.615 | 52 | 8 | 0 | 2 | 53 | 164 | 215 | 1.80e-18 | 87.8 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG028847 | sp|C0LGP9|IMK3_ARATH | 73.077 | 52 | 14 | 0 | 2 | 53 | 611 | 662 | 7.99e-17 | 75.9 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG028847 | tr|A0A072UGN2|A0A072UGN2_MEDTR | 77.049 | 61 | 14 | 0 | 2 | 62 | 621 | 681 | 1.03e-18 | 88.6 |
| Gene ID | Type | Classification |
|---|
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG028847 | MtrunA17_Chr5g0437741 | 77.049 | 61 | 14 | 0 | 2 | 62 | 618 | 678 | 2.09e-22 | 88.6 |
| MsaG028847 | MtrunA17_Chr5g0437731 | 70.492 | 61 | 18 | 0 | 2 | 62 | 50 | 110 | 3.19e-21 | 80.5 |
| MsaG028847 | MtrunA17_Chr4g0005201 | 68.750 | 48 | 15 | 0 | 2 | 49 | 626 | 673 | 2.17e-16 | 71.6 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG028847 | AT3G51740.1 | 61.017 | 59 | 23 | 0 | 4 | 62 | 662 | 720 | 5.82e-16 | 70.9 |
Find 10 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| TGAGATTGCTTGGCAATTTA+TGG | 0.131646 | 5:+69665503 | None:intergenic |
| AATGCTAAAATAGCAGATTT+TGG | 0.278097 | 5:-69665649 | MsaT028847.1:CDS |
| CAACACATTGTTTGAAGTAA+AGG | 0.376582 | 5:+69665687 | None:intergenic |
| ATTGCTACTGCCGGAGCATT+GGG | 0.448207 | 5:-69665586 | MsaT028847.1:CDS |
| GATTGCTACTGCCGGAGCAT+TGG | 0.493034 | 5:-69665587 | MsaT028847.1:CDS |
| GGCAGGCTATGCAGAGAAGA+AGG | 0.502464 | 5:+69665547 | None:intergenic |
| GAGAAGAAGGCTGCTGTGCT+CGG | 0.535485 | 5:+69665560 | None:intergenic |
| TGATGTTATATGAGATTGCT+TGG | 0.547089 | 5:+69665493 | None:intergenic |
| TGCTCGGTATCCCAATGCTC+CGG | 0.551476 | 5:+69665576 | None:intergenic |
| TCTAATGTGATTGCTACTGC+CGG | 0.594704 | 5:-69665595 | MsaT028847.1:CDS |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| Chr5 | gene | 69665498 | 69665716 | 69665498 | ID=MsaG028847 |
| Chr5 | mRNA | 69665498 | 69665716 | 69665498 | ID=MsaT028847.1;Parent=MsaG028847 |
| Chr5 | exon | 69665498 | 69665716 | 69665498 | ID=MsaT028847.1.exon1;Parent=MsaT028847.1 |
| Chr5 | CDS | 69665498 | 69665716 | 69665498 | ID=cds.MsaT028847.1;Parent=MsaT028847.1 |
| Gene Sequence |
| Protein sequence |
