Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG031821 | PNX89196.1 | 74.742 | 194 | 49 | 0 | 58 | 251 | 5 | 198 | 1.90e-95 | 295 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG031821 | sp|Q9LKR4|FRS10_ARATH | 34.568 | 162 | 102 | 3 | 88 | 246 | 61 | 221 | 5.54e-18 | 89.0 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG031821 | tr|A0A2K3MEL2|A0A2K3MEL2_TRIPR | 74.742 | 194 | 49 | 0 | 58 | 251 | 5 | 198 | 9.05e-96 | 295 |
Gene ID | Type | Classification |
---|---|---|
MsaG031821 | TF | FAR1 |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000117 | MsaG031821 | 0.825503 | 8.033689e-54 | 2.049046e-51 |
MsaG000128 | MsaG031821 | 0.829166 | 1.074698e-54 | 3.036718e-52 |
MsaG000352 | MsaG031821 | 0.803682 | 5.227123e-49 | 7.686019e-47 |
MsaG000559 | MsaG031821 | 0.841262 | 9.800953e-58 | 3.981109e-55 |
MsaG000528 | MsaG031821 | 0.804515 | 3.514111e-49 | 5.267883e-47 |
MsaG000546 | MsaG031821 | 0.814073 | 3.202204e-51 | 6.047366e-49 |
MsaG000550 | MsaG031821 | 0.819278 | 2.207830e-52 | 4.764384e-50 |
MsaG000584 | MsaG031821 | 0.861445 | 2.015260e-63 | 1.655467e-60 |
MsaG000759 | MsaG031821 | 0.834472 | 5.344634e-56 | 1.762268e-53 |
MsaG000762 | MsaG031821 | 0.855626 | 1.076904e-61 | 7.116943e-59 |
MsaG000942 | MsaG031821 | 0.801856 | 1.239762e-48 | 1.748126e-46 |
MsaG001057 | MsaG031821 | 0.869702 | 5.157184e-66 | 5.902213e-63 |
MsaG001306 | MsaG031821 | 0.802371 | 9.726552e-49 | 1.387714e-46 |
MsaG001514 | MsaG031821 | 0.839960 | 2.140371e-57 | 8.345106e-55 |
MsaG001728 | MsaG031821 | 0.823003 | 3.087557e-53 | 7.356473e-51 |
MsaG001809 | MsaG031821 | 0.801848 | 1.244243e-48 | 1.754127e-46 |
MsaG002170 | MsaG031821 | 0.820906 | 9.400302e-53 | 2.117621e-50 |
MsaG003161 | MsaG031821 | 0.836813 | 1.375118e-56 | 4.863820e-54 |
MsaG003703 | MsaG031821 | 0.866401 | 5.878694e-65 | 5.875019e-62 |
MsaG003964 | MsaG031821 | 0.802514 | 9.091113e-49 | 1.301296e-46 |
MsaG004164 | MsaG031821 | 0.808526 | 5.052700e-50 | 8.327282e-48 |
MsaG004264 | MsaG031821 | 0.848719 | 9.712882e-60 | 5.038964e-57 |
MsaG004277 | MsaG031821 | 0.817904 | 4.510875e-52 | 9.391729e-50 |
MsaG004320 | MsaG031821 | 0.801951 | 1.185801e-48 | 1.675604e-46 |
MsaG004370 | MsaG031821 | 0.817681 | 5.060487e-52 | 1.047553e-49 |
MsaG004344 | MsaG031821 | 0.828599 | 1.472095e-54 | 4.093890e-52 |
MsaG004349 | MsaG031821 | 0.808020 | 6.469551e-50 | 1.053352e-47 |
MsaG004385 | MsaG031821 | 0.809817 | 2.679675e-50 | 4.556052e-48 |
MsaG004544 | MsaG031821 | 0.811613 | 1.100279e-50 | 1.954534e-48 |
MsaG004744 | MsaG031821 | 0.811473 | 1.180040e-50 | 2.089028e-48 |
MsaG004745 | MsaG031821 | 0.803963 | 4.572647e-49 | 6.767688e-47 |
MsaG004749 | MsaG031821 | 0.813665 | 3.933956e-51 | 7.353685e-49 |
MsaG004801 | MsaG031821 | 0.820953 | 9.168874e-53 | 2.068126e-50 |
MsaG004849 | MsaG031821 | 0.827620 | 2.526449e-54 | 6.835687e-52 |
MsaG004881 | MsaG031821 | 0.805534 | 2.155848e-49 | 3.309107e-47 |
MsaG004934 | MsaG031821 | 0.822158 | 4.845319e-53 | 1.128425e-50 |
MsaG004938 | MsaG031821 | 0.801475 | 1.482731e-48 | 2.072660e-46 |
MsaG004984 | MsaG031821 | 0.813834 | 3.613026e-51 | 6.782757e-49 |
MsaG004990 | MsaG031821 | 0.836542 | 1.610803e-56 | 5.651117e-54 |
MsaG005310 | MsaG031821 | 0.805815 | 1.883200e-49 | 2.909748e-47 |
MsaG005289 | MsaG031821 | 0.852169 | 1.054704e-60 | 6.163135e-58 |
MsaG005386 | MsaG031821 | 0.801879 | 1.226417e-48 | 1.730217e-46 |
MsaG005584 | MsaG031821 | 0.806795 | 1.173324e-49 | 1.855375e-47 |
MsaG005993 | MsaG031821 | 0.805657 | 2.032385e-49 | 3.128633e-47 |
MsaG006035 | MsaG031821 | 0.823698 | 2.128188e-53 | 5.167259e-51 |
MsaG006307 | MsaG031821 | 0.805814 | 1.884359e-49 | 2.911458e-47 |
MsaG006469 | MsaG031821 | 0.806219 | 1.550181e-49 | 2.418264e-47 |
MsaG006901 | MsaG031821 | 0.846439 | 4.085301e-59 | 1.963204e-56 |
MsaG006942 | MsaG031821 | 0.865170 | 1.433360e-64 | 1.363557e-61 |
MsaG006956 | MsaG031821 | 0.867952 | 1.889305e-65 | 2.011207e-62 |
MsaG007413 | MsaG031821 | 0.804397 | 3.717054e-49 | 5.557002e-47 |
MsaG007480 | MsaG031821 | 0.815385 | 1.645105e-51 | 3.211258e-49 |
MsaG007641 | MsaG031821 | 0.827199 | 3.185019e-54 | 8.516035e-52 |
MsaG007646 | MsaG031821 | 0.806473 | 1.371065e-49 | 2.151769e-47 |
MsaG007652 | MsaG031821 | 0.820846 | 9.702618e-53 | 2.182128e-50 |
MsaG007655 | MsaG031821 | 0.828390 | 1.651871e-54 | 4.567169e-52 |
MsaG008081 | MsaG031821 | 0.801478 | 1.480953e-48 | 2.070303e-46 |
MsaG008166 | MsaG031821 | 0.837165 | 1.118687e-56 | 3.999351e-54 |
MsaG008225 | MsaG031821 | 0.842315 | 5.184617e-58 | 2.177801e-55 |
MsaG008256 | MsaG031821 | 0.821702 | 6.172086e-53 | 1.420029e-50 |
MsaG008291 | MsaG031821 | 0.806567 | 1.309811e-49 | 2.060175e-47 |
MsaG008368 | MsaG031821 | 0.832695 | 1.477243e-55 | 4.621730e-53 |
MsaG008442 | MsaG031821 | 0.804127 | 4.227261e-49 | 6.280482e-47 |
MsaG008405 | MsaG031821 | 0.835393 | 3.140435e-56 | 1.064372e-53 |
MsaG008693 | MsaG031821 | 0.818869 | 2.732259e-52 | 5.832915e-50 |
MsaG009179 | MsaG031821 | 0.855649 | 1.060471e-61 | 7.014182e-59 |
MsaG009184 | MsaG031821 | 0.816701 | 8.387028e-52 | 1.692941e-49 |
MsaG009472 | MsaG031821 | 0.822803 | 3.436554e-53 | 8.143834e-51 |
MsaG009672 | MsaG031821 | 0.830733 | 4.477344e-55 | 1.323177e-52 |
MsaG009781 | MsaG031821 | 0.829323 | 9.847858e-55 | 2.795171e-52 |
MsaG009859 | MsaG031821 | 0.804693 | 3.227056e-49 | 4.857571e-47 |
MsaG010213 | MsaG031821 | 0.822675 | 3.678880e-53 | 8.687834e-51 |
MsaG010275 | MsaG031821 | 0.813491 | 4.294065e-51 | 7.991869e-49 |
MsaG010628 | MsaG031821 | 0.808384 | 5.415483e-50 | 8.894513e-48 |
MsaG011506 | MsaG031821 | 0.824328 | 1.516845e-53 | 3.746407e-51 |
MsaG011915 | MsaG031821 | 0.804623 | 3.336358e-49 | 5.013979e-47 |
MsaG011997 | MsaG031821 | 0.834789 | 4.452941e-56 | 1.482226e-53 |
MsaG012047 | MsaG031821 | 0.860479 | 3.949103e-63 | 3.127545e-60 |
MsaG012248 | MsaG031821 | 0.834598 | 4.972940e-56 | 1.645863e-53 |
MsaG012331 | MsaG031821 | 0.813453 | 4.377783e-51 | 8.140098e-49 |
MsaG013245 | MsaG031821 | 0.839834 | 2.308255e-57 | 8.964155e-55 |
MsaG014194 | MsaG031821 | 0.832734 | 1.445386e-55 | 4.527415e-53 |
MsaG014725 | MsaG031821 | 0.812763 | 6.192489e-51 | 1.131735e-48 |
MsaG015294 | MsaG031821 | 0.829813 | 7.492565e-55 | 2.156794e-52 |
MsaG015852 | MsaG031821 | 0.806154 | 1.599690e-49 | 2.491542e-47 |
MsaG016812 | MsaG031821 | 0.806799 | 1.171148e-49 | 1.852088e-47 |
MsaG017256 | MsaG031821 | 0.858927 | 1.152088e-62 | 8.599844e-60 |
MsaG017270 | MsaG031821 | 0.802016 | 1.149963e-48 | 1.627352e-46 |
MsaG017464 | MsaG031821 | 0.830401 | 5.394158e-55 | 1.579148e-52 |
MsaG017723 | MsaG031821 | 0.800100 | 2.822027e-48 | 3.824090e-46 |
MsaG017779 | MsaG031821 | 0.803204 | 6.558561e-49 | 9.537940e-47 |
MsaG017784 | MsaG031821 | 0.829414 | 9.363131e-55 | 2.664562e-52 |
MsaG018045 | MsaG031821 | 0.804099 | 4.284285e-49 | 6.361256e-47 |
MsaG018465 | MsaG031821 | 0.830857 | 4.176306e-55 | 1.238689e-52 |
MsaG018417 | MsaG031821 | 0.802173 | 1.067889e-48 | 1.516638e-46 |
MsaG018671 | MsaG031821 | 0.830593 | 4.844737e-55 | 1.425971e-52 |
MsaG018809 | MsaG031821 | 0.814566 | 2.494602e-51 | 4.769621e-49 |
MsaG018928 | MsaG031821 | 0.800979 | 1.871832e-48 | 2.587293e-46 |
MsaG019130 | MsaG031821 | 0.810227 | 2.188701e-50 | 3.758427e-48 |
MsaG019206 | MsaG031821 | 0.831497 | 2.912551e-55 | 8.800107e-53 |
MsaG019422 | MsaG031821 | 0.856344 | 6.654688e-62 | 4.514700e-59 |
MsaG019656 | MsaG031821 | 0.829884 | 7.204379e-55 | 2.078111e-52 |
MsaG019772 | MsaG031821 | 0.815986 | 1.209940e-51 | 2.398081e-49 |
MsaG019927 | MsaG031821 | 0.804931 | 2.879253e-49 | 4.358110e-47 |
MsaG020294 | MsaG031821 | 0.821630 | 6.410510e-53 | 1.472074e-50 |
MsaG020559 | MsaG031821 | 0.826343 | 5.087763e-54 | 1.328329e-51 |
MsaG020748 | MsaG031821 | 0.829964 | 6.887717e-55 | 1.991354e-52 |
MsaG020784 | MsaG031821 | 0.832099 | 2.072647e-55 | 6.373665e-53 |
MsaG020888 | MsaG031821 | 0.825524 | 7.945043e-54 | 2.027681e-51 |
MsaG021520 | MsaG031821 | 0.800554 | 2.282525e-48 | 3.125027e-46 |
MsaG022227 | MsaG031821 | 0.808295 | 5.657374e-50 | 9.272036e-48 |
MsaG022780 | MsaG031821 | 0.821495 | 6.886997e-53 | 1.575819e-50 |
MsaG023153 | MsaG031821 | 0.829377 | 9.558202e-55 | 2.717170e-52 |
MsaG023474 | MsaG031821 | 0.802270 | 1.020096e-48 | 1.452000e-46 |
MsaG023810 | MsaG031821 | 0.825111 | 9.936952e-54 | 2.507296e-51 |
MsaG023887 | MsaG031821 | 0.830755 | 4.423077e-55 | 1.307984e-52 |
MsaG023991 | MsaG031821 | 0.844029 | 1.819457e-58 | 8.074641e-56 |
MsaG024331 | MsaG031821 | 0.810134 | 2.291891e-50 | 3.926609e-48 |
MsaG025845 | MsaG031821 | 0.807467 | 8.468794e-50 | 1.360638e-47 |
MsaG025861 | MsaG031821 | 0.825948 | 6.309069e-54 | 1.629297e-51 |
MsaG027022 | MsaG031821 | 0.820346 | 1.261984e-52 | 2.801234e-50 |
MsaG027136 | MsaG031821 | 0.811550 | 1.135851e-50 | 2.014566e-48 |
MsaG027160 | MsaG031821 | 0.804481 | 3.570328e-49 | 5.348016e-47 |
MsaG027672 | MsaG031821 | 0.818899 | 2.690774e-52 | 5.748742e-50 |
MsaG027745 | MsaG031821 | 0.800484 | 2.358669e-48 | 3.224099e-46 |
MsaG028510 | MsaG031821 | 0.803387 | 6.013971e-49 | 8.782958e-47 |
MsaG028488 | MsaG031821 | 0.809954 | 2.504997e-50 | 4.273048e-48 |
MsaG028529 | MsaG031821 | 0.812147 | 8.431401e-51 | 1.517465e-48 |
MsaG028645 | MsaG031821 | 0.818730 | 2.937619e-52 | 6.248391e-50 |
MsaG028664 | MsaG031821 | 0.800747 | 2.085736e-48 | 2.868060e-46 |
MsaG028713 | MsaG031821 | 0.805769 | 1.925360e-49 | 2.971675e-47 |
MsaG028862 | MsaG031821 | 0.829866 | 7.276679e-55 | 2.097900e-52 |
MsaG028961 | MsaG031821 | 0.820258 | 1.321794e-52 | 2.927220e-50 |
MsaG028905 | MsaG031821 | 0.832092 | 2.080160e-55 | 6.395643e-53 |
MsaG028990 | MsaG031821 | 0.811087 | 1.429586e-50 | 2.506979e-48 |
MsaG029132 | MsaG031821 | 0.802707 | 8.298886e-49 | 1.193117e-46 |
MsaG029328 | MsaG031821 | 0.829589 | 8.489811e-55 | 2.428378e-52 |
MsaG029360 | MsaG031821 | 0.803401 | 5.973979e-49 | 8.727302e-47 |
MsaG029362 | MsaG031821 | 0.829826 | 7.439333e-55 | 2.142301e-52 |
MsaG029710 | MsaG031821 | 0.800008 | 2.945563e-48 | 3.983382e-46 |
MsaG029735 | MsaG031821 | 0.816390 | 9.839424e-52 | 1.970318e-49 |
MsaG029789 | MsaG031821 | 0.823627 | 2.211457e-53 | 5.358985e-51 |
MsaG030267 | MsaG031821 | 0.847823 | 1.712644e-59 | 8.622438e-57 |
MsaG030237 | MsaG031821 | 0.816372 | 9.930077e-52 | 1.987589e-49 |
MsaG030388 | MsaG031821 | 0.804308 | 3.879183e-49 | 5.787502e-47 |
MsaG030548 | MsaG031821 | 0.813471 | 4.338515e-51 | 8.070602e-49 |
MsaG031393 | MsaG031821 | 0.825848 | 6.660616e-54 | 1.715242e-51 |
MsaG031819 | MsaG031821 | 0.811359 | 1.248732e-50 | 2.204453e-48 |
MsaG031821 | MsaG033961 | 0.849182 | 7.230504e-60 | 3.811290e-57 |
MsaG031821 | MsaG034149 | 0.816375 | 9.917076e-52 | 1.985105e-49 |
MsaG031821 | MsaG034173 | 0.819810 | 1.672215e-52 | 3.659141e-50 |
MsaG031821 | MsaG035644 | 0.809361 | 3.354169e-50 | 5.640052e-48 |
MsaG031821 | MsaG036062 | 0.813717 | 3.831369e-51 | 7.171385e-49 |
MsaG031821 | MsaG036444 | 0.807747 | 7.391004e-50 | 1.195471e-47 |
MsaG031821 | MsaG036714 | 0.822968 | 3.145865e-53 | 7.488422e-51 |
MsaG031821 | MsaG036718 | 0.820125 | 1.417274e-52 | 3.127532e-50 |
MsaG031821 | MsaG037874 | 0.833265 | 1.067699e-55 | 3.396936e-53 |
MsaG031821 | MsaG039424 | 0.842069 | 6.017997e-58 | 2.508155e-55 |
MsaG031821 | MsaG039458 | 0.801642 | 1.371440e-48 | 1.924370e-46 |
MsaG031821 | MsaG040171 | 0.801978 | 1.170909e-48 | 1.655592e-46 |
MsaG031821 | MsaG040191 | 0.820549 | 1.134153e-52 | 2.530946e-50 |
MsaG031821 | MsaG040480 | 0.836584 | 1.571652e-56 | 5.520605e-54 |
MsaG031821 | MsaG040747 | 0.824741 | 1.214134e-53 | 3.032516e-51 |
MsaG031821 | MsaG040767 | 0.816768 | 8.103223e-52 | 1.638499e-49 |
MsaG031821 | MsaG041597 | 0.815270 | 1.744352e-51 | 3.395095e-49 |
MsaG031821 | MsaG041793 | 0.824382 | 1.473617e-53 | 3.644925e-51 |
MsaG031821 | MsaG041785 | 0.800538 | 2.300301e-48 | 3.148161e-46 |
MsaG031821 | MsaG041973 | 0.819895 | 1.598893e-52 | 3.506709e-50 |
MsaG031821 | MsaG042241 | 0.800153 | 2.752342e-48 | 3.734150e-46 |
MsaG031821 | MsaG042557 | 0.801731 | 1.314975e-48 | 1.848879e-46 |
MsaG031821 | MsaG043017 | 0.834180 | 6.323639e-56 | 2.066779e-53 |
MsaG031821 | MsaG043563 | 0.823040 | 3.027038e-53 | 7.219537e-51 |
MsaG031821 | MsaG044225 | 0.815824 | 1.314589e-51 | 2.594790e-49 |
MsaG031821 | MsaG044614 | 0.818056 | 4.169393e-52 | 8.714911e-50 |
MsaG031821 | MsaG044904 | 0.819417 | 2.052983e-52 | 4.446402e-50 |
MsaG031821 | MsaG045179 | 0.803135 | 6.776645e-49 | 9.839358e-47 |
MsaG031821 | MsaG045285 | 0.823922 | 1.887435e-53 | 4.610233e-51 |
MsaG031821 | MsaG045353 | 0.807284 | 9.254895e-50 | 1.480452e-47 |
MsaG031821 | MsaG045355 | 0.812736 | 6.276387e-51 | 1.146303e-48 |
MsaG031821 | MsaG045357 | 0.815519 | 1.536351e-51 | 3.009096e-49 |
MsaG031821 | MsaG045508 | 0.804591 | 3.387695e-49 | 5.087337e-47 |
MsaG031821 | MsaG045695 | 0.806626 | 1.273105e-49 | 2.005241e-47 |
MsaG031821 | MsaG045813 | 0.802748 | 8.139968e-49 | 1.171369e-46 |
MsaG031821 | MsaG045950 | 0.820438 | 1.202425e-52 | 2.675497e-50 |
MsaG031821 | MsaG046403 | 0.835149 | 3.616627e-56 | 1.216851e-53 |
MsaG031821 | MsaG046665 | 0.807355 | 8.941436e-50 | 1.432754e-47 |
MsaG031821 | MsaG046638 | 0.848125 | 1.415528e-59 | 7.198490e-57 |
MsaG031821 | MsaG046702 | 0.848671 | 1.000896e-59 | 5.184469e-57 |
MsaG031821 | MsaG047081 | 0.819706 | 1.765305e-52 | 3.852254e-50 |
MsaG031821 | MsaG047118 | 0.840777 | 1.312579e-57 | 5.250315e-55 |
MsaG031821 | MsaG047135 | 0.816474 | 9.422959e-52 | 1.890950e-49 |
MsaG031821 | MsaG002231 | 0.802190 | 1.059236e-48 | 1.504946e-46 |
MsaG031821 | MsaG001947 | 0.814969 | 2.032258e-51 | 3.925548e-49 |
MsaG031821 | MsaG002445 | 0.836780 | 1.402079e-56 | 4.954156e-54 |
MsaG031821 | MsaG009633 | 0.831921 | 2.291866e-55 | 7.011444e-53 |
MsaG031821 | MsaG014302 | 0.842276 | 5.306656e-58 | 2.226303e-55 |
MsaG031821 | MsaG012253 | 0.810522 | 1.891481e-50 | 3.271547e-48 |
MsaG031821 | MsaG016849 | 0.813279 | 4.777985e-51 | 8.845327e-49 |
MsaG031821 | MsaG023305 | 0.803210 | 6.540656e-49 | 9.513204e-47 |
MsaG031821 | MsaG019408 | 0.803081 | 6.951205e-49 | 1.008032e-46 |
MsaG031821 | MsaG018515 | 0.822480 | 4.082243e-53 | 9.589808e-51 |
MsaG031821 | MsaG021171 | 0.812975 | 5.567148e-51 | 1.022853e-48 |
MsaG031821 | MsaG029395 | 0.800899 | 1.942543e-48 | 2.680242e-46 |
MsaG031821 | MsaG032460 | 0.800179 | 2.719759e-48 | 3.692028e-46 |
MsaG031821 | MsaG032865 | 0.808187 | 5.961767e-50 | 9.745722e-48 |
MsaG031821 | MsaG034520 | 0.810084 | 2.348975e-50 | 4.019592e-48 |
MsaG031821 | MsaG031507 | 0.841997 | 6.287816e-58 | 2.614635e-55 |
MsaG031821 | MsaG037377 | 0.851607 | 1.520093e-60 | 8.708012e-58 |
MsaG031821 | MsaG035814 | 0.841339 | 9.358348e-58 | 3.810519e-55 |
MsaG031821 | MsaG036922 | 0.809102 | 3.809873e-50 | 6.366824e-48 |
MsaG031821 | MsaG039794 | 0.840864 | 1.245822e-57 | 4.996996e-55 |
MsaG031821 | MsaG040619 | 0.822720 | 3.592204e-53 | 8.493512e-51 |
MsaG031821 | MsaG036623 | 0.839236 | 3.295553e-57 | 1.256006e-54 |
MsaG031821 | MsaG036743 | 0.809941 | 2.520834e-50 | 4.298695e-48 |
MsaG031821 | MsaG037488 | 0.823707 | 2.118000e-53 | 5.143751e-51 |
MsaG031821 | MsaG045466 | 0.836744 | 1.431699e-56 | 5.053381e-54 |
MsaG031821 | MsaG043534 | 0.825491 | 8.089588e-54 | 2.062594e-51 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG031821 | MtrunA17_Chr2g0308841 | 67.826 | 115 | 35 | 1 | 252 | 366 | 153 | 265 | 3.29e-49 | 166 |
MsaG031821 | MtrunA17_Chr1g0203051 | 33.898 | 295 | 164 | 6 | 6 | 278 | 5 | 290 | 2.68e-48 | 172 |
MsaG031821 | MtrunA17_Chr1g0171741 | 39.752 | 161 | 95 | 2 | 53 | 212 | 103 | 262 | 8.57e-33 | 123 |
MsaG031821 | MtrunA17_Chr8g0389811 | 43.307 | 127 | 72 | 0 | 67 | 193 | 69 | 195 | 1.25e-31 | 118 |
MsaG031821 | MtrunA17_Chr2g0287651 | 35.870 | 184 | 118 | 0 | 82 | 265 | 75 | 258 | 2.26e-31 | 125 |
MsaG031821 | MtrunA17_Chr2g0331371 | 41.401 | 157 | 90 | 1 | 32 | 186 | 3 | 159 | 4.05e-29 | 112 |
MsaG031821 | MtrunA17_Chr6g0473421 | 45.263 | 95 | 52 | 0 | 64 | 158 | 37 | 131 | 4.66e-24 | 96.7 |
MsaG031821 | MtrunA17_Chr1g0172931 | 36.508 | 126 | 80 | 0 | 39 | 164 | 33 | 158 | 5.01e-20 | 85.9 |
MsaG031821 | MtrunA17_Chr5g0448761 | 30.636 | 173 | 118 | 2 | 84 | 254 | 62 | 234 | 1.55e-15 | 78.2 |
MsaG031821 | MtrunA17_Chr1g0202341 | 27.746 | 173 | 120 | 3 | 83 | 254 | 52 | 220 | 2.46e-14 | 74.3 |
MsaG031821 | MtrunA17_Chr2g0276841 | 36.232 | 138 | 83 | 4 | 88 | 221 | 76 | 212 | 6.35e-14 | 73.2 |
MsaG031821 | MtrunA17_Chr2g0290391 | 31.548 | 168 | 109 | 4 | 88 | 251 | 57 | 222 | 4.97e-13 | 70.5 |
MsaG031821 | MtrunA17_Chr6g0458391 | 35.714 | 126 | 70 | 4 | 87 | 208 | 96 | 214 | 9.06e-13 | 69.7 |
MsaG031821 | MtrunA17_Chr1g0198761 | 29.775 | 178 | 102 | 7 | 88 | 249 | 53 | 223 | 2.19e-12 | 68.6 |
MsaG031821 | MtrunA17_Chr6g0451441 | 26.761 | 213 | 140 | 6 | 45 | 250 | 44 | 247 | 4.26e-11 | 63.9 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG031821 | AT5G28530.5 | 34.568 | 162 | 102 | 3 | 88 | 246 | 61 | 221 | 4.02e-19 | 89.4 |
MsaG031821 | AT5G28530.4 | 34.568 | 162 | 102 | 3 | 88 | 246 | 61 | 221 | 4.23e-19 | 89.4 |
MsaG031821 | AT5G28530.3 | 34.568 | 162 | 102 | 3 | 88 | 246 | 61 | 221 | 5.12e-19 | 89.0 |
MsaG031821 | AT5G28530.2 | 34.568 | 162 | 102 | 3 | 88 | 246 | 61 | 221 | 5.12e-19 | 89.0 |
MsaG031821 | AT5G28530.1 | 34.568 | 162 | 102 | 3 | 88 | 246 | 61 | 221 | 5.63e-19 | 89.0 |
MsaG031821 | AT4G38180.1 | 30.508 | 236 | 148 | 8 | 38 | 259 | 17 | 250 | 1.54e-15 | 78.6 |
MsaG031821 | AT1G10240.2 | 34.756 | 164 | 97 | 6 | 88 | 244 | 54 | 214 | 4.49e-15 | 77.0 |
MsaG031821 | AT1G10240.1 | 34.756 | 164 | 97 | 6 | 88 | 244 | 54 | 214 | 4.49e-15 | 77.0 |
Find 80 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
GGGGCTTTGGCAGATGCTTC+TGG | 0.082781 | 6:-36698512 | MsaT031821.1:CDS |
TTTGTTCATGTCAAGGTTAC+AGG | 0.251328 | 6:-36698796 | MsaT031821.1:CDS |
GGGCTTTGGCAGATGCTTCT+GGG | 0.266190 | 6:-36698511 | MsaT031821.1:CDS |
CTGGGCAAAACCAAACATTT+TGG | 0.278132 | 6:+36697311 | None:intergenic |
GATCACAATCATGCTATGTT+AGG | 0.329562 | 6:-36698641 | MsaT031821.1:CDS |
TGATGATCTTCCAAAATGTT+TGG | 0.355568 | 6:-36697321 | MsaT031821.1:CDS |
TCCGATTATGATAAAAGATA+TGG | 0.367150 | 6:-36698999 | MsaT031821.1:CDS |
AACTGAAAATCCTGACGTTC+TGG | 0.369216 | 6:+36698874 | None:intergenic |
AAACAATGATTTACGTTGCT+TGG | 0.383660 | 6:+36698439 | None:intergenic |
CACGAGCATTTCAAAACAAC+TGG | 0.401503 | 6:+36697410 | None:intergenic |
GGAAGTTCAAATTCAGTTGA+AGG | 0.407056 | 6:-36699049 | MsaT031821.1:CDS |
TCTTGGTTTGCCAGAACGTC+AGG | 0.409357 | 6:-36698884 | MsaT031821.1:CDS |
TCAAGGTTACAGGGAGGATA+GGG | 0.412309 | 6:-36698786 | MsaT031821.1:CDS |
GTACCAAATGTATGGGGCTT+TGG | 0.414713 | 6:-36698525 | MsaT031821.1:CDS |
CTGCCAAAGCCCCATACATT+TGG | 0.417656 | 6:+36698522 | None:intergenic |
AAATTCAGTTGAAGGCTTAG+AGG | 0.428492 | 6:-36699041 | MsaT031821.1:CDS |
GAAATGCTCGTGTCTTAGAA+TGG | 0.443162 | 6:-36697399 | MsaT031821.1:CDS |
TTGGAAGATCATCAAAATCA+AGG | 0.448932 | 6:+36697330 | None:intergenic |
TTTAGCAAACTTGGACCACC+TGG | 0.451664 | 6:+36697292 | None:intergenic |
TGCAAAATTTCGAGTCCACT+TGG | 0.456820 | 6:-36698705 | MsaT031821.1:CDS |
ATAAGACCGTACCAAATGTA+TGG | 0.463653 | 6:-36698533 | MsaT031821.1:CDS |
GGCTTTGGCAGATGCTTCTG+GGG | 0.464116 | 6:-36698510 | MsaT031821.1:CDS |
TTTGAAGGACATGCTGAGCC+AGG | 0.465178 | 6:-36696009 | MsaT031821.1:intron |
CCATCAGTCGCATCAATGTT+GGG | 0.475672 | 6:-36696893 | MsaT031821.1:CDS |
ACCTTTGTTTGTTCATGTCA+AGG | 0.486075 | 6:-36698803 | MsaT031821.1:CDS |
GACGGTACACGTCTCAATCC+TGG | 0.486316 | 6:+36695991 | None:intergenic |
CAAAATACCGTGGTGATGGT+AGG | 0.487602 | 6:-36697460 | MsaT031821.1:CDS |
ACCGTGGTGATGGTAGGGTT+TGG | 0.493348 | 6:-36697454 | MsaT031821.1:CDS |
ATGAACAAACAAAGGTCTGC+TGG | 0.497463 | 6:+36698810 | None:intergenic |
TCCATCAGTCGCATCAATGT+TGG | 0.500041 | 6:-36696894 | MsaT031821.1:CDS |
TGTTGTACGCATCCTCGTCT+TGG | 0.504705 | 6:+36696832 | None:intergenic |
ATTTACGTTGCTTGGCAACT+TGG | 0.506669 | 6:+36698447 | None:intergenic |
GTCAAGGTTACAGGGAGGAT+AGG | 0.518923 | 6:-36698787 | MsaT031821.1:CDS |
GCTTTGGCAGATGCTTCTGG+GGG | 0.524995 | 6:-36698509 | MsaT031821.1:CDS |
AAAATACCGTGGTGATGGTA+GGG | 0.526246 | 6:-36697459 | MsaT031821.1:CDS |
TTCACTTACATTGTAACCCT+CGG | 0.528797 | 6:+36696809 | None:intergenic |
TGTCTTAGAATGGAATCGCT+TGG | 0.529768 | 6:-36697389 | MsaT031821.1:CDS |
CAAAGCAATGGAGATGTCAA+TGG | 0.531347 | 6:-36699070 | MsaT031821.1:CDS |
CCCAACATTGATGCGACTGA+TGG | 0.535314 | 6:+36696893 | None:intergenic |
TAAGACCGTACCAAATGTAT+GGG | 0.537974 | 6:-36698532 | MsaT031821.1:CDS |
ACACCATCGCGCTCTAACAA+AGG | 0.543044 | 6:+36699235 | None:intergenic |
ATTGAGCGTAGTCGAAAAGC+TGG | 0.551197 | 6:-36698557 | MsaT031821.1:CDS |
CACAATCATGCTATGTTAGG+AGG | 0.553509 | 6:-36698638 | MsaT031821.1:CDS |
TTGTTCATGTCAAGGTTACA+GGG | 0.556666 | 6:-36698795 | MsaT031821.1:CDS |
TGATATAATGAAGATTGAGC+TGG | 0.557270 | 6:-36698975 | MsaT031821.1:CDS |
GTTTCAAAATACCGTGGTGA+TGG | 0.561793 | 6:-36697464 | MsaT031821.1:CDS |
AGAAATGGACGGACGTTCAG+AGG | 0.566572 | 6:-36699266 | None:intergenic |
TCGTAAGGGGCAAGTGGTGA+GGG | 0.567327 | 6:-36698852 | MsaT031821.1:CDS |
ACGCTCAATTTCAGCTATGT+CGG | 0.568884 | 6:+36698571 | None:intergenic |
TTCGTAAGGGGCAAGTGGTG+AGG | 0.571006 | 6:-36698853 | MsaT031821.1:CDS |
ATCCCTTCGTCAGTTGACAT+TGG | 0.575813 | 6:+36696858 | None:intergenic |
TTCAGTTCGTAAGGGGCAAG+TGG | 0.578338 | 6:-36698858 | MsaT031821.1:CDS |
AGAAAGGCAAGAAATGTCCA+TGG | 0.584202 | 6:-36697501 | MsaT031821.1:CDS |
GAAAGGCAAGAAATGTCCAT+GGG | 0.588349 | 6:-36697500 | MsaT031821.1:CDS |
CAAGTGGTGAGGGATCGAAA+TGG | 0.589736 | 6:-36698842 | MsaT031821.1:CDS |
ACATTGATGCGACTGATGGA+AGG | 0.591550 | 6:+36696897 | None:intergenic |
AAACCAAGAGTAAAACATGT+AGG | 0.598768 | 6:+36698898 | None:intergenic |
AACCGTGAAAATAAACCCCA+TGG | 0.607032 | 6:+36697484 | None:intergenic |
CAAGGTTACAGGGAGGATAG+GGG | 0.609406 | 6:-36698785 | MsaT031821.1:CDS |
AAGGTTACAGGGAGGATAGG+GGG | 0.615842 | 6:-36698784 | MsaT031821.1:CDS |
AAAGCCCCATACATTTGGTA+CGG | 0.620279 | 6:+36698527 | None:intergenic |
CACCAATGTCAACTGACGAA+GGG | 0.623535 | 6:-36696860 | MsaT031821.1:CDS |
ACAAATTGCGAACAAAGCAA+TGG | 0.627176 | 6:-36699082 | MsaT031821.1:CDS |
ACACCAATGTCAACTGACGA+AGG | 0.627495 | 6:-36696861 | MsaT031821.1:CDS |
CGAAGGGATTCTCCAAGACG+AGG | 0.638814 | 6:-36696844 | MsaT031821.1:CDS |
TTCACGGTTTCAAAATACCG+TGG | 0.639319 | 6:-36697470 | MsaT031821.1:CDS |
GCCTCGACAAAATATCCAAG+TGG | 0.642964 | 6:+36698690 | None:intergenic |
ACCTTGACATGAACAAACAA+AGG | 0.644270 | 6:+36698802 | None:intergenic |
TTGGTATTCAGAGAAATGGA+CGG | 0.649153 | 6:-36699277 | None:intergenic |
AATCCTTTGTTAGAGCGCGA+TGG | 0.654133 | 6:-36699238 | MsaT031821.1:CDS |
CAAGGTACAGAAGCACAGCA+AGG | 0.654464 | 6:+36697348 | None:intergenic |
TTAGCAAACTTGGACCACCT+GGG | 0.656483 | 6:+36697293 | None:intergenic |
ACAGCAAGGATATGATCGCA+CGG | 0.663089 | 6:+36697362 | None:intergenic |
GCCAAACCCTACCATCACCA+CGG | 0.683425 | 6:+36697453 | None:intergenic |
GAGGATGCGTACAACACCGA+GGG | 0.685934 | 6:-36696825 | MsaT031821.1:CDS |
ATGTTAGGAGGTACTCTGTG+TGG | 0.688101 | 6:-36698626 | MsaT031821.1:CDS |
AAGACCGTACCAAATGTATG+GGG | 0.707217 | 6:-36698531 | MsaT031821.1:CDS |
TTCATGTCAAGGTTACAGGG+AGG | 0.709283 | 6:-36698792 | MsaT031821.1:CDS |
CGAGGATGCGTACAACACCG+AGG | 0.735213 | 6:-36696826 | MsaT031821.1:CDS |
AAAGGCAAGAAATGTCCATG+GGG | 0.742239 | 6:-36697499 | MsaT031821.1:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr6 | gene | 36696004 | 36699284 | 36696004 | ID=MsaG031821 |
Chr6 | mRNA | 36696004 | 36699284 | 36696004 | ID=MsaT031821.1;Parent=MsaG031821 |
Chr6 | exon | 36696004 | 36696024 | 36696004 | ID=MsaT031821.1.exon5;Parent=MsaT031821.1 |
Chr6 | CDS | 36696004 | 36696024 | 36696004 | ID=cds.MsaT031821.1;Parent=MsaT031821.1 |
Chr6 | exon | 36696818 | 36696929 | 36696818 | ID=MsaT031821.1.exon4;Parent=MsaT031821.1 |
Chr6 | CDS | 36696818 | 36696929 | 36696818 | ID=cds.MsaT031821.1;Parent=MsaT031821.1 |
Chr6 | exon | 36697302 | 36697521 | 36697302 | ID=MsaT031821.1.exon3;Parent=MsaT031821.1 |
Chr6 | CDS | 36697302 | 36697521 | 36697302 | ID=cds.MsaT031821.1;Parent=MsaT031821.1 |
Chr6 | exon | 36698453 | 36699137 | 36698453 | ID=MsaT031821.1.exon2;Parent=MsaT031821.1 |
Chr6 | CDS | 36698453 | 36699137 | 36698453 | ID=cds.MsaT031821.1;Parent=MsaT031821.1 |
Chr6 | exon | 36699222 | 36699284 | 36699222 | ID=MsaT031821.1.exon1;Parent=MsaT031821.1 |
Chr6 | CDS | 36699222 | 36699284 | 36699222 | ID=cds.MsaT031821.1;Parent=MsaT031821.1 |
Gene Sequence |
Protein sequence |