Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG029938 | sp|Q9LJX1|PRE5_ARATH | 76.923 | 91 | 20 | 1 | 1 | 90 | 1 | 91 | 9.07e-42 | 134 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG029938 | tr|A0A072UGS5|A0A072UGS5_MEDTR | 100.000 | 92 | 0 | 0 | 1 | 92 | 1 | 92 | 8.39e-56 | 176 |
| Gene ID | Type | Classification |
|---|---|---|
| MsaG029938 | TF | bHLH |
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG029938 | MtrunA17_Chr6g0453041 | 100.000 | 92 | 0 | 0 | 1 | 92 | 1 | 92 | 1.62e-59 | 176 |
| MsaG029938 | MtrunA17_Chr7g0217141 | 84.946 | 93 | 13 | 1 | 1 | 92 | 1 | 93 | 8.23e-48 | 147 |
| MsaG029938 | MtrunA17_Chr5g0416431 | 68.421 | 76 | 24 | 0 | 15 | 90 | 17 | 92 | 4.15e-33 | 110 |
| MsaG029938 | MtrunA17_Chr8g0362131 | 69.880 | 83 | 24 | 1 | 8 | 90 | 10 | 91 | 5.13e-33 | 109 |
| MsaG029938 | MtrunA17_Chr3g0093001 | 73.077 | 78 | 19 | 1 | 15 | 92 | 17 | 92 | 9.80e-33 | 108 |
| MsaG029938 | MtrunA17_Chr7g0237771 | 49.351 | 77 | 36 | 1 | 1 | 77 | 1 | 74 | 6.46e-13 | 58.9 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG029938 | AT3G28857.1 | 76.923 | 91 | 20 | 1 | 1 | 90 | 1 | 91 | 9.22e-43 | 134 |
| MsaG029938 | AT5G39860.1 | 75.000 | 80 | 19 | 1 | 12 | 90 | 12 | 91 | 3.48e-36 | 118 |
| MsaG029938 | AT1G26945.1 | 77.333 | 75 | 17 | 0 | 17 | 91 | 19 | 93 | 2.25e-35 | 116 |
| MsaG029938 | AT5G15160.1 | 72.368 | 76 | 20 | 1 | 17 | 91 | 18 | 93 | 5.23e-33 | 110 |
| MsaG029938 | AT1G74500.1 | 67.089 | 79 | 23 | 2 | 15 | 92 | 17 | 93 | 2.29e-29 | 100 |
| MsaG029938 | AT3G47710.1 | 61.702 | 94 | 32 | 3 | 1 | 92 | 1 | 92 | 7.58e-29 | 99.8 |
Find 12 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| CTAAAGCTTATTGATTAATT+AGG | 0.226540 | 6:-43916 | None:intergenic |
| TGAAAGATTATCTCAGTTAT+TGG | 0.286390 | 6:+43850 | MsaT029938.1:CDS |
| TGTAGTTGCAAGTCTCTTGT+AGG | 0.341927 | 6:-43793 | None:intergenic |
| AGGAACAAGTTGACGTAACT+TGG | 0.402465 | 6:-41502 | None:intergenic |
| TGTGCAGGTATCAGCATCTA+AGG | 0.416549 | 6:+43769 | MsaT029938.1:intron |
| TTGTTCCTGAGATTCGTCAT+AGG | 0.480384 | 6:+41517 | MsaT029938.1:CDS |
| GAACGCCTATGACGAATCTC+AGG | 0.525453 | 6:-41522 | None:intergenic |
| TCGTCATAGGCGTTCAGATA+AGG | 0.525461 | 6:+41530 | MsaT029938.1:CDS |
| CTTCTGATAATATTAGCCTC+TGG | 0.544212 | 6:-43893 | None:intergenic |
| TATATATTATGTCTAGCAGA+AGG | 0.605924 | 6:+41421 | None:intergenic |
| TTATGTCTAGCAGAAGGTCA+AGG | 0.634096 | 6:+41427 | None:intergenic |
| AATTGATGCTGATAGTCCAG+AGG | 0.714162 | 6:+43877 | MsaT029938.1:CDS |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| Chr6 | gene | 41429 | 43931 | 41429 | ID=MsaG029938 |
| Chr6 | mRNA | 41429 | 43931 | 41429 | ID=MsaT029938.1;Parent=MsaG029938 |
| Chr6 | exon | 41429 | 41551 | 41429 | ID=MsaT029938.1.exon1;Parent=MsaT029938.1 |
| Chr6 | CDS | 41429 | 41551 | 41429 | ID=cds.MsaT029938.1;Parent=MsaT029938.1 |
| Chr6 | exon | 43776 | 43931 | 43776 | ID=MsaT029938.1.exon2;Parent=MsaT029938.1 |
| Chr6 | CDS | 43776 | 43931 | 43776 | ID=cds.MsaT029938.1;Parent=MsaT029938.1 |
| Gene Sequence |
| Protein sequence |
