Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG029483 | XP_024627301.1 | 87.075 | 147 | 17 | 1 | 64 | 208 | 12 | 158 | 7.93e-76 | 239 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG029483 | sp|Q6P819|CNOT9_XENTR | 64.463 | 121 | 43 | 0 | 85 | 205 | 28 | 148 | 4.99e-47 | 159 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG029483 | tr|A0A396GV60|A0A396GV60_MEDTR | 87.075 | 147 | 17 | 1 | 64 | 208 | 12 | 158 | 6.68e-75 | 237 |
Gene ID | Type | Classification |
---|---|---|
MsaG029483 | TR | Rcd1-like |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000192 | MsaG029483 | 0.821187 | 8.104481e-53 | 1.839382e-50 |
MsaG000458 | MsaG029483 | 0.843162 | 3.095443e-58 | 1.336041e-55 |
MsaG000476 | MsaG029483 | 0.806804 | 1.168254e-49 | 1.847719e-47 |
MsaG000578 | MsaG029483 | 0.861856 | 1.510539e-63 | 1.260646e-60 |
MsaG000687 | MsaG029483 | 0.824334 | 1.511633e-53 | 3.734200e-51 |
MsaG001001 | MsaG029483 | 0.898645 | 9.899906e-77 | 4.678897e-73 |
MsaG001086 | MsaG029483 | 0.812803 | 6.069135e-51 | 1.110317e-48 |
MsaG002273 | MsaG029483 | 0.808081 | 6.278415e-50 | 1.023730e-47 |
MsaG002458 | MsaG029483 | 0.833184 | 1.118195e-55 | 3.549220e-53 |
MsaG002866 | MsaG029483 | 0.802297 | 1.007261e-48 | 1.434649e-46 |
MsaG003192 | MsaG029483 | 0.815528 | 1.529359e-51 | 2.996067e-49 |
MsaG003535 | MsaG029483 | 0.821450 | 7.051886e-53 | 1.611606e-50 |
MsaG003929 | MsaG029483 | 0.803705 | 5.170268e-49 | 7.606593e-47 |
MsaG004012 | MsaG029483 | 0.824094 | 1.720287e-53 | 4.221772e-51 |
MsaG004185 | MsaG029483 | 0.835345 | 3.229954e-56 | 1.093133e-53 |
MsaG004479 | MsaG029483 | 0.853341 | 4.899768e-61 | 2.983539e-58 |
MsaG004641 | MsaG029483 | 0.814240 | 2.942255e-51 | 5.579912e-49 |
MsaG004648 | MsaG029483 | 0.837347 | 1.005797e-56 | 3.615600e-54 |
MsaG004760 | MsaG029483 | 0.818199 | 3.871389e-52 | 8.122056e-50 |
MsaG004798 | MsaG029483 | 0.813140 | 5.124652e-51 | 9.454322e-49 |
MsaG004976 | MsaG029483 | 0.849999 | 4.289560e-60 | 2.324784e-57 |
MsaG005018 | MsaG029483 | 0.849239 | 6.974884e-60 | 3.683531e-57 |
MsaG005092 | MsaG029483 | 0.805095 | 2.662230e-49 | 4.044955e-47 |
MsaG005274 | MsaG029483 | 0.845345 | 8.075300e-59 | 3.742481e-56 |
MsaG005277 | MsaG029483 | 0.828353 | 1.686056e-54 | 4.656826e-52 |
MsaG005354 | MsaG029483 | 0.808742 | 4.545968e-50 | 7.531530e-48 |
MsaG005442 | MsaG029483 | 0.800912 | 1.930659e-48 | 2.664621e-46 |
MsaG005683 | MsaG029483 | 0.803896 | 4.719628e-49 | 6.974263e-47 |
MsaG006133 | MsaG029483 | 0.855800 | 9.587214e-62 | 6.375189e-59 |
MsaG006177 | MsaG029483 | 0.819702 | 1.769443e-52 | 3.860876e-50 |
MsaG006274 | MsaG029483 | 0.831758 | 2.513926e-55 | 7.654453e-53 |
MsaG006330 | MsaG029483 | 0.814419 | 2.687207e-51 | 5.119259e-49 |
MsaG006774 | MsaG029483 | 0.819753 | 1.722164e-52 | 3.762736e-50 |
MsaG006898 | MsaG029483 | 0.806916 | 1.106332e-49 | 1.754393e-47 |
MsaG006886 | MsaG029483 | 0.820383 | 1.238004e-52 | 2.750572e-50 |
MsaG007000 | MsaG029483 | 0.824621 | 1.295470e-53 | 3.225067e-51 |
MsaG006998 | MsaG029483 | 0.816506 | 9.269797e-52 | 1.861779e-49 |
MsaG007145 | MsaG029483 | 0.829812 | 7.497909e-55 | 2.158257e-52 |
MsaG007168 | MsaG029483 | 0.836546 | 1.607205e-56 | 5.639174e-54 |
MsaG007215 | MsaG029483 | 0.805720 | 1.970875e-49 | 3.038478e-47 |
MsaG007287 | MsaG029483 | 0.832554 | 1.601260e-55 | 4.989208e-53 |
MsaG007558 | MsaG029483 | 0.827151 | 3.268697e-54 | 8.728218e-52 |
MsaG008525 | MsaG029483 | 0.846615 | 3.660754e-59 | 1.769546e-56 |
MsaG009265 | MsaG029483 | 0.823514 | 2.348858e-53 | 5.674373e-51 |
MsaG009477 | MsaG029483 | 0.855437 | 1.221914e-61 | 8.019699e-59 |
MsaG009504 | MsaG029483 | 0.808378 | 5.431072e-50 | 8.918939e-48 |
MsaG009703 | MsaG029483 | 0.823898 | 1.912213e-53 | 4.667721e-51 |
MsaG009787 | MsaG029483 | 0.831528 | 2.862590e-55 | 8.656982e-53 |
MsaG010066 | MsaG029483 | 0.810306 | 2.105507e-50 | 3.622528e-48 |
MsaG010508 | MsaG029483 | 0.808561 | 4.966789e-50 | 8.192622e-48 |
MsaG010571 | MsaG029483 | 0.803843 | 4.840228e-49 | 7.143784e-47 |
MsaG010592 | MsaG029483 | 0.806366 | 1.443909e-49 | 2.260302e-47 |
MsaG010667 | MsaG029483 | 0.806961 | 1.082497e-49 | 1.718449e-47 |
MsaG010768 | MsaG029483 | 0.816418 | 9.698620e-52 | 1.943498e-49 |
MsaG011039 | MsaG029483 | 0.816750 | 8.178053e-52 | 1.652864e-49 |
MsaG011314 | MsaG029483 | 0.807825 | 7.112423e-50 | 1.152608e-47 |
MsaG011357 | MsaG029483 | 0.848614 | 1.038081e-59 | 5.366558e-57 |
MsaG011596 | MsaG029483 | 0.810802 | 1.647278e-50 | 2.868629e-48 |
MsaG012170 | MsaG029483 | 0.887126 | 4.073844e-72 | 1.036428e-68 |
MsaG012561 | MsaG029483 | 0.813871 | 3.546063e-51 | 6.663107e-49 |
MsaG012893 | MsaG029483 | 0.804818 | 3.039343e-49 | 4.588468e-47 |
MsaG013917 | MsaG029483 | 0.812214 | 8.151095e-51 | 1.469486e-48 |
MsaG013962 | MsaG029483 | 0.800057 | 2.878576e-48 | 3.897087e-46 |
MsaG014439 | MsaG029483 | 0.800699 | 2.133287e-48 | 2.930335e-46 |
MsaG015081 | MsaG029483 | 0.866726 | 4.642194e-65 | 4.701466e-62 |
MsaG015082 | MsaG029483 | 0.800847 | 1.990747e-48 | 2.743527e-46 |
MsaG015176 | MsaG029483 | 0.843169 | 3.080985e-58 | 1.330130e-55 |
MsaG015216 | MsaG029483 | 0.831452 | 2.988079e-55 | 9.016321e-53 |
MsaG015184 | MsaG029483 | 0.803776 | 4.997263e-49 | 7.364149e-47 |
MsaG015689 | MsaG029483 | 0.808899 | 4.209062e-50 | 6.999611e-48 |
MsaG016293 | MsaG029483 | 0.813760 | 3.750723e-51 | 7.027972e-49 |
MsaG016571 | MsaG029483 | 0.864291 | 2.693252e-64 | 2.473680e-61 |
MsaG016674 | MsaG029483 | 0.864730 | 1.965879e-64 | 1.837403e-61 |
MsaG016882 | MsaG029483 | 0.860222 | 4.718552e-63 | 3.700335e-60 |
MsaG017269 | MsaG029483 | 0.810540 | 1.874808e-50 | 3.244143e-48 |
MsaG017772 | MsaG029483 | 0.805626 | 2.062580e-49 | 3.172850e-47 |
MsaG017798 | MsaG029483 | 0.802891 | 7.607109e-49 | 1.098299e-46 |
MsaG018111 | MsaG029483 | 0.825035 | 1.035707e-53 | 2.607861e-51 |
MsaG018123 | MsaG029483 | 0.845389 | 7.857590e-59 | 3.647076e-56 |
MsaG018290 | MsaG029483 | 0.812241 | 8.044975e-51 | 1.451271e-48 |
MsaG018565 | MsaG029483 | 0.837860 | 7.437294e-57 | 2.715878e-54 |
MsaG018636 | MsaG029483 | 0.833456 | 9.576874e-56 | 3.063973e-53 |
MsaG018712 | MsaG029483 | 0.813749 | 3.770118e-51 | 7.062474e-49 |
MsaG018821 | MsaG029483 | 0.804727 | 3.174775e-49 | 4.782700e-47 |
MsaG018961 | MsaG029483 | 0.818338 | 3.601605e-52 | 7.583122e-50 |
MsaG019221 | MsaG029483 | 0.841742 | 7.333744e-58 | 3.024637e-55 |
MsaG019265 | MsaG029483 | 0.862374 | 1.050221e-63 | 8.942897e-61 |
MsaG019628 | MsaG029483 | 0.808898 | 4.211699e-50 | 7.003771e-48 |
MsaG019862 | MsaG029483 | 0.834540 | 5.140331e-56 | 1.698288e-53 |
MsaG020029 | MsaG029483 | 0.814051 | 3.236557e-51 | 6.108969e-49 |
MsaG020296 | MsaG029483 | 0.835828 | 2.441157e-56 | 8.382068e-54 |
MsaG020338 | MsaG029483 | 0.814738 | 2.285579e-51 | 4.389053e-49 |
MsaG020487 | MsaG029483 | 0.830675 | 4.627505e-55 | 1.365248e-52 |
MsaG020828 | MsaG029483 | 0.812130 | 8.504669e-51 | 1.529987e-48 |
MsaG020874 | MsaG029483 | 0.808759 | 4.507565e-50 | 7.470884e-48 |
MsaG020875 | MsaG029483 | 0.801246 | 1.651683e-48 | 2.296796e-46 |
MsaG021238 | MsaG029483 | 0.818611 | 3.124839e-52 | 6.626297e-50 |
MsaG021286 | MsaG029483 | 0.808661 | 4.729605e-50 | 7.820378e-48 |
MsaG021553 | MsaG029483 | 0.859240 | 9.290118e-63 | 7.018196e-60 |
MsaG021665 | MsaG029483 | 0.804931 | 2.879253e-49 | 4.358110e-47 |
MsaG022116 | MsaG029483 | 0.802133 | 1.088013e-48 | 1.543807e-46 |
MsaG022079 | MsaG029483 | 0.800944 | 1.902308e-48 | 2.627386e-46 |
MsaG022243 | MsaG029483 | 0.832017 | 2.171319e-55 | 6.661224e-53 |
MsaG023133 | MsaG029483 | 0.826957 | 3.635855e-54 | 9.656385e-52 |
MsaG023396 | MsaG029483 | 0.810910 | 1.561322e-50 | 2.726065e-48 |
MsaG023762 | MsaG029483 | 0.824165 | 1.656463e-53 | 4.072794e-51 |
MsaG026721 | MsaG029483 | 0.828733 | 1.366676e-54 | 3.814836e-52 |
MsaG026841 | MsaG029483 | 0.839738 | 2.444046e-57 | 9.462776e-55 |
MsaG026863 | MsaG029483 | 0.807238 | 9.463110e-50 | 1.512108e-47 |
MsaG027093 | MsaG029483 | 0.802908 | 7.547490e-49 | 1.090109e-46 |
MsaG027361 | MsaG029483 | 0.801371 | 1.557471e-48 | 2.171995e-46 |
MsaG027650 | MsaG029483 | 0.806879 | 1.126267e-49 | 1.784499e-47 |
MsaG027749 | MsaG029483 | 0.820563 | 1.125798e-52 | 2.513185e-50 |
MsaG028634 | MsaG029483 | 0.806868 | 1.132663e-49 | 1.794124e-47 |
MsaG028758 | MsaG029483 | 0.823783 | 2.034076e-53 | 4.949917e-51 |
MsaG028855 | MsaG029483 | 0.813510 | 4.252801e-51 | 7.919152e-49 |
MsaG028951 | MsaG029483 | 0.806059 | 1.674316e-49 | 2.601958e-47 |
MsaG029232 | MsaG029483 | 0.804839 | 3.008915e-49 | 4.544748e-47 |
MsaG029335 | MsaG029483 | 0.839486 | 2.839487e-57 | 1.090742e-54 |
MsaG029483 | MsaG029567 | 0.806535 | 1.330574e-49 | 2.091234e-47 |
MsaG029483 | MsaG029593 | 0.800296 | 2.574718e-48 | 3.504451e-46 |
MsaG029483 | MsaG029704 | 0.820930 | 9.280749e-53 | 2.092039e-50 |
MsaG029483 | MsaG029745 | 0.828924 | 1.229007e-54 | 3.449070e-52 |
MsaG029483 | MsaG029763 | 0.816658 | 8.573811e-52 | 1.728678e-49 |
MsaG029483 | MsaG029829 | 0.823542 | 2.314026e-53 | 5.594488e-51 |
MsaG029483 | MsaG029863 | 0.819376 | 2.097917e-52 | 4.538880e-50 |
MsaG029483 | MsaG030359 | 0.833381 | 9.991112e-56 | 3.189478e-53 |
MsaG029483 | MsaG030546 | 0.824618 | 1.297257e-53 | 3.229273e-51 |
MsaG029483 | MsaG030679 | 0.803143 | 6.752064e-49 | 9.805317e-47 |
MsaG029483 | MsaG030801 | 0.809194 | 3.641416e-50 | 6.098553e-48 |
MsaG029483 | MsaG031062 | 0.800010 | 2.941817e-48 | 3.978599e-46 |
MsaG029483 | MsaG031652 | 0.812465 | 7.190185e-51 | 1.304410e-48 |
MsaG029483 | MsaG032062 | 0.802487 | 9.206078e-49 | 1.316952e-46 |
MsaG029483 | MsaG033613 | 0.801349 | 1.573425e-48 | 2.193163e-46 |
MsaG029483 | MsaG034079 | 0.814708 | 2.320594e-51 | 4.452924e-49 |
MsaG029483 | MsaG034837 | 0.802145 | 1.082133e-48 | 1.535868e-46 |
MsaG029483 | MsaG034946 | 0.800454 | 2.392677e-48 | 3.268357e-46 |
MsaG029483 | MsaG034996 | 0.812589 | 6.756140e-51 | 1.229456e-48 |
MsaG029483 | MsaG035054 | 0.806437 | 1.394973e-49 | 2.187451e-47 |
MsaG029483 | MsaG035529 | 0.853425 | 4.635532e-61 | 2.831322e-58 |
MsaG029483 | MsaG035860 | 0.825913 | 6.429625e-54 | 1.658809e-51 |
MsaG029483 | MsaG036324 | 0.820658 | 1.071154e-52 | 2.397130e-50 |
MsaG029483 | MsaG036973 | 0.817297 | 6.170217e-52 | 1.264814e-49 |
MsaG029483 | MsaG037910 | 0.831103 | 3.637021e-55 | 1.086369e-52 |
MsaG029483 | MsaG039160 | 0.847218 | 2.507984e-59 | 1.237186e-56 |
MsaG029483 | MsaG040026 | 0.830540 | 4.991558e-55 | 1.466974e-52 |
MsaG029483 | MsaG040350 | 0.809495 | 3.140038e-50 | 5.297601e-48 |
MsaG029483 | MsaG040425 | 0.832683 | 1.488015e-55 | 4.653668e-53 |
MsaG029483 | MsaG040546 | 0.840804 | 1.291594e-57 | 5.170772e-55 |
MsaG029483 | MsaG040649 | 0.806392 | 1.425617e-49 | 2.233067e-47 |
MsaG029483 | MsaG040669 | 0.824957 | 1.080115e-53 | 2.713873e-51 |
MsaG029483 | MsaG041112 | 0.815520 | 1.535350e-51 | 3.007222e-49 |
MsaG029483 | MsaG041285 | 0.824507 | 1.377431e-53 | 3.418595e-51 |
MsaG029483 | MsaG041335 | 0.808550 | 4.993056e-50 | 8.233727e-48 |
MsaG029483 | MsaG042898 | 0.807477 | 8.426819e-50 | 1.354220e-47 |
MsaG029483 | MsaG042968 | 0.808404 | 5.362805e-50 | 8.812183e-48 |
MsaG029483 | MsaG043000 | 0.804980 | 2.813062e-49 | 4.262721e-47 |
MsaG029483 | MsaG043177 | 0.826109 | 5.777782e-54 | 1.498760e-51 |
MsaG029483 | MsaG043227 | 0.848505 | 1.112503e-59 | 5.729564e-57 |
MsaG029483 | MsaG044002 | 0.806899 | 1.115557e-49 | 1.768340e-47 |
MsaG029483 | MsaG044333 | 0.817131 | 6.723269e-52 | 1.372264e-49 |
MsaG029483 | MsaG044411 | 0.831962 | 2.239451e-55 | 6.859154e-53 |
MsaG029483 | MsaG044386 | 0.835399 | 3.130474e-56 | 1.061170e-53 |
MsaG029483 | MsaG044387 | 0.832203 | 1.953964e-55 | 6.026516e-53 |
MsaG029483 | MsaG044501 | 0.832831 | 1.367691e-55 | 4.295941e-53 |
MsaG029483 | MsaG044885 | 0.848834 | 9.028345e-60 | 4.702035e-57 |
MsaG029483 | MsaG044934 | 0.803915 | 4.676757e-49 | 6.914087e-47 |
MsaG029483 | MsaG045021 | 0.813233 | 4.889837e-51 | 9.042344e-49 |
MsaG029483 | MsaG045072 | 0.837228 | 1.078240e-56 | 3.862027e-54 |
MsaG029483 | MsaG045078 | 0.864151 | 2.976163e-64 | 2.718255e-61 |
MsaG029483 | MsaG045106 | 0.803624 | 5.371978e-49 | 7.888388e-47 |
MsaG029483 | MsaG045109 | 0.840037 | 2.044559e-57 | 7.990926e-55 |
MsaG029483 | MsaG045403 | 0.810904 | 1.565656e-50 | 2.733266e-48 |
MsaG029483 | MsaG045404 | 0.806284 | 1.502378e-49 | 2.347298e-47 |
MsaG029483 | MsaG045536 | 0.827247 | 3.101351e-54 | 8.303655e-52 |
MsaG029483 | MsaG045576 | 0.818582 | 3.172379e-52 | 6.721931e-50 |
MsaG029483 | MsaG045810 | 0.806178 | 1.580736e-49 | 2.463514e-47 |
MsaG029483 | MsaG045974 | 0.847218 | 2.507984e-59 | 1.237186e-56 |
MsaG029483 | MsaG046126 | 0.883255 | 1.119744e-70 | 2.356949e-67 |
MsaG029483 | MsaG046226 | 0.851481 | 1.649553e-60 | 9.409488e-58 |
MsaG029483 | MsaG046251 | 0.821115 | 8.416526e-53 | 1.906530e-50 |
MsaG029483 | MsaG046430 | 0.820238 | 1.336059e-52 | 2.957171e-50 |
MsaG029483 | MsaG046554 | 0.800539 | 2.298928e-48 | 3.146371e-46 |
MsaG029483 | MsaG046703 | 0.803519 | 5.648137e-49 | 8.273948e-47 |
MsaG029483 | MsaG046746 | 0.830704 | 4.551813e-55 | 1.344020e-52 |
MsaG029483 | MsaG046802 | 0.877414 | 1.338087e-68 | 2.143839e-65 |
MsaG029483 | MsaG046862 | 0.808513 | 5.084888e-50 | 8.377672e-48 |
MsaG029483 | MsaG047067 | 0.800814 | 2.021925e-48 | 2.784450e-46 |
MsaG029483 | MsaG047194 | 0.806891 | 1.120122e-49 | 1.775208e-47 |
MsaG029483 | MsaG002437 | 0.801817 | 1.262889e-48 | 1.779166e-46 |
MsaG029483 | MsaG000837 | 0.857313 | 3.459300e-62 | 2.431555e-59 |
MsaG029483 | MsaG001986 | 0.816068 | 1.160367e-51 | 2.304590e-49 |
MsaG029483 | MsaG002984 | 0.812117 | 8.559108e-51 | 1.539308e-48 |
MsaG029483 | MsaG002433 | 0.823206 | 2.769838e-53 | 6.635711e-51 |
MsaG029483 | MsaG003009 | 0.810442 | 1.968338e-50 | 3.397913e-48 |
MsaG029483 | MsaG003742 | 0.845931 | 5.609001e-59 | 2.650358e-56 |
MsaG029483 | MsaG008854 | 0.866338 | 6.158174e-65 | 6.137909e-62 |
MsaG029483 | MsaG007366 | 0.831529 | 2.860526e-55 | 8.651077e-53 |
MsaG029483 | MsaG013401 | 0.821281 | 7.709258e-53 | 1.754078e-50 |
MsaG029483 | MsaG015244 | 0.895437 | 2.160136e-75 | 8.518163e-72 |
MsaG029483 | MsaG013406 | 0.822933 | 3.205449e-53 | 7.622898e-51 |
MsaG029483 | MsaG014449 | 0.834473 | 5.342854e-56 | 1.761716e-53 |
MsaG029483 | MsaG014358 | 0.821280 | 7.713952e-53 | 1.755092e-50 |
MsaG029483 | MsaG011654 | 0.824810 | 1.169461e-53 | 2.926539e-51 |
MsaG029483 | MsaG014180 | 0.827409 | 2.836909e-54 | 7.630274e-52 |
MsaG029483 | MsaG014177 | 0.816076 | 1.155824e-51 | 2.296030e-49 |
MsaG029483 | MsaG013405 | 0.819071 | 2.459318e-52 | 5.278318e-50 |
MsaG029483 | MsaG013372 | 0.821823 | 5.785945e-53 | 1.335479e-50 |
MsaG029483 | MsaG015300 | 0.822153 | 4.858213e-53 | 1.131286e-50 |
MsaG029483 | MsaG011352 | 0.809698 | 2.841884e-50 | 4.817859e-48 |
MsaG029483 | MsaG013014 | 0.813057 | 5.343184e-51 | 9.837423e-49 |
MsaG029483 | MsaG019027 | 0.815776 | 1.346947e-51 | 2.655383e-49 |
MsaG029483 | MsaG026431 | 0.815963 | 1.224256e-51 | 2.425089e-49 |
MsaG029483 | MsaG029575 | 0.816013 | 1.193448e-51 | 2.366983e-49 |
MsaG029483 | MsaG028127 | 0.815052 | 1.948230e-51 | 3.770976e-49 |
MsaG029483 | MsaG032410 | 0.817712 | 4.981996e-52 | 1.032118e-49 |
MsaG029483 | MsaG032342 | 0.836809 | 1.377919e-56 | 4.873222e-54 |
MsaG029483 | MsaG030924 | 0.832474 | 1.674953e-55 | 5.206811e-53 |
MsaG029483 | MsaG031734 | 0.826541 | 4.566332e-54 | 1.198746e-51 |
MsaG029483 | MsaG030190 | 0.838803 | 4.261391e-57 | 1.602468e-54 |
MsaG029483 | MsaG031290 | 0.816116 | 1.132379e-51 | 2.251759e-49 |
MsaG029483 | MsaG030000 | 0.811562 | 1.128647e-50 | 2.002417e-48 |
MsaG029483 | MsaG040848 | 0.847191 | 2.550630e-59 | 1.257028e-56 |
MsaG029483 | MsaG036784 | 0.875005 | 8.968230e-68 | 1.289993e-64 |
MsaG029483 | MsaG036873 | 0.844414 | 1.436103e-58 | 6.454516e-56 |
MsaG029483 | MsaG037271 | 0.829189 | 1.061046e-54 | 2.999985e-52 |
MsaG029483 | MsaG037249 | 0.811860 | 9.730028e-51 | 1.738953e-48 |
MsaG029483 | MsaG037156 | 0.833161 | 1.133376e-55 | 3.595002e-53 |
MsaG029483 | MsaG040777 | 0.830287 | 5.748798e-55 | 1.677469e-52 |
MsaG029483 | MsaG038711 | 0.866751 | 4.555725e-65 | 4.618768e-62 |
MsaG029483 | MsaG036671 | 0.815112 | 1.889620e-51 | 3.663056e-49 |
MsaG029483 | MsaG036984 | 0.802860 | 7.718229e-49 | 1.113549e-46 |
MsaG029483 | MsaG044032 | 0.832780 | 1.408054e-55 | 4.416322e-53 |
MsaG029483 | MsaG042524 | 0.854674 | 2.030295e-61 | 1.296438e-58 |
MsaG029483 | MsaG042698 | 0.863425 | 4.992812e-64 | 4.431192e-61 |
MsaG029483 | MsaG042234 | 0.808917 | 4.172314e-50 | 6.941416e-48 |
MsaG029483 | MsaG042299 | 0.835530 | 2.901331e-56 | 9.873988e-54 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG029483 | MtrunA17_Chr7g0224601 | 87.075 | 147 | 17 | 1 | 64 | 208 | 12 | 158 | 1.29e-78 | 237 |
MsaG029483 | MtrunA17_Chr8g0392781 | 72.535 | 142 | 39 | 0 | 64 | 205 | 22 | 163 | 9.59e-64 | 201 |
MsaG029483 | MtrunA17_Chr1g0177151 | 68.310 | 142 | 45 | 0 | 66 | 207 | 20 | 161 | 5.08e-62 | 194 |
MsaG029483 | MtrunA17_Chr3g0099561 | 74.603 | 126 | 32 | 0 | 80 | 205 | 26 | 151 | 5.37e-58 | 185 |
MsaG029483 | MtrunA17_Chr6g0477171 | 71.429 | 105 | 30 | 0 | 101 | 205 | 45 | 149 | 1.23e-42 | 144 |
MsaG029483 | MtrunA17_Chr3g0083821 | 60.909 | 110 | 39 | 1 | 96 | 205 | 14 | 119 | 5.85e-39 | 130 |
MsaG029483 | MtrunA17_Chr5g0444621 | 75.581 | 86 | 21 | 0 | 120 | 205 | 60 | 145 | 1.54e-37 | 131 |
MsaG029483 | MtrunA17_Chr5g0444631 | 84.615 | 52 | 8 | 0 | 154 | 205 | 4 | 55 | 4.59e-26 | 95.5 |
MsaG029483 | MtrunA17_Chr6g0477181 | 81.579 | 38 | 7 | 0 | 64 | 101 | 22 | 59 | 1.12e-13 | 64.3 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG029483 | AT3G20800.1 | 65.734 | 143 | 49 | 0 | 63 | 205 | 22 | 164 | 1.32e-56 | 182 |
MsaG029483 | AT5G12980.1 | 62.879 | 132 | 49 | 0 | 74 | 205 | 29 | 160 | 4.83e-51 | 167 |
MsaG029483 | AT2G32550.2 | 40.517 | 116 | 64 | 1 | 95 | 205 | 67 | 182 | 2.15e-14 | 70.9 |
MsaG029483 | AT2G32550.3 | 41.905 | 105 | 56 | 1 | 106 | 205 | 39 | 143 | 7.27e-14 | 68.9 |
Find 41 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
CAGACCTTGCACCTTTATTA+TGG | 0.198406 | 5:-77625740 | MsaT029483.1:CDS |
CAAGTCTTAAATGCTCAAAT+TGG | 0.237750 | 5:+77621039 | None:intergenic |
AACTCAGCAATCCTGATCTA+AGG | 0.276656 | 5:-77627258 | MsaT029483.1:CDS |
CCTTTATTATGGAATTCTTA+TGG | 0.279542 | 5:-77625729 | MsaT029483.1:CDS |
CAATGTTCTGGCACTACTTC+AGG | 0.316358 | 5:-77621638 | MsaT029483.1:intron |
AGTTGTTGCGGCTGGATTGC+TGG | 0.331413 | 5:-77634459 | MsaT029483.1:intron |
CCATAAGAATTCCATAATAA+AGG | 0.371929 | 5:+77625729 | None:intergenic |
CATAATAAAGGTGCAAGGTC+TGG | 0.376558 | 5:+77625741 | None:intergenic |
AAGGTTGACGTCGTTCTTCA+AGG | 0.407633 | 5:-77634077 | MsaT029483.1:intron |
CATTTAAGACTTGCTAGTCT+TGG | 0.419357 | 5:-77621029 | MsaT029483.1:CDS |
CTAACTCGCTTGTCGTTTGA+AGG | 0.424446 | 5:+77621063 | None:intergenic |
TTGTGCAGTGGTGCTAGATT+GGG | 0.436163 | 5:+77627312 | None:intergenic |
TCGCTTGTCGTTTGAAGGAA+TGG | 0.449153 | 5:+77621068 | None:intergenic |
TTTGTGCAGTGGTGCTAGAT+TGG | 0.458174 | 5:+77627311 | None:intergenic |
AACTCGTGTGTGCAATGTTC+TGG | 0.463403 | 5:-77621650 | MsaT029483.1:CDS |
TGTGCTGGAGTTGTTGCGGC+TGG | 0.480169 | 5:-77634467 | MsaT029483.1:CDS |
CTGGCGGTCAAGCATCGGCT+TGG | 0.481552 | 5:-77634129 | MsaT029483.1:CDS |
TGCTCTTCGTGTTCTCTCCA+AGG | 0.482455 | 5:-77627230 | MsaT029483.1:intron |
CCTCTCTGGCGGTCAAGCAT+CGG | 0.484432 | 5:-77634134 | MsaT029483.1:CDS |
AAGTCTTAAATGCTCAAATT+GGG | 0.487572 | 5:+77621040 | None:intergenic |
TGCACAAAGCATGGCATCCA+TGG | 0.501829 | 5:-77627296 | MsaT029483.1:CDS |
TTCAAGAACAAGGCGTTCCA+TGG | 0.504073 | 5:+77627279 | None:intergenic |
AGATTCAACAGCGGTAGAGT+AGG | 0.549429 | 5:+77621688 | None:intergenic |
GATACGTTCGACGGTTGTGC+TGG | 0.558179 | 5:-77634482 | MsaT029483.1:CDS |
ATCTGACACATCTCATTATG+CGG | 0.559158 | 5:+77634167 | None:intergenic |
GGATGCCATGCTTTGTGCAG+TGG | 0.561228 | 5:+77627300 | None:intergenic |
ACTCAGCAATCCTGATCTAA+GGG | 0.564912 | 5:-77627257 | MsaT029483.1:CDS |
CTTGCTAGTCTTGGAGTCAT+CGG | 0.568027 | 5:-77621020 | MsaT029483.1:CDS |
TCTGACACATCTCATTATGC+GGG | 0.579718 | 5:+77634168 | None:intergenic |
TAGCACCACTGCACAAAGCA+TGG | 0.592070 | 5:-77627305 | MsaT029483.1:CDS |
AGTCATCGGTGCGTTAGTGA+AGG | 0.630469 | 5:-77621006 | MsaT029483.1:intron |
TACCGCCACTGTCATCCTCA+AGG | 0.630654 | 5:-77634096 | MsaT029483.1:CDS |
CGGTTGTGCTGGAGTTGTTG+CGG | 0.636159 | 5:-77634471 | MsaT029483.1:CDS |
GAAGAACGACGTCAACCTTG+AGG | 0.650785 | 5:+77634081 | None:intergenic |
AATTCCATAATAAAGGTGCA+AGG | 0.655845 | 5:+77625736 | None:intergenic |
TTGAGGATGACAGTGGCGGT+AGG | 0.663707 | 5:+77634098 | None:intergenic |
CCGATGCTTGACCGCCAGAG+AGG | 0.670253 | 5:+77634134 | None:intergenic |
GATTGCTGAGTTCAAGAACA+AGG | 0.671470 | 5:+77627269 | None:intergenic |
AACCTTGAGGATGACAGTGG+CGG | 0.692981 | 5:+77634094 | None:intergenic |
GTCAACCTTGAGGATGACAG+TGG | 0.746342 | 5:+77634091 | None:intergenic |
GCTTGAGTAAGATTCAACAG+CGG | 0.799751 | 5:+77621679 | None:intergenic |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr5 | gene | 77620859 | 77634522 | 77620859 | ID=MsaG029483 |
Chr5 | mRNA | 77620859 | 77634522 | 77620859 | ID=MsaT029483.1;Parent=MsaG029483 |
Chr5 | exon | 77620859 | 77620873 | 77620859 | ID=MsaT029483.1.exon8;Parent=MsaT029483.1 |
Chr5 | CDS | 77620859 | 77620873 | 77620859 | ID=cds.MsaT029483.1;Parent=MsaT029483.1 |
Chr5 | exon | 77621007 | 77621113 | 77621007 | ID=MsaT029483.1.exon7;Parent=MsaT029483.1 |
Chr5 | CDS | 77621007 | 77621113 | 77621007 | ID=cds.MsaT029483.1;Parent=MsaT029483.1 |
Chr5 | exon | 77621406 | 77621448 | 77621406 | ID=MsaT029483.1.exon6;Parent=MsaT029483.1 |
Chr5 | CDS | 77621406 | 77621448 | 77621406 | ID=cds.MsaT029483.1;Parent=MsaT029483.1 |
Chr5 | exon | 77621639 | 77621728 | 77621639 | ID=MsaT029483.1.exon5;Parent=MsaT029483.1 |
Chr5 | CDS | 77621639 | 77621728 | 77621639 | ID=cds.MsaT029483.1;Parent=MsaT029483.1 |
Chr5 | exon | 77625707 | 77625778 | 77625707 | ID=MsaT029483.1.exon4;Parent=MsaT029483.1 |
Chr5 | CDS | 77625707 | 77625778 | 77625707 | ID=cds.MsaT029483.1;Parent=MsaT029483.1 |
Chr5 | exon | 77627231 | 77627343 | 77627231 | ID=MsaT029483.1.exon3;Parent=MsaT029483.1 |
Chr5 | CDS | 77627231 | 77627343 | 77627231 | ID=cds.MsaT029483.1;Parent=MsaT029483.1 |
Chr5 | exon | 77634078 | 77634204 | 77634078 | ID=MsaT029483.1.exon2;Parent=MsaT029483.1 |
Chr5 | CDS | 77634078 | 77634204 | 77634078 | ID=cds.MsaT029483.1;Parent=MsaT029483.1 |
Chr5 | exon | 77634460 | 77634522 | 77634460 | ID=MsaT029483.1.exon1;Parent=MsaT029483.1 |
Chr5 | CDS | 77634460 | 77634522 | 77634460 | ID=cds.MsaT029483.1;Parent=MsaT029483.1 |
Gene Sequence |
Protein sequence |