Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG029086 | GAU21615.1 | 75.439 | 513 | 61 | 8 | 1 | 505 | 1 | 456 | 0.0 | 736 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG029086 | sp|O24606|EIN3_ARATH | 61.508 | 252 | 79 | 5 | 2 | 243 | 1 | 244 | 9.62e-91 | 293 |
MsaG029086 | sp|O24606|EIN3_ARATH | 39.601 | 351 | 171 | 15 | 172 | 505 | 301 | 627 | 4.17e-54 | 195 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG029086 | tr|A0A2Z6MFD7|A0A2Z6MFD7_TRISU | 75.439 | 513 | 61 | 8 | 1 | 505 | 1 | 456 | 0.0 | 736 |
Gene ID | Type | Classification |
---|---|---|
MsaG029086 | TF | EIL |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000004 | MsaG029086 | 0.849462 | 6.048232e-60 | 3.218787e-57 |
MsaG000210 | MsaG029086 | 0.833780 | 7.956094e-56 | 2.569742e-53 |
MsaG000170 | MsaG029086 | 0.824130 | 1.687497e-53 | 4.145335e-51 |
MsaG000326 | MsaG029086 | 0.808045 | 6.391261e-50 | 1.041228e-47 |
MsaG000431 | MsaG029086 | 0.835540 | 2.884096e-56 | 9.818432e-54 |
MsaG000456 | MsaG029086 | 0.827980 | 2.072346e-54 | 5.663908e-52 |
MsaG000519 | MsaG029086 | 0.827264 | 3.073140e-54 | 8.232074e-52 |
MsaG000532 | MsaG029086 | 0.805061 | 2.705213e-49 | 4.107122e-47 |
MsaG000646 | MsaG029086 | 0.882794 | 1.648684e-70 | 3.394569e-67 |
MsaG000687 | MsaG029086 | 0.821008 | 8.906984e-53 | 2.011994e-50 |
MsaG000832 | MsaG029086 | 0.807536 | 8.188485e-50 | 1.317790e-47 |
MsaG000855 | MsaG029086 | 0.834562 | 5.076450e-56 | 1.678282e-53 |
MsaG001029 | MsaG029086 | 0.829020 | 1.165253e-54 | 3.279091e-52 |
MsaG001084 | MsaG029086 | 0.811445 | 1.196416e-50 | 2.116565e-48 |
MsaG001171 | MsaG029086 | 0.811103 | 1.418478e-50 | 2.488459e-48 |
MsaG001237 | MsaG029086 | 0.811521 | 1.151971e-50 | 2.041724e-48 |
MsaG001248 | MsaG029086 | 0.803966 | 4.565210e-49 | 6.757231e-47 |
MsaG001258 | MsaG029086 | 0.888795 | 9.406149e-73 | 2.603884e-69 |
MsaG001479 | MsaG029086 | 0.890005 | 3.200552e-73 | 9.434301e-70 |
MsaG001542 | MsaG029086 | 0.815029 | 1.971150e-51 | 3.813195e-49 |
MsaG001672 | MsaG029086 | 0.810102 | 2.328332e-50 | 3.986022e-48 |
MsaG002015 | MsaG029086 | 0.825345 | 8.752361e-54 | 2.222723e-51 |
MsaG002273 | MsaG029086 | 0.800867 | 1.971797e-48 | 2.718665e-46 |
MsaG002277 | MsaG029086 | 0.841463 | 8.684236e-58 | 3.550122e-55 |
MsaG002715 | MsaG029086 | 0.801715 | 1.324838e-48 | 1.862072e-46 |
MsaG002866 | MsaG029086 | 0.830636 | 4.727979e-55 | 1.393351e-52 |
MsaG003210 | MsaG029086 | 0.809543 | 3.067558e-50 | 5.181163e-48 |
MsaG003214 | MsaG029086 | 0.804177 | 4.128010e-49 | 6.140092e-47 |
MsaG003389 | MsaG029086 | 0.831331 | 3.198344e-55 | 9.616720e-53 |
MsaG003394 | MsaG029086 | 0.807773 | 7.297458e-50 | 1.181103e-47 |
MsaG003468 | MsaG029086 | 0.818531 | 3.257630e-52 | 6.893460e-50 |
MsaG003513 | MsaG029086 | 0.804488 | 3.559078e-49 | 5.332012e-47 |
MsaG003514 | MsaG029086 | 0.807950 | 6.692515e-50 | 1.087823e-47 |
MsaG004040 | MsaG029086 | 0.834369 | 5.672633e-56 | 1.864677e-53 |
MsaG004181 | MsaG029086 | 0.824957 | 1.080398e-53 | 2.714526e-51 |
MsaG004319 | MsaG029086 | 0.853019 | 6.052357e-61 | 3.644183e-58 |
MsaG004373 | MsaG029086 | 0.826724 | 4.130842e-54 | 1.090007e-51 |
MsaG004401 | MsaG029086 | 0.808523 | 5.059019e-50 | 8.337216e-48 |
MsaG004468 | MsaG029086 | 0.827345 | 2.938224e-54 | 7.888582e-52 |
MsaG004555 | MsaG029086 | 0.843827 | 2.059534e-58 | 9.080819e-56 |
MsaG004621 | MsaG029086 | 0.800281 | 2.593192e-48 | 3.528396e-46 |
MsaG004715 | MsaG029086 | 0.828833 | 1.293123e-54 | 3.619690e-52 |
MsaG004858 | MsaG029086 | 0.845402 | 7.792392e-59 | 3.618364e-56 |
MsaG004890 | MsaG029086 | 0.825263 | 9.154020e-54 | 2.319350e-51 |
MsaG004958 | MsaG029086 | 0.805164 | 2.575595e-49 | 3.919695e-47 |
MsaG005027 | MsaG029086 | 0.802661 | 8.481292e-49 | 1.218113e-46 |
MsaG005154 | MsaG029086 | 0.825200 | 9.471889e-54 | 2.395750e-51 |
MsaG005202 | MsaG029086 | 0.856093 | 7.877578e-62 | 5.295105e-59 |
MsaG005205 | MsaG029086 | 0.840369 | 1.676064e-57 | 6.619467e-55 |
MsaG005283 | MsaG029086 | 0.841336 | 9.372778e-58 | 3.816064e-55 |
MsaG005384 | MsaG029086 | 0.820492 | 1.168973e-52 | 2.604661e-50 |
MsaG005435 | MsaG029086 | 0.841219 | 1.005919e-57 | 4.080580e-55 |
MsaG005438 | MsaG029086 | 0.848638 | 1.022155e-59 | 5.288828e-57 |
MsaG005477 | MsaG029086 | 0.812325 | 7.712722e-51 | 1.394288e-48 |
MsaG005680 | MsaG029086 | 0.928775 | 4.843735e-92 | 1.787962e-87 |
MsaG005683 | MsaG029086 | 0.855873 | 9.130905e-62 | 6.087909e-59 |
MsaG005635 | MsaG029086 | 0.801925 | 1.200152e-48 | 1.694914e-46 |
MsaG005809 | MsaG029086 | 0.812669 | 6.493157e-51 | 1.183885e-48 |
MsaG005991 | MsaG029086 | 0.820318 | 1.280758e-52 | 2.840838e-50 |
MsaG006023 | MsaG029086 | 0.817856 | 4.622576e-52 | 9.612617e-50 |
MsaG005958 | MsaG029086 | 0.843544 | 2.450590e-58 | 1.070808e-55 |
MsaG005966 | MsaG029086 | 0.877784 | 9.961861e-69 | 1.623363e-65 |
MsaG006051 | MsaG029086 | 0.864488 | 2.339538e-64 | 2.165525e-61 |
MsaG006074 | MsaG029086 | 0.809499 | 3.134123e-50 | 5.288108e-48 |
MsaG006121 | MsaG029086 | 0.825111 | 9.936454e-54 | 2.507199e-51 |
MsaG006203 | MsaG029086 | 0.810077 | 2.357881e-50 | 4.034092e-48 |
MsaG006248 | MsaG029086 | 0.855623 | 1.078943e-61 | 7.129698e-59 |
MsaG006255 | MsaG029086 | 0.837781 | 7.792261e-57 | 2.838702e-54 |
MsaG006269 | MsaG029086 | 0.854526 | 2.240065e-61 | 1.422914e-58 |
MsaG006274 | MsaG029086 | 0.817653 | 5.134530e-52 | 1.062113e-49 |
MsaG006261 | MsaG029086 | 0.830342 | 5.574668e-55 | 1.629214e-52 |
MsaG006500 | MsaG029086 | 0.807800 | 7.199376e-50 | 1.166005e-47 |
MsaG006601 | MsaG029086 | 0.862207 | 1.180448e-63 | 9.986937e-61 |
MsaG006604 | MsaG029086 | 0.839138 | 3.493907e-57 | 1.327573e-54 |
MsaG006777 | MsaG029086 | 0.848533 | 1.093026e-59 | 5.634769e-57 |
MsaG006902 | MsaG029086 | 0.810540 | 1.875557e-50 | 3.245398e-48 |
MsaG007066 | MsaG029086 | 0.800072 | 2.858310e-48 | 3.870947e-46 |
MsaG007145 | MsaG029086 | 0.812754 | 6.220331e-51 | 1.136585e-48 |
MsaG007168 | MsaG029086 | 0.800254 | 2.625843e-48 | 3.570669e-46 |
MsaG007183 | MsaG029086 | 0.810621 | 1.801561e-50 | 3.123486e-48 |
MsaG007322 | MsaG029086 | 0.847853 | 1.681043e-59 | 8.471827e-57 |
MsaG007328 | MsaG029086 | 0.843932 | 1.931270e-58 | 8.544004e-56 |
MsaG007387 | MsaG029086 | 0.809083 | 3.846159e-50 | 6.424374e-48 |
MsaG007555 | MsaG029086 | 0.832932 | 1.291304e-55 | 4.068221e-53 |
MsaG007569 | MsaG029086 | 0.834923 | 4.121297e-56 | 1.377328e-53 |
MsaG007846 | MsaG029086 | 0.806489 | 1.360536e-49 | 2.136000e-47 |
MsaG007716 | MsaG029086 | 0.835232 | 3.447298e-56 | 1.162712e-53 |
MsaG007729 | MsaG029086 | 0.812685 | 6.439123e-51 | 1.174555e-48 |
MsaG007744 | MsaG029086 | 0.811014 | 1.482224e-50 | 2.594613e-48 |
MsaG007833 | MsaG029086 | 0.824795 | 1.178971e-53 | 2.949073e-51 |
MsaG008017 | MsaG029086 | 0.816562 | 9.006183e-52 | 1.811444e-49 |
MsaG008197 | MsaG029086 | 0.803408 | 5.952432e-49 | 8.697311e-47 |
MsaG008222 | MsaG029086 | 0.838264 | 5.861241e-57 | 2.167269e-54 |
MsaG008461 | MsaG029086 | 0.804118 | 4.246054e-49 | 6.307091e-47 |
MsaG008433 | MsaG029086 | 0.929586 | 1.527713e-92 | 6.005742e-88 |
MsaG008552 | MsaG029086 | 0.805275 | 2.441012e-49 | 3.724404e-47 |
MsaG008970 | MsaG029086 | 0.825026 | 1.040694e-53 | 2.619788e-51 |
MsaG008962 | MsaG029086 | 0.850231 | 3.695980e-60 | 2.018872e-57 |
MsaG008969 | MsaG029086 | 0.841570 | 8.140521e-58 | 3.339225e-55 |
MsaG008975 | MsaG029086 | 0.824013 | 1.796714e-53 | 4.399789e-51 |
MsaG008996 | MsaG029086 | 0.841791 | 7.122877e-58 | 2.942269e-55 |
MsaG009100 | MsaG029086 | 0.807537 | 8.185838e-50 | 1.317382e-47 |
MsaG009102 | MsaG029086 | 0.820846 | 9.703524e-53 | 2.182322e-50 |
MsaG009095 | MsaG029086 | 0.885783 | 1.303684e-71 | 3.103595e-68 |
MsaG009212 | MsaG029086 | 0.817896 | 4.529240e-52 | 9.428130e-50 |
MsaG009346 | MsaG029086 | 0.813399 | 4.497703e-51 | 8.351779e-49 |
MsaG010031 | MsaG029086 | 0.806743 | 1.203156e-49 | 1.900278e-47 |
MsaG010066 | MsaG029086 | 0.855218 | 1.414222e-61 | 9.208136e-59 |
MsaG010266 | MsaG029086 | 0.832768 | 1.417297e-55 | 4.443799e-53 |
MsaG010394 | MsaG029086 | 0.820125 | 1.417274e-52 | 3.127532e-50 |
MsaG010460 | MsaG029086 | 0.859568 | 7.416140e-63 | 5.671867e-60 |
MsaG010517 | MsaG029086 | 0.848740 | 9.579321e-60 | 4.973503e-57 |
MsaG011275 | MsaG029086 | 0.803578 | 5.491777e-49 | 8.055791e-47 |
MsaG011287 | MsaG029086 | 0.834177 | 6.332926e-56 | 2.069653e-53 |
MsaG011441 | MsaG029086 | 0.841270 | 9.755777e-58 | 3.963774e-55 |
MsaG011584 | MsaG029086 | 0.857632 | 2.787618e-62 | 1.982607e-59 |
MsaG011599 | MsaG029086 | 0.866771 | 4.492488e-65 | 4.558233e-62 |
MsaG012120 | MsaG029086 | 0.848588 | 1.055087e-59 | 5.449566e-57 |
MsaG012190 | MsaG029086 | 0.846521 | 3.882313e-59 | 1.870799e-56 |
MsaG012424 | MsaG029086 | 0.815403 | 1.629861e-51 | 3.182988e-49 |
MsaG012426 | MsaG029086 | 0.801513 | 1.457156e-48 | 2.038633e-46 |
MsaG012428 | MsaG029086 | 0.838266 | 5.853126e-57 | 2.164407e-54 |
MsaG012522 | MsaG029086 | 0.810737 | 1.700726e-50 | 2.957012e-48 |
MsaG013085 | MsaG029086 | 0.812956 | 5.620990e-51 | 1.032245e-48 |
MsaG013658 | MsaG029086 | 0.820576 | 1.118376e-52 | 2.497470e-50 |
MsaG013993 | MsaG029086 | 0.815959 | 1.226935e-51 | 2.430137e-49 |
MsaG014075 | MsaG029086 | 0.803404 | 5.965407e-49 | 8.715444e-47 |
MsaG014184 | MsaG029086 | 0.802937 | 7.441494e-49 | 1.075558e-46 |
MsaG014856 | MsaG029086 | 0.822434 | 4.182296e-53 | 9.812684e-51 |
MsaG014885 | MsaG029086 | 0.800049 | 2.888875e-48 | 3.910322e-46 |
MsaG014893 | MsaG029086 | 0.812068 | 8.769633e-51 | 1.575276e-48 |
MsaG014926 | MsaG029086 | 0.816322 | 1.018554e-51 | 2.036164e-49 |
MsaG014927 | MsaG029086 | 0.827595 | 2.562103e-54 | 6.927315e-52 |
MsaG015148 | MsaG029086 | 0.802321 | 9.960052e-49 | 1.419415e-46 |
MsaG015267 | MsaG029086 | 0.822117 | 4.952396e-53 | 1.152082e-50 |
MsaG015269 | MsaG029086 | 0.818920 | 2.661913e-52 | 5.690293e-50 |
MsaG015496 | MsaG029086 | 0.809014 | 3.978291e-50 | 6.634080e-48 |
MsaG015705 | MsaG029086 | 0.804784 | 3.089086e-49 | 4.659784e-47 |
MsaG015707 | MsaG029086 | 0.810869 | 1.593309e-50 | 2.779108e-48 |
MsaG015828 | MsaG029086 | 0.814504 | 2.573384e-51 | 4.912769e-49 |
MsaG015978 | MsaG029086 | 0.829812 | 7.497909e-55 | 2.158257e-52 |
MsaG016149 | MsaG029086 | 0.813538 | 4.193614e-51 | 7.814292e-49 |
MsaG016265 | MsaG029086 | 0.811409 | 1.218158e-50 | 2.153112e-48 |
MsaG016708 | MsaG029086 | 0.829839 | 7.388270e-55 | 2.128380e-52 |
MsaG017058 | MsaG029086 | 0.821372 | 7.346692e-53 | 1.675555e-50 |
MsaG017050 | MsaG029086 | 0.850443 | 3.224456e-60 | 1.774326e-57 |
MsaG017081 | MsaG029086 | 0.844314 | 1.527004e-58 | 6.840889e-56 |
MsaG017095 | MsaG029086 | 0.801086 | 1.780071e-48 | 2.466418e-46 |
MsaG017128 | MsaG029086 | 0.812036 | 8.910281e-51 | 1.599336e-48 |
MsaG017299 | MsaG029086 | 0.822312 | 4.463737e-53 | 1.043893e-50 |
MsaG017173 | MsaG029086 | 0.827546 | 2.631551e-54 | 7.105322e-52 |
MsaG017189 | MsaG029086 | 0.801877 | 1.227893e-48 | 1.732190e-46 |
MsaG017258 | MsaG029086 | 0.821915 | 5.511889e-53 | 1.275325e-50 |
MsaG017287 | MsaG029086 | 0.823144 | 2.864143e-53 | 6.850040e-51 |
MsaG017505 | MsaG029086 | 0.809958 | 2.500536e-50 | 4.265802e-48 |
MsaG017702 | MsaG029086 | 0.840229 | 1.823182e-57 | 7.168339e-55 |
MsaG018085 | MsaG029086 | 0.818875 | 2.725066e-52 | 5.818298e-50 |
MsaG018218 | MsaG029086 | 0.868040 | 1.770497e-65 | 1.891784e-62 |
MsaG018248 | MsaG029086 | 0.820193 | 1.367609e-52 | 3.023471e-50 |
MsaG018341 | MsaG029086 | 0.817768 | 4.838235e-52 | 1.003829e-49 |
MsaG018343 | MsaG029086 | 0.811985 | 9.140597e-51 | 1.638630e-48 |
MsaG018498 | MsaG029086 | 0.877206 | 1.579709e-68 | 2.507308e-65 |
MsaG018666 | MsaG029086 | 0.819328 | 2.151307e-52 | 4.648554e-50 |
MsaG018822 | MsaG029086 | 0.856331 | 6.710923e-62 | 4.550727e-59 |
MsaG018773 | MsaG029086 | 0.808351 | 5.504112e-50 | 9.032877e-48 |
MsaG018791 | MsaG029086 | 0.849834 | 4.768167e-60 | 2.569596e-57 |
MsaG018834 | MsaG029086 | 0.864751 | 1.937252e-64 | 1.812071e-61 |
MsaG019140 | MsaG029086 | 0.836187 | 1.981268e-56 | 6.876966e-54 |
MsaG019137 | MsaG029086 | 0.825319 | 8.876780e-54 | 2.252685e-51 |
MsaG019179 | MsaG029086 | 0.815284 | 1.731912e-51 | 3.372050e-49 |
MsaG019409 | MsaG029086 | 0.837764 | 7.868787e-57 | 2.865103e-54 |
MsaG019577 | MsaG029086 | 0.821680 | 6.243430e-53 | 1.435617e-50 |
MsaG019663 | MsaG029086 | 0.804909 | 2.909361e-49 | 4.401493e-47 |
MsaG019731 | MsaG029086 | 0.872380 | 6.819753e-67 | 8.746956e-64 |
MsaG019911 | MsaG029086 | 0.819140 | 2.372627e-52 | 5.101486e-50 |
MsaG019925 | MsaG029086 | 0.824848 | 1.145734e-53 | 2.870130e-51 |
MsaG019924 | MsaG029086 | 0.801010 | 1.844045e-48 | 2.550746e-46 |
MsaG019930 | MsaG029086 | 0.808107 | 6.200627e-50 | 1.011662e-47 |
MsaG019977 | MsaG029086 | 0.832040 | 2.142796e-55 | 6.578166e-53 |
MsaG020033 | MsaG029086 | 0.830583 | 4.870743e-55 | 1.433235e-52 |
MsaG020020 | MsaG029086 | 0.828098 | 1.941622e-54 | 5.324195e-52 |
MsaG020395 | MsaG029086 | 0.821676 | 6.255603e-53 | 1.438262e-50 |
MsaG020580 | MsaG029086 | 0.866423 | 5.786557e-65 | 5.787722e-62 |
MsaG020812 | MsaG029086 | 0.848514 | 1.106398e-59 | 5.699877e-57 |
MsaG020843 | MsaG029086 | 0.843978 | 1.877082e-58 | 8.316344e-56 |
MsaG020846 | MsaG029086 | 0.814600 | 2.451670e-51 | 4.691559e-49 |
MsaG020874 | MsaG029086 | 0.828562 | 1.502325e-54 | 4.173662e-52 |
MsaG020875 | MsaG029086 | 0.814943 | 2.060089e-51 | 3.976553e-49 |
MsaG021012 | MsaG029086 | 0.816836 | 7.824670e-52 | 1.584915e-49 |
MsaG021043 | MsaG029086 | 0.864552 | 2.234893e-64 | 2.073923e-61 |
MsaG021448 | MsaG029086 | 0.833822 | 7.764104e-56 | 2.510806e-53 |
MsaG021590 | MsaG029086 | 0.810869 | 1.592819e-50 | 2.778317e-48 |
MsaG021668 | MsaG029086 | 0.809743 | 2.779335e-50 | 4.716986e-48 |
MsaG022058 | MsaG029086 | 0.844522 | 1.343129e-58 | 6.058119e-56 |
MsaG022059 | MsaG029086 | 0.813397 | 4.502523e-51 | 8.360350e-49 |
MsaG022438 | MsaG029086 | 0.800330 | 2.535205e-48 | 3.453312e-46 |
MsaG022440 | MsaG029086 | 0.805645 | 2.043612e-49 | 3.145130e-47 |
MsaG022628 | MsaG029086 | 0.840936 | 1.192730e-57 | 4.795115e-55 |
MsaG023326 | MsaG029086 | 0.853872 | 3.452802e-61 | 2.142619e-58 |
MsaG023339 | MsaG029086 | 0.840214 | 1.839753e-57 | 7.230037e-55 |
MsaG023595 | MsaG029086 | 0.808265 | 5.740246e-50 | 9.401275e-48 |
MsaG023743 | MsaG029086 | 0.843851 | 2.029196e-58 | 8.954010e-56 |
MsaG023719 | MsaG029086 | 0.850369 | 3.381855e-60 | 1.856121e-57 |
MsaG023729 | MsaG029086 | 0.805580 | 2.108380e-49 | 3.239779e-47 |
MsaG023765 | MsaG029086 | 0.803535 | 5.605226e-49 | 8.214124e-47 |
MsaG023831 | MsaG029086 | 0.838583 | 4.853553e-57 | 1.812603e-54 |
MsaG023882 | MsaG029086 | 0.803977 | 4.541879e-49 | 6.724365e-47 |
MsaG023924 | MsaG029086 | 0.858890 | 1.181495e-62 | 8.807923e-60 |
MsaG024010 | MsaG029086 | 0.853642 | 4.018060e-61 | 2.472953e-58 |
MsaG024291 | MsaG029086 | 0.818636 | 3.085294e-52 | 6.546659e-50 |
MsaG025423 | MsaG029086 | 0.804668 | 3.265739e-49 | 4.912983e-47 |
MsaG025467 | MsaG029086 | 0.800745 | 2.088121e-48 | 2.871219e-46 |
MsaG025691 | MsaG029086 | 0.856322 | 6.751654e-62 | 4.576867e-59 |
MsaG025969 | MsaG029086 | 0.867292 | 3.069057e-65 | 3.180259e-62 |
MsaG026624 | MsaG029086 | 0.818084 | 4.108696e-52 | 8.594350e-50 |
MsaG026777 | MsaG029086 | 0.840033 | 2.049247e-57 | 8.008336e-55 |
MsaG026842 | MsaG029086 | 0.805949 | 1.765372e-49 | 2.736323e-47 |
MsaG027092 | MsaG029086 | 0.815614 | 1.463049e-51 | 2.872585e-49 |
MsaG027211 | MsaG029086 | 0.859537 | 7.577131e-63 | 5.788077e-60 |
MsaG027389 | MsaG029086 | 0.801471 | 1.486108e-48 | 2.077164e-46 |
MsaG027542 | MsaG029086 | 0.824768 | 1.196176e-53 | 2.989890e-51 |
MsaG027593 | MsaG029086 | 0.800106 | 2.813640e-48 | 3.813283e-46 |
MsaG027872 | MsaG029086 | 0.808546 | 5.002427e-50 | 8.248473e-48 |
MsaG027881 | MsaG029086 | 0.880488 | 1.113806e-69 | 2.056968e-66 |
MsaG027984 | MsaG029086 | 0.840688 | 1.384300e-57 | 5.521917e-55 |
MsaG028001 | MsaG029086 | 0.848785 | 9.311351e-60 | 4.841489e-57 |
MsaG028211 | MsaG029086 | 0.801685 | 1.343861e-48 | 1.887521e-46 |
MsaG028234 | MsaG029086 | 0.864990 | 1.631516e-64 | 1.540766e-61 |
MsaG028374 | MsaG029086 | 0.855203 | 1.428409e-61 | 9.295369e-59 |
MsaG028335 | MsaG029086 | 0.831511 | 2.889950e-55 | 8.735309e-53 |
MsaG028456 | MsaG029086 | 0.800183 | 2.715102e-48 | 3.686017e-46 |
MsaG028554 | MsaG029086 | 0.869494 | 6.024624e-66 | 6.834701e-63 |
MsaG028715 | MsaG029086 | 0.846825 | 3.208002e-59 | 1.561748e-56 |
MsaG028811 | MsaG029086 | 0.807580 | 8.013546e-50 | 1.290968e-47 |
MsaG029086 | MsaG029177 | 0.835522 | 2.914249e-56 | 9.915712e-54 |
MsaG029086 | MsaG029184 | 0.834994 | 3.956086e-56 | 1.324937e-53 |
MsaG029086 | MsaG029204 | 0.817987 | 4.321064e-52 | 9.016115e-50 |
MsaG029086 | MsaG029230 | 0.807980 | 6.595856e-50 | 1.072883e-47 |
MsaG029086 | MsaG029385 | 0.870231 | 3.470583e-66 | 4.061044e-63 |
MsaG029086 | MsaG029319 | 0.837510 | 9.137305e-57 | 3.301423e-54 |
MsaG029086 | MsaG029324 | 0.937965 | 4.237167e-98 | 3.338131e-93 |
MsaG029086 | MsaG029340 | 0.857259 | 3.590154e-62 | 2.518293e-59 |
MsaG029086 | MsaG029540 | 0.885742 | 1.350356e-71 | 3.207492e-68 |
MsaG029086 | MsaG029581 | 0.803835 | 4.858263e-49 | 7.169134e-47 |
MsaG029086 | MsaG029801 | 0.811650 | 1.080181e-50 | 1.920546e-48 |
MsaG029086 | MsaG030198 | 0.810703 | 1.729420e-50 | 3.004410e-48 |
MsaG029086 | MsaG030471 | 0.884853 | 2.891881e-71 | 6.575713e-68 |
MsaG029086 | MsaG030501 | 0.846820 | 3.218660e-59 | 1.566672e-56 |
MsaG029086 | MsaG031043 | 0.846470 | 4.006703e-59 | 1.927411e-56 |
MsaG029086 | MsaG031126 | 0.823045 | 3.019886e-53 | 7.203331e-51 |
MsaG029086 | MsaG031277 | 0.819502 | 1.964217e-52 | 4.263529e-50 |
MsaG029086 | MsaG031408 | 0.838465 | 5.204742e-57 | 1.936583e-54 |
MsaG029086 | MsaG031799 | 0.851682 | 1.448107e-60 | 8.318042e-58 |
MsaG029086 | MsaG032062 | 0.803111 | 6.853046e-49 | 9.945034e-47 |
MsaG029086 | MsaG032146 | 0.822113 | 4.961814e-53 | 1.154148e-50 |
MsaG029086 | MsaG032285 | 0.850419 | 3.275203e-60 | 1.800750e-57 |
MsaG029086 | MsaG032479 | 0.843175 | 3.071384e-58 | 1.326221e-55 |
MsaG029086 | MsaG032477 | 0.830189 | 6.074148e-55 | 1.767410e-52 |
MsaG029086 | MsaG032947 | 0.826927 | 3.696841e-54 | 9.810080e-52 |
MsaG029086 | MsaG033249 | 0.830159 | 6.178579e-55 | 1.796284e-52 |
MsaG029086 | MsaG033333 | 0.805668 | 2.021725e-49 | 3.113011e-47 |
MsaG029086 | MsaG033437 | 0.829211 | 1.048113e-54 | 2.965284e-52 |
MsaG029086 | MsaG033481 | 0.806468 | 1.374385e-49 | 2.156749e-47 |
MsaG029086 | MsaG033693 | 0.810603 | 1.817590e-50 | 3.149859e-48 |
MsaG029086 | MsaG033759 | 0.801610 | 1.392181e-48 | 1.952051e-46 |
MsaG029086 | MsaG033812 | 0.829471 | 9.068199e-55 | 2.584921e-52 |
MsaG029086 | MsaG033831 | 0.810546 | 1.869771e-50 | 3.235856e-48 |
MsaG029086 | MsaG034319 | 0.809643 | 2.920548e-50 | 4.944615e-48 |
MsaG029086 | MsaG034337 | 0.828426 | 1.619516e-54 | 4.482190e-52 |
MsaG029086 | MsaG034741 | 0.835781 | 2.508116e-56 | 8.599933e-54 |
MsaG029086 | MsaG034836 | 0.827864 | 2.208812e-54 | 6.017251e-52 |
MsaG029086 | MsaG035015 | 0.828770 | 1.338384e-54 | 3.739804e-52 |
MsaG029086 | MsaG035057 | 0.863132 | 6.144843e-64 | 5.391147e-61 |
MsaG029086 | MsaG035233 | 0.806473 | 1.371065e-49 | 2.151769e-47 |
MsaG029086 | MsaG035532 | 0.839628 | 2.609491e-57 | 1.006824e-54 |
MsaG029086 | MsaG035533 | 0.843335 | 2.783627e-58 | 1.208241e-55 |
MsaG029086 | MsaG035552 | 0.871806 | 1.055847e-66 | 1.321291e-63 |
MsaG029086 | MsaG036065 | 0.820441 | 1.200514e-52 | 2.671483e-50 |
MsaG029086 | MsaG036109 | 0.905390 | 1.066515e-79 | 7.524107e-76 |
MsaG029086 | MsaG037861 | 0.802379 | 9.688451e-49 | 1.382546e-46 |
MsaG029086 | MsaG037863 | 0.814012 | 3.301942e-51 | 6.226247e-49 |
MsaG029086 | MsaG037865 | 0.895946 | 1.333179e-75 | 5.409240e-72 |
MsaG029086 | MsaG037866 | 0.867010 | 3.770978e-65 | 3.863852e-62 |
MsaG029086 | MsaG037867 | 0.891215 | 1.075564e-73 | 3.377944e-70 |
MsaG029086 | MsaG038016 | 0.836570 | 1.584597e-56 | 5.563760e-54 |
MsaG029086 | MsaG038395 | 0.894677 | 4.417011e-75 | 1.671707e-71 |
MsaG029086 | MsaG039051 | 0.813785 | 3.702665e-51 | 6.942541e-49 |
MsaG029086 | MsaG039489 | 0.833072 | 1.191920e-55 | 3.770564e-53 |
MsaG029086 | MsaG039621 | 0.817822 | 4.705447e-52 | 9.776701e-50 |
MsaG029086 | MsaG039751 | 0.807977 | 6.606748e-50 | 1.074570e-47 |
MsaG029086 | MsaG039962 | 0.843556 | 2.431493e-58 | 1.062906e-55 |
MsaG029086 | MsaG040072 | 0.834299 | 5.905855e-56 | 1.937237e-53 |
MsaG029086 | MsaG040428 | 0.843131 | 3.153946e-58 | 1.359947e-55 |
MsaG029086 | MsaG040670 | 0.804781 | 3.094351e-49 | 4.667360e-47 |
MsaG029086 | MsaG040982 | 0.802051 | 1.130858e-48 | 1.601627e-46 |
MsaG029086 | MsaG041011 | 0.827818 | 2.265985e-54 | 6.165160e-52 |
MsaG029086 | MsaG041039 | 0.831499 | 2.909036e-55 | 8.790177e-53 |
MsaG029086 | MsaG041040 | 0.824148 | 1.671477e-53 | 4.107878e-51 |
MsaG029086 | MsaG041253 | 0.823192 | 2.791866e-53 | 6.685870e-51 |
MsaG029086 | MsaG041517 | 0.808784 | 4.451857e-50 | 7.382955e-48 |
MsaG029086 | MsaG041734 | 0.854624 | 2.098558e-61 | 1.337636e-58 |
MsaG029086 | MsaG041905 | 0.828555 | 1.507923e-54 | 4.188424e-52 |
MsaG029086 | MsaG042380 | 0.862976 | 6.862672e-64 | 5.984074e-61 |
MsaG029086 | MsaG042407 | 0.802002 | 1.157570e-48 | 1.637604e-46 |
MsaG029086 | MsaG043663 | 0.801260 | 1.640506e-48 | 2.282024e-46 |
MsaG029086 | MsaG043668 | 0.851713 | 1.418980e-60 | 8.159690e-58 |
MsaG029086 | MsaG043808 | 0.828114 | 1.923905e-54 | 5.278171e-52 |
MsaG029086 | MsaG044063 | 0.802655 | 8.506986e-49 | 1.221621e-46 |
MsaG029086 | MsaG044187 | 0.872647 | 5.559041e-67 | 7.212037e-64 |
MsaG029086 | MsaG044336 | 0.805997 | 1.725077e-49 | 2.676806e-47 |
MsaG029086 | MsaG044439 | 0.810533 | 1.881844e-50 | 3.255760e-48 |
MsaG029086 | MsaG044663 | 0.885381 | 1.842019e-71 | 4.298300e-68 |
MsaG029086 | MsaG044664 | 0.852076 | 1.120760e-60 | 6.528060e-58 |
MsaG029086 | MsaG044782 | 0.843743 | 2.168692e-58 | 9.537024e-56 |
MsaG029086 | MsaG044888 | 0.821016 | 8.871034e-53 | 2.004299e-50 |
MsaG029086 | MsaG044928 | 0.865471 | 1.153317e-64 | 1.110289e-61 |
MsaG029086 | MsaG045184 | 0.820342 | 1.264528e-52 | 2.806606e-50 |
MsaG029086 | MsaG045291 | 0.821917 | 5.504421e-53 | 1.273687e-50 |
MsaG029086 | MsaG045362 | 0.823291 | 2.647540e-53 | 6.357467e-51 |
MsaG029086 | MsaG045452 | 0.829701 | 7.977534e-55 | 2.289073e-52 |
MsaG029086 | MsaG045677 | 0.826643 | 4.318243e-54 | 1.136838e-51 |
MsaG029086 | MsaG045706 | 0.804412 | 3.689940e-49 | 5.518445e-47 |
MsaG029086 | MsaG045824 | 0.809006 | 3.994446e-50 | 6.659809e-48 |
MsaG029086 | MsaG045832 | 0.820096 | 1.439293e-52 | 3.173662e-50 |
MsaG029086 | MsaG045838 | 0.803657 | 5.287807e-49 | 7.770861e-47 |
MsaG029086 | MsaG046001 | 0.848337 | 1.237673e-59 | 6.338171e-57 |
MsaG029086 | MsaG046029 | 0.802430 | 9.460426e-49 | 1.351545e-46 |
MsaG029086 | MsaG046036 | 0.819746 | 1.729088e-52 | 3.777102e-50 |
MsaG029086 | MsaG046041 | 0.820294 | 1.296751e-52 | 2.874474e-50 |
MsaG029086 | MsaG046053 | 0.815850 | 1.297122e-51 | 2.561990e-49 |
MsaG029086 | MsaG046205 | 0.843767 | 2.136811e-58 | 9.403892e-56 |
MsaG029086 | MsaG046307 | 0.801421 | 1.520968e-48 | 2.123537e-46 |
MsaG029086 | MsaG046311 | 0.848480 | 1.130145e-59 | 5.815542e-57 |
MsaG029086 | MsaG046539 | 0.878075 | 7.887708e-69 | 1.302712e-65 |
MsaG029086 | MsaG046488 | 0.855370 | 1.277317e-61 | 8.363033e-59 |
MsaG029086 | MsaG046544 | 0.881612 | 4.410315e-70 | 8.584202e-67 |
MsaG029086 | MsaG046556 | 0.808852 | 4.307726e-50 | 7.155545e-48 |
MsaG029086 | MsaG046588 | 0.874992 | 9.061794e-68 | 1.302722e-64 |
MsaG029086 | MsaG046629 | 0.813954 | 3.400412e-51 | 6.402739e-49 |
MsaG029086 | MsaG046656 | 0.800124 | 2.790289e-48 | 3.783109e-46 |
MsaG029086 | MsaG046912 | 0.815876 | 1.280412e-51 | 2.530649e-49 |
MsaG029086 | MsaG047053 | 0.802720 | 8.246355e-49 | 1.185934e-46 |
MsaG029086 | MsaG047138 | 0.841983 | 6.341570e-58 | 2.635797e-55 |
MsaG029086 | MsaG001257 | 0.893800 | 1.001916e-74 | 3.615347e-71 |
MsaG029086 | MsaG001485 | 0.809544 | 3.065920e-50 | 5.178481e-48 |
MsaG029086 | MsaG001694 | 0.802342 | 9.862375e-49 | 1.406158e-46 |
MsaG029086 | MsaG001106 | 0.807404 | 8.730430e-50 | 1.400582e-47 |
MsaG029086 | MsaG001372 | 0.827729 | 2.379873e-54 | 6.458747e-52 |
MsaG029086 | MsaG001715 | 0.825926 | 6.384091e-54 | 1.647651e-51 |
MsaG029086 | MsaG002035 | 0.816402 | 9.779741e-52 | 1.958983e-49 |
MsaG029086 | MsaG007590 | 0.825339 | 8.784200e-54 | 2.230391e-51 |
MsaG029086 | MsaG009510 | 0.856449 | 6.199926e-62 | 4.222407e-59 |
MsaG029086 | MsaG011183 | 0.813553 | 4.163448e-51 | 7.760964e-49 |
MsaG029086 | MsaG010137 | 0.859002 | 1.094043e-62 | 8.189757e-60 |
MsaG029086 | MsaG013590 | 0.829707 | 7.949167e-55 | 2.281347e-52 |
MsaG029086 | MsaG011742 | 0.835036 | 3.862245e-56 | 1.295130e-53 |
MsaG029086 | MsaG014180 | 0.830167 | 6.148395e-55 | 1.787926e-52 |
MsaG029086 | MsaG013262 | 0.820697 | 1.049321e-52 | 2.350644e-50 |
MsaG029086 | MsaG013526 | 0.828706 | 1.387145e-54 | 3.869055e-52 |
MsaG029086 | MsaG014993 | 0.803125 | 6.809557e-49 | 9.884822e-47 |
MsaG029086 | MsaG012695 | 0.842274 | 5.314892e-58 | 2.229549e-55 |
MsaG029086 | MsaG019142 | 0.828054 | 1.988723e-54 | 5.446674e-52 |
MsaG029086 | MsaG020038 | 0.803611 | 5.404703e-49 | 7.934070e-47 |
MsaG029086 | MsaG021114 | 0.812658 | 6.526514e-51 | 1.189666e-48 |
MsaG029086 | MsaG028858 | 0.805397 | 2.302203e-49 | 3.522599e-47 |
MsaG029086 | MsaG028289 | 0.817714 | 4.976378e-52 | 1.031019e-49 |
MsaG029086 | MsaG028139 | 0.828016 | 2.031220e-54 | 5.557115e-52 |
MsaG029086 | MsaG028903 | 0.810053 | 2.385494e-50 | 4.078956e-48 |
MsaG029086 | MsaG031488 | 0.820526 | 1.147956e-52 | 2.560158e-50 |
MsaG029086 | MsaG030863 | 0.915953 | 7.959287e-85 | 1.121428e-80 |
MsaG029086 | MsaG032931 | 0.842347 | 5.082919e-58 | 2.137391e-55 |
MsaG029086 | MsaG033467 | 0.850413 | 3.287413e-60 | 1.807028e-57 |
MsaG029086 | MsaG032243 | 0.843960 | 1.898281e-58 | 8.405459e-56 |
MsaG029086 | MsaG031968 | 0.812635 | 6.605088e-51 | 1.203277e-48 |
MsaG029086 | MsaG032481 | 0.852401 | 9.066520e-61 | 5.341612e-58 |
MsaG029086 | MsaG031903 | 0.864565 | 2.213688e-64 | 2.055353e-61 |
MsaG029086 | MsaG032845 | 0.805589 | 2.099657e-49 | 3.227023e-47 |
MsaG029086 | MsaG031711 | 0.854159 | 2.855661e-61 | 1.790378e-58 |
MsaG029086 | MsaG034730 | 0.813154 | 5.088569e-51 | 9.391046e-49 |
MsaG029086 | MsaG031311 | 0.805765 | 1.928916e-49 | 2.976897e-47 |
MsaG029086 | MsaG033345 | 0.841653 | 7.740880e-58 | 3.183610e-55 |
MsaG029086 | MsaG033321 | 0.812870 | 5.867834e-51 | 1.075292e-48 |
MsaG029086 | MsaG030553 | 0.821482 | 6.933715e-53 | 1.585950e-50 |
MsaG029086 | MsaG033360 | 0.834444 | 5.431778e-56 | 1.789501e-53 |
MsaG029086 | MsaG031316 | 0.804192 | 4.098852e-49 | 6.098837e-47 |
MsaG029086 | MsaG031025 | 0.825596 | 7.641486e-54 | 1.953980e-51 |
MsaG029086 | MsaG032473 | 0.833846 | 7.656853e-56 | 2.477823e-53 |
MsaG029086 | MsaG032474 | 0.887738 | 2.387259e-72 | 6.264753e-69 |
MsaG029086 | MsaG033065 | 0.860779 | 3.205640e-63 | 2.567742e-60 |
MsaG029086 | MsaG032251 | 0.812402 | 7.422458e-51 | 1.344416e-48 |
MsaG029086 | MsaG033470 | 0.815682 | 1.413344e-51 | 2.779727e-49 |
MsaG029086 | MsaG033454 | 0.844805 | 1.127794e-58 | 5.135078e-56 |
MsaG029086 | MsaG036760 | 0.804204 | 4.075524e-49 | 6.065833e-47 |
MsaG029086 | MsaG038716 | 0.805512 | 2.178317e-49 | 3.341920e-47 |
MsaG029086 | MsaG037678 | 0.806413 | 1.411430e-49 | 2.211949e-47 |
MsaG029086 | MsaG036053 | 0.880774 | 8.806053e-70 | 1.648281e-66 |
MsaG029086 | MsaG037271 | 0.837063 | 1.187702e-56 | 4.232946e-54 |
MsaG029086 | MsaG037384 | 0.805293 | 2.419892e-49 | 3.693738e-47 |
MsaG029086 | MsaG037454 | 0.804021 | 4.446401e-49 | 6.589923e-47 |
MsaG029086 | MsaG038131 | 0.883780 | 7.193260e-71 | 1.553165e-67 |
MsaG029086 | MsaG037262 | 0.814807 | 2.206890e-51 | 4.245449e-49 |
MsaG029086 | MsaG040703 | 0.844572 | 1.302293e-58 | 5.883784e-56 |
MsaG029086 | MsaG035677 | 0.864362 | 2.560749e-64 | 2.358430e-61 |
MsaG029086 | MsaG037023 | 0.828394 | 1.648833e-54 | 4.559234e-52 |
MsaG029086 | MsaG035294 | 0.809364 | 3.349958e-50 | 5.633373e-48 |
MsaG029086 | MsaG036073 | 0.878802 | 4.393236e-69 | 7.503467e-66 |
MsaG029086 | MsaG035340 | 0.845576 | 6.995595e-59 | 3.266840e-56 |
MsaG029086 | MsaG037480 | 0.811078 | 1.435911e-50 | 2.517543e-48 |
MsaG029086 | MsaG036205 | 0.806270 | 1.512238e-49 | 2.361968e-47 |
MsaG029086 | MsaG039501 | 0.820344 | 1.263609e-52 | 2.804683e-50 |
MsaG029086 | MsaG035272 | 0.874162 | 1.729107e-67 | 2.396793e-64 |
MsaG029086 | MsaG036984 | 0.825816 | 6.776880e-54 | 1.743681e-51 |
MsaG029086 | MsaG043490 | 0.819037 | 2.504148e-52 | 5.369625e-50 |
MsaG029086 | MsaG041378 | 0.838501 | 5.094388e-57 | 1.897714e-54 |
MsaG029086 | MsaG045876 | 0.823895 | 1.914840e-53 | 4.673791e-51 |
MsaG029086 | MsaG045256 | 0.803002 | 7.217160e-49 | 1.044687e-46 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG029086 | MtrunA17_Chr5g0440591 | 91.964 | 336 | 6 | 1 | 172 | 507 | 301 | 615 | 0.0 | 641 |
MsaG029086 | MtrunA17_Chr5g0440591 | 73.810 | 252 | 49 | 4 | 1 | 243 | 1 | 244 | 2.43e-117 | 358 |
MsaG029086 | MtrunA17_Chr3g0118361 | 48.895 | 362 | 119 | 18 | 172 | 505 | 304 | 627 | 4.99e-87 | 280 |
MsaG029086 | MtrunA17_Chr3g0118361 | 72.000 | 200 | 50 | 4 | 1 | 195 | 2 | 200 | 4.01e-80 | 262 |
MsaG029086 | MtrunA17_Chr2g0329151 | 69.600 | 125 | 36 | 1 | 36 | 158 | 25 | 149 | 6.15e-55 | 194 |
MsaG029086 | MtrunA17_Chr3g0124291 | 60.000 | 110 | 41 | 1 | 46 | 155 | 29 | 135 | 4.37e-39 | 147 |
MsaG029086 | MtrunA17_Chr8g0382561 | 57.627 | 118 | 45 | 2 | 39 | 155 | 12 | 125 | 1.72e-37 | 143 |
MsaG029086 | MtrunA17_Chr6g0476301 | 65.079 | 63 | 22 | 0 | 103 | 165 | 1 | 63 | 6.55e-24 | 103 |
MsaG029086 | MtrunA17_Chr6g0473191 | 65.079 | 63 | 22 | 0 | 103 | 165 | 1 | 63 | 1.50e-23 | 100 |
MsaG029086 | MtrunA17_Chr6g0476291 | 61.905 | 63 | 24 | 0 | 103 | 165 | 1 | 63 | 7.42e-23 | 98.2 |
MsaG029086 | MtrunA17_Chr7g0260281 | 53.846 | 65 | 30 | 0 | 92 | 156 | 1 | 65 | 8.80e-19 | 82.4 |
MsaG029086 | MtrunA17_Chr3g0080401 | 53.968 | 63 | 29 | 0 | 103 | 165 | 1 | 63 | 3.19e-18 | 85.9 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG029086 | AT3G20770.1 | 61.508 | 252 | 79 | 5 | 2 | 243 | 1 | 244 | 9.78e-92 | 293 |
MsaG029086 | AT3G20770.1 | 39.601 | 351 | 171 | 15 | 172 | 505 | 301 | 627 | 4.24e-55 | 195 |
MsaG029086 | AT2G27050.1 | 74.566 | 173 | 41 | 3 | 1 | 171 | 1 | 172 | 2.39e-80 | 261 |
MsaG029086 | AT2G27050.1 | 38.109 | 349 | 133 | 16 | 172 | 505 | 303 | 583 | 2.49e-42 | 159 |
MsaG029086 | AT1G73730.2 | 64.493 | 138 | 43 | 2 | 34 | 167 | 11 | 146 | 5.03e-53 | 188 |
MsaG029086 | AT1G73730.1 | 64.493 | 138 | 43 | 2 | 34 | 167 | 23 | 158 | 7.67e-53 | 188 |
MsaG029086 | AT5G10120.1 | 51.938 | 129 | 58 | 3 | 28 | 155 | 4 | 129 | 4.34e-37 | 143 |
MsaG029086 | AT5G21120.2 | 57.143 | 140 | 54 | 2 | 22 | 158 | 31 | 167 | 5.73e-35 | 137 |
MsaG029086 | AT5G21120.3 | 57.143 | 140 | 54 | 2 | 22 | 158 | 24 | 160 | 5.95e-35 | 137 |
MsaG029086 | AT5G21120.1 | 57.143 | 140 | 54 | 2 | 22 | 158 | 24 | 160 | 5.95e-35 | 137 |
MsaG029086 | AT5G65100.1 | 48.438 | 128 | 49 | 2 | 44 | 155 | 33 | 159 | 2.87e-32 | 130 |
Find 141 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
AAGGCACAAGGCTTTGTTTA+TGG | 0.190580 | 5:-72757464 | MsaT029086.1:CDS |
ACCTCGGTAGCATGAAAATT+AGG | 0.199653 | 5:+72756468 | None:intergenic |
CCACCTTCATTCGATTTAAC+TGG | 0.245739 | 5:-72756378 | MsaT029086.1:CDS |
TTTAACTGGGTTTGGAGTTT+CGG | 0.307024 | 5:-72756364 | MsaT029086.1:CDS |
AAGCTTTGTGGGAAAATAAC+TGG | 0.313704 | 5:+72756441 | None:intergenic |
GCAGGCTGAACTGTAGAATT+AGG | 0.320347 | 5:+72756411 | None:intergenic |
ATCTGCTTGATACTTGGATA+TGG | 0.326260 | 5:+72757343 | None:intergenic |
AGGCACAAGGCTTTGTTTAT+GGG | 0.329778 | 5:-72757463 | MsaT029086.1:CDS |
TGCATTATCTGCTTGATACT+TGG | 0.339703 | 5:+72757337 | None:intergenic |
GTATGGTTCTTCATGTGATT+TGG | 0.348025 | 5:-72756001 | MsaT029086.1:CDS |
TCATCCTCGACCACCGAATC+TGG | 0.353514 | 5:+72757698 | None:intergenic |
TACCTCCGCCAGAGGATAAC+GGG | 0.362721 | 5:+72756871 | None:intergenic |
AACAACAAGATGTTTCAATA+TGG | 0.364077 | 5:-72755915 | MsaT029086.1:CDS |
TGATGAGAAGGTTGCTGAAC+TGG | 0.365013 | 5:+72756708 | None:intergenic |
CCTTTCAAGATAGGTCTTCC+AGG | 0.366977 | 5:-72756551 | MsaT029086.1:CDS |
ATTATTGTTGTTGTTGAGGT+TGG | 0.371583 | 5:+72756035 | None:intergenic |
GTCCTGTTGTTGCTGAATGA+TGG | 0.379003 | 5:+72756158 | None:intergenic |
AATCTTCATCCATCCAATCT+TGG | 0.380733 | 5:-72756756 | MsaT029086.1:CDS |
ATCAATTCCTTCTTTAGCCT+TGG | 0.381143 | 5:+72757589 | None:intergenic |
TCATTCGATTTAACTGGGTT+TGG | 0.382118 | 5:-72756372 | MsaT029086.1:CDS |
TTATCCTCTGGCGGAGGTAC+TGG | 0.383389 | 5:-72756867 | MsaT029086.1:CDS |
TTCAATAACTACACAATTGG+TGG | 0.384657 | 5:+72756266 | None:intergenic |
GGTTTCAAAAGGAGAGTTCA+TGG | 0.396115 | 5:+72756056 | None:intergenic |
CAAGCAGATAATGCAATTCC+AGG | 0.406735 | 5:-72757329 | MsaT029086.1:CDS |
CATTCTATCCATCCCAAGAT+TGG | 0.409448 | 5:+72756743 | None:intergenic |
TTGTGGTACACTTGGGGAAG+GGG | 0.411806 | 5:-72757747 | MsaT029086.1:CDS |
TAGGTTGAACAAAGCTTTGT+GGG | 0.411860 | 5:+72756430 | None:intergenic |
AGAAACAGTCCTGCAGGTTA+TGG | 0.412726 | 5:-72756495 | MsaT029086.1:CDS |
CTCGCCTTGCCTTTCAAGAT+AGG | 0.415938 | 5:-72756560 | MsaT029086.1:CDS |
TGGCGGAGGTACTGGTTCTA+TGG | 0.421852 | 5:-72756859 | MsaT029086.1:CDS |
AATAATATGCATCCCATGTA+TGG | 0.430283 | 5:-72756018 | MsaT029086.1:CDS |
TCCTGTTGTTGCTGAATGAT+GGG | 0.434795 | 5:+72756159 | None:intergenic |
GGCAAGGCAGTCTCAAGAAC+AGG | 0.441318 | 5:-72757558 | MsaT029086.1:CDS |
ATCTTCATCCATCCAATCTT+GGG | 0.443460 | 5:-72756755 | MsaT029086.1:CDS |
TTGTTGAGGTTGGTTTCAAA+AGG | 0.451254 | 5:+72756045 | None:intergenic |
GGGAGAGGTTGTCACAAACT+TGG | 0.451465 | 5:-72756679 | MsaT029086.1:CDS |
CCTCGGTAGCATGAAAATTA+GGG | 0.456819 | 5:+72756469 | None:intergenic |
CACCTTCATTCGATTTAACT+GGG | 0.462918 | 5:-72756377 | MsaT029086.1:CDS |
GGCTATGATACACATGTTAT+AGG | 0.462962 | 5:-72756306 | MsaT029086.1:CDS |
TCACAAACTTGGATTTCATT+CGG | 0.464079 | 5:-72756668 | MsaT029086.1:CDS |
TGATTATAGTGATGAAGAAA+TGG | 0.464489 | 5:-72757678 | MsaT029086.1:CDS |
TTTGTGGTACACTTGGGGAA+GGG | 0.466355 | 5:-72757748 | MsaT029086.1:CDS |
GCCCATCATTCAGCAACAAC+AGG | 0.469177 | 5:-72756160 | MsaT029086.1:CDS |
GCATATTATTGTTGTTGTTG+AGG | 0.474406 | 5:+72756031 | None:intergenic |
CAGGCAAACCGAGCCAGATT+CGG | 0.479153 | 5:-72757711 | MsaT029086.1:CDS |
TCGTGAATGGTGGAAGGATA+AGG | 0.479265 | 5:-72757393 | MsaT029086.1:CDS |
GAGAGTTCATGGCCTTGAAC+CGG | 0.490862 | 5:+72756067 | None:intergenic |
AAGGGGATATTTCTTCTGTC+AGG | 0.493214 | 5:-72757730 | MsaT029086.1:CDS |
ACGAAGATTGTCAGATGCTC+CGG | 0.495666 | 5:+72757412 | None:intergenic |
AATTCCCGAGAAGGGAAAAC+CGG | 0.496336 | 5:-72757438 | MsaT029086.1:CDS |
TTGTCAGATGCTCCGGTCAC+CGG | 0.496468 | 5:+72757419 | None:intergenic |
GCAACCTTCTCATCAAATCA+AGG | 0.497251 | 5:-72756700 | MsaT029086.1:CDS |
AAATCAGTTTGACCGGTTCA+AGG | 0.500225 | 5:-72756079 | MsaT029086.1:CDS |
GATGATGATGTTTGAGGACA+TGG | 0.505605 | 5:-72757795 | MsaT029086.1:CDS |
TGCAGTGAGTATGATGTTGA+TGG | 0.508204 | 5:-72756825 | MsaT029086.1:CDS |
GTACCTCCGCCAGAGGATAA+CGG | 0.514038 | 5:+72756870 | None:intergenic |
TGATACTTGGATATGGCAGC+TGG | 0.514747 | 5:+72757350 | None:intergenic |
ATGATCAGCGACCTTATGTC+AGG | 0.516438 | 5:-72756327 | MsaT029086.1:CDS |
CGAGCCAGATTCGGTGGTCG+AGG | 0.516671 | 5:-72757702 | MsaT029086.1:CDS |
GCAATTCCAGGGAAGAATGA+TGG | 0.516754 | 5:-72757317 | MsaT029086.1:CDS |
CTCGACCACCGAATCTGGCT+CGG | 0.517344 | 5:+72757703 | None:intergenic |
TAACGACTTCAACATGATGA+TGG | 0.518203 | 5:-72756631 | MsaT029086.1:CDS |
TTGCATCCATCATTCTTCCC+TGG | 0.518960 | 5:+72757311 | None:intergenic |
ATGAGCTTGAGCGGAGGATG+TGG | 0.520497 | 5:-72757649 | MsaT029086.1:CDS |
ATCACATGAAGAACCATACA+TGG | 0.521967 | 5:+72756005 | None:intergenic |
GTGTATCATAGCCTGACATA+AGG | 0.531266 | 5:+72756316 | None:intergenic |
TCTCCCTTGATTTGATGAGA+AGG | 0.537373 | 5:+72756696 | None:intergenic |
ATTCAATTGATGATTGTCCC+TGG | 0.537403 | 5:+72756533 | None:intergenic |
ATCTTGGGATGGATAGAATG+AGG | 0.537865 | 5:-72756740 | MsaT029086.1:CDS |
TAGATCCTCCTTAAAATCAA+AGG | 0.539849 | 5:+72755975 | None:intergenic |
ACTTGGATTTCATTCGGAAG+AGG | 0.540565 | 5:-72756662 | MsaT029086.1:CDS |
TTAGGTTGAACAAAGCTTTG+TGG | 0.541625 | 5:+72756429 | None:intergenic |
GGGTTTGGAGTTTCGGAGGA+CGG | 0.542268 | 5:-72756357 | MsaT029086.1:CDS |
GAACAAACCAAGGCTAAAGA+AGG | 0.542936 | 5:-72757596 | MsaT029086.1:CDS |
TTTGAATCAAGGAATGGTGA+TGG | 0.544516 | 5:-72756127 | MsaT029086.1:CDS |
GAAGTACATGCTGAAAATGA+TGG | 0.545558 | 5:-72757495 | MsaT029086.1:CDS |
AGCTTGAGCGGAGGATGTGG+AGG | 0.545764 | 5:-72757646 | MsaT029086.1:CDS |
GAGAAGGGAAAACCGGTGAC+CGG | 0.547110 | 5:-72757431 | MsaT029086.1:CDS |
AGAAACAGAAACAGTCCTGC+AGG | 0.548675 | 5:-72756501 | MsaT029086.1:CDS |
GGACTGTTTCTGTTTCTATG+TGG | 0.550312 | 5:+72756507 | None:intergenic |
GAAGGTGGAACTAAACTAGC+AGG | 0.551330 | 5:+72756393 | None:intergenic |
AGGATAAGGTTCGGTTCGAT+AGG | 0.552012 | 5:-72757379 | MsaT029086.1:CDS |
TTAGGGTCGCCATAACCTGC+AGG | 0.552645 | 5:+72756486 | None:intergenic |
GCTGAATGATGGGCTGAGAA+AGG | 0.553081 | 5:+72756169 | None:intergenic |
GCTGAATGATGGGCTGAGAA+AGG | 0.553081 | 5:+72756202 | None:intergenic |
GCTGAATGATGGGCTGAGAA+AGG | 0.553081 | 5:+72756235 | None:intergenic |
TTCTCATCAAATCAAGGGAG+AGG | 0.554659 | 5:-72756694 | MsaT029086.1:CDS |
CTTTCAAGATAGGTCTTCCA+GGG | 0.555713 | 5:-72756550 | MsaT029086.1:CDS |
TATGGGATAATTCCCGAGAA+GGG | 0.556990 | 5:-72757446 | MsaT029086.1:CDS |
GGAAAAGATGATGATGTTTG+AGG | 0.557260 | 5:-72757801 | None:intergenic |
CTATCCATCCCAAGATTGGA+TGG | 0.557944 | 5:+72756747 | None:intergenic |
CTGACAATCTTCGTGAATGG+TGG | 0.558385 | 5:-72757403 | MsaT029086.1:CDS |
CCTGGAAGACCTATCTTGAA+AGG | 0.560673 | 5:+72756551 | None:intergenic |
CTACAACTACAAGGAGGAGT+AGG | 0.563021 | 5:-72755955 | MsaT029086.1:CDS |
AACCCAGTTAAATCGAATGA+AGG | 0.563631 | 5:+72756375 | None:intergenic |
GCGAGGAAAATCAGTTTGAC+CGG | 0.565875 | 5:-72756086 | MsaT029086.1:CDS |
CATCTGACAATCTTCGTGAA+TGG | 0.567255 | 5:-72757406 | MsaT029086.1:CDS |
TTATGGGATAATTCCCGAGA+AGG | 0.572124 | 5:-72757447 | MsaT029086.1:CDS |
AATGGTGGAAGGATAAGGTT+CGG | 0.572803 | 5:-72757388 | MsaT029086.1:CDS |
AGAAGGAATTGATGCTGCAA+AGG | 0.574701 | 5:-72757579 | MsaT029086.1:CDS |
GCAGTGAGTATGATGTTGAT+GGG | 0.574936 | 5:-72756824 | MsaT029086.1:CDS |
AACTGGGTTTGGAGTTTCGG+AGG | 0.578482 | 5:-72756361 | MsaT029086.1:CDS |
CGAGTCAAACTTTGATGTGG+AGG | 0.584361 | 5:-72756793 | MsaT029086.1:CDS |
TAGTGATGAAGAAATGGATG+TGG | 0.587114 | 5:-72757672 | MsaT029086.1:CDS |
GAAAATGATGGAGGTTTGCA+AGG | 0.590144 | 5:-72757483 | MsaT029086.1:CDS |
ATGGAGGTTTGCAAGGCACA+AGG | 0.590635 | 5:-72757476 | MsaT029086.1:CDS |
TCTTGGGATGGATAGAATGA+GGG | 0.594489 | 5:-72756739 | MsaT029086.1:CDS |
CAACCTTCTCATCAAATCAA+GGG | 0.596906 | 5:-72756699 | MsaT029086.1:CDS |
TCATCCATCCAATCTTGGGA+TGG | 0.598664 | 5:-72756751 | MsaT029086.1:CDS |
CCAGTTAAATCGAATGAAGG+TGG | 0.598931 | 5:+72756378 | None:intergenic |
CTTGGGATGGATAGAATGAG+GGG | 0.601634 | 5:-72756738 | MsaT029086.1:CDS |
CAATCTTCGTGAATGGTGGA+AGG | 0.601878 | 5:-72757399 | MsaT029086.1:CDS |
AAGCAGATAATGCAATTCCA+GGG | 0.603704 | 5:-72757328 | MsaT029086.1:CDS |
GGCAGTCTCAAGAACAGGCG+AGG | 0.607320 | 5:-72757553 | MsaT029086.1:CDS |
AAGGAGGATCTACAACTACA+AGG | 0.608788 | 5:-72755964 | MsaT029086.1:CDS |
AAGGTTCGGTTCGATAGGAA+TGG | 0.610184 | 5:-72757374 | MsaT029086.1:CDS |
GCAAACCGAGCCAGATTCGG+TGG | 0.610299 | 5:-72757708 | MsaT029086.1:CDS |
ACTACAAGGAGGAGTAGGAA+TGG | 0.611304 | 5:-72755950 | MsaT029086.1:CDS |
AAGATGTCAAGAGCTCAAGA+TGG | 0.612194 | 5:-72757524 | MsaT029086.1:CDS |
GCTTCGCTGTAAGCGCATTG+AGG | 0.613195 | 5:+72756582 | None:intergenic |
CGGCGAGTCAAACTTTGATG+TGG | 0.614982 | 5:-72756796 | MsaT029086.1:CDS |
AAGACCTATCTTGAAAGGCA+AGG | 0.620631 | 5:+72756556 | None:intergenic |
TATGATGTTGATGGGGCTGA+CGG | 0.622733 | 5:-72756816 | MsaT029086.1:CDS |
GAATTGATGCTGCAAAGGCA+AGG | 0.624873 | 5:-72757574 | MsaT029086.1:CDS |
GAATCAAGGAATGGTGATGG+AGG | 0.630262 | 5:-72756124 | MsaT029086.1:CDS |
ACCTCCGCCAGAGGATAACG+GGG | 0.630408 | 5:+72756872 | None:intergenic |
AATGATGGATGCAATTCCAT+CGG | 0.635466 | 5:-72757302 | MsaT029086.1:intron |
GAAAATAACTGGCTTAACCT+CGG | 0.643010 | 5:+72756452 | None:intergenic |
AGTCTCAAGAACAGGCGAGG+AGG | 0.643483 | 5:-72757550 | MsaT029086.1:CDS |
GCTTGAGCGGAGGATGTGGA+GGG | 0.653404 | 5:-72757645 | MsaT029086.1:CDS |
TGGATGTGGATGAGCTTGAG+CGG | 0.660750 | 5:-72757658 | MsaT029086.1:CDS |
ATGATGATGTTTGAGGACAT+GGG | 0.668420 | 5:-72757794 | MsaT029086.1:CDS |
AGAACCAGTACCTCCGCCAG+AGG | 0.682787 | 5:+72756863 | None:intergenic |
TCACATGAAGAACCATACAT+GGG | 0.685805 | 5:+72756006 | None:intergenic |
CTCCGCCAGAGGATAACGGG+GGG | 0.685928 | 5:+72756874 | None:intergenic |
GCGACTGAAAGAACAAACCA+AGG | 0.688069 | 5:-72757606 | MsaT029086.1:CDS |
CAGTGAGTATGATGTTGATG+GGG | 0.693933 | 5:-72756823 | MsaT029086.1:CDS |
CCTCCGCCAGAGGATAACGG+GGG | 0.696205 | 5:+72756873 | None:intergenic |
ATGTGGATGAGCTTGAGCGG+AGG | 0.710465 | 5:-72757655 | MsaT029086.1:CDS |
GTACATGCTGAAAATGATGG+AGG | 0.724912 | 5:-72757492 | MsaT029086.1:CDS |
GAGGATCTACAACTACAAGG+AGG | 0.776973 | 5:-72755961 | MsaT029086.1:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr5 | gene | 72755906 | 72757816 | 72755906 | ID=MsaG029086 |
Chr5 | mRNA | 72755906 | 72757816 | 72755906 | ID=MsaT029086.1;Parent=MsaG029086 |
Chr5 | exon | 72755906 | 72756915 | 72755906 | ID=MsaT029086.1.exon2;Parent=MsaT029086.1 |
Chr5 | CDS | 72755906 | 72756915 | 72755906 | ID=cds.MsaT029086.1;Parent=MsaT029086.1 |
Chr5 | exon | 72757303 | 72757816 | 72757303 | ID=MsaT029086.1.exon1;Parent=MsaT029086.1 |
Chr5 | CDS | 72757303 | 72757816 | 72757303 | ID=cds.MsaT029086.1;Parent=MsaT029086.1 |
Gene Sequence |
Protein sequence |