Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG032149 | XP_024642022.1 | 90.166 | 1505 | 125 | 6 | 1 | 1486 | 1 | 1501 | 0.0 | 2710 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG032149 | sp|Q4KKX4|NCOR1_XENTR | 27.509 | 269 | 166 | 9 | 603 | 852 | 231 | 489 | 5.31e-16 | 88.2 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG032149 | tr|A0A396HIY1|A0A396HIY1_MEDTR | 90.100 | 1505 | 125 | 7 | 1 | 1486 | 1 | 1500 | 0.0 | 2706 |
Gene ID | Type | Classification |
---|---|---|
MsaG032149 | TF | MYB-related |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000045 | MsaG032149 | 0.803754 | 5.049169e-49 | 7.436926e-47 |
MsaG000083 | MsaG032149 | 0.806089 | 1.650229e-49 | 2.566366e-47 |
MsaG000117 | MsaG032149 | 0.817011 | 7.152138e-52 | 1.455283e-49 |
MsaG000179 | MsaG032149 | 0.837540 | 8.980937e-57 | 3.247727e-54 |
MsaG000274 | MsaG032149 | 0.859962 | 5.650872e-63 | 4.387080e-60 |
MsaG000292 | MsaG032149 | 0.829944 | 6.966811e-55 | 2.013059e-52 |
MsaG000314 | MsaG032149 | 0.818209 | 3.850927e-52 | 8.081319e-50 |
MsaG000327 | MsaG032149 | 0.807772 | 7.299610e-50 | 1.181426e-47 |
MsaG000336 | MsaG032149 | 0.820855 | 9.656987e-53 | 2.172388e-50 |
MsaG000352 | MsaG032149 | 0.853775 | 3.681176e-61 | 2.276476e-58 |
MsaG000366 | MsaG032149 | 0.814126 | 3.116482e-51 | 5.893400e-49 |
MsaG000439 | MsaG032149 | 0.809911 | 2.559247e-50 | 4.361054e-48 |
MsaG000450 | MsaG032149 | 0.838301 | 5.735115e-57 | 2.123048e-54 |
MsaG000559 | MsaG032149 | 0.821619 | 6.449667e-53 | 1.480602e-50 |
MsaG000528 | MsaG032149 | 0.842472 | 4.712608e-58 | 1.989658e-55 |
MsaG000550 | MsaG032149 | 0.811119 | 1.407087e-50 | 2.469416e-48 |
MsaG000584 | MsaG032149 | 0.806860 | 1.136876e-49 | 1.800461e-47 |
MsaG000643 | MsaG032149 | 0.853181 | 5.441672e-61 | 3.294980e-58 |
MsaG000662 | MsaG032149 | 0.835218 | 3.475842e-56 | 1.171858e-53 |
MsaG000686 | MsaG032149 | 0.826344 | 5.084218e-54 | 1.327451e-51 |
MsaG000712 | MsaG032149 | 0.802955 | 7.380436e-49 | 1.067139e-46 |
MsaG000760 | MsaG032149 | 0.852950 | 6.332907e-61 | 3.803617e-58 |
MsaG000762 | MsaG032149 | 0.806672 | 1.245089e-49 | 1.963203e-47 |
MsaG000791 | MsaG032149 | 0.856870 | 4.668217e-62 | 3.228282e-59 |
MsaG000795 | MsaG032149 | 0.817058 | 6.978571e-52 | 1.421727e-49 |
MsaG000830 | MsaG032149 | 0.849990 | 4.314893e-60 | 2.337798e-57 |
MsaG000880 | MsaG032149 | 0.818121 | 4.031377e-52 | 8.440709e-50 |
MsaG000884 | MsaG032149 | 0.826676 | 4.240519e-54 | 1.117422e-51 |
MsaG000856 | MsaG032149 | 0.802853 | 7.746332e-49 | 1.117389e-46 |
MsaG000940 | MsaG032149 | 0.816940 | 7.415492e-52 | 1.506121e-49 |
MsaG000942 | MsaG032149 | 0.829905 | 7.117540e-55 | 2.054310e-52 |
MsaG001046 | MsaG032149 | 0.801995 | 1.161093e-48 | 1.642342e-46 |
MsaG001056 | MsaG032149 | 0.804347 | 3.806539e-49 | 5.684321e-47 |
MsaG001057 | MsaG032149 | 0.865138 | 1.466705e-64 | 1.393390e-61 |
MsaG001004 | MsaG032149 | 0.814980 | 2.021726e-51 | 3.906179e-49 |
MsaG001161 | MsaG032149 | 0.827293 | 3.023490e-54 | 8.105918e-52 |
MsaG001196 | MsaG032149 | 0.854498 | 2.282201e-61 | 1.448267e-58 |
MsaG001201 | MsaG032149 | 0.819719 | 1.753110e-52 | 3.826962e-50 |
MsaG001300 | MsaG032149 | 0.805166 | 2.572441e-49 | 3.915140e-47 |
MsaG001306 | MsaG032149 | 0.822994 | 3.102343e-53 | 7.389868e-51 |
MsaG001366 | MsaG032149 | 0.805657 | 2.032385e-49 | 3.128633e-47 |
MsaG001403 | MsaG032149 | 0.853952 | 3.274978e-61 | 2.038203e-58 |
MsaG001478 | MsaG032149 | 0.807110 | 1.006923e-49 | 1.604103e-47 |
MsaG001558 | MsaG032149 | 0.817500 | 5.557643e-52 | 1.145162e-49 |
MsaG001514 | MsaG032149 | 0.839248 | 3.273108e-57 | 1.247916e-54 |
MsaG001600 | MsaG032149 | 0.836582 | 1.573588e-56 | 5.527065e-54 |
MsaG001705 | MsaG032149 | 0.843284 | 2.871965e-58 | 1.244480e-55 |
MsaG001728 | MsaG032149 | 0.806405 | 1.416667e-49 | 2.219733e-47 |
MsaG001739 | MsaG032149 | 0.822971 | 3.140687e-53 | 7.476708e-51 |
MsaG001809 | MsaG032149 | 0.817841 | 4.659388e-52 | 9.685457e-50 |
MsaG001827 | MsaG032149 | 0.838731 | 4.445890e-57 | 1.668105e-54 |
MsaG001911 | MsaG032149 | 0.815954 | 1.229868e-51 | 2.435632e-49 |
MsaG001931 | MsaG032149 | 0.803162 | 6.690996e-49 | 9.720992e-47 |
MsaG002045 | MsaG032149 | 0.851364 | 1.779156e-60 | 1.010673e-57 |
MsaG002021 | MsaG032149 | 0.862404 | 1.027783e-63 | 8.762568e-61 |
MsaG002093 | MsaG032149 | 0.837272 | 1.050889e-56 | 3.769046e-54 |
MsaG002121 | MsaG032149 | 0.801622 | 1.383848e-48 | 1.940916e-46 |
MsaG002170 | MsaG032149 | 0.842784 | 3.898432e-58 | 1.662403e-55 |
MsaG002175 | MsaG032149 | 0.833997 | 7.022805e-56 | 2.282794e-53 |
MsaG002201 | MsaG032149 | 0.868354 | 1.404981e-65 | 1.520739e-62 |
MsaG002350 | MsaG032149 | 0.822741 | 3.550835e-53 | 8.400691e-51 |
MsaG002373 | MsaG032149 | 0.813660 | 3.944108e-51 | 7.371713e-49 |
MsaG002560 | MsaG032149 | 0.833583 | 8.902162e-56 | 2.858802e-53 |
MsaG002563 | MsaG032149 | 0.858255 | 1.824181e-62 | 1.328011e-59 |
MsaG002681 | MsaG032149 | 0.807547 | 8.143759e-50 | 1.310927e-47 |
MsaG002735 | MsaG032149 | 0.800254 | 2.625841e-48 | 3.570669e-46 |
MsaG002814 | MsaG032149 | 0.816450 | 9.541031e-52 | 1.913489e-49 |
MsaG002889 | MsaG032149 | 0.845098 | 9.412384e-59 | 4.327067e-56 |
MsaG002878 | MsaG032149 | 0.832699 | 1.474026e-55 | 4.612295e-53 |
MsaG003016 | MsaG032149 | 0.808731 | 4.568781e-50 | 7.567398e-48 |
MsaG003067 | MsaG032149 | 0.837826 | 7.589868e-57 | 2.768713e-54 |
MsaG003105 | MsaG032149 | 0.838209 | 6.055168e-57 | 2.235178e-54 |
MsaG003161 | MsaG032149 | 0.840181 | 1.875481e-57 | 7.363045e-55 |
MsaG003141 | MsaG032149 | 0.874653 | 1.180813e-67 | 1.672578e-64 |
MsaG003257 | MsaG032149 | 0.804084 | 4.315708e-49 | 6.405626e-47 |
MsaG003258 | MsaG032149 | 0.819543 | 1.922953e-52 | 4.178249e-50 |
MsaG003381 | MsaG032149 | 0.833399 | 9.889530e-56 | 3.158759e-53 |
MsaG003423 | MsaG032149 | 0.867274 | 3.109531e-65 | 3.219878e-62 |
MsaG003461 | MsaG032149 | 0.807425 | 8.644131e-50 | 1.387416e-47 |
MsaG003529 | MsaG032149 | 0.832509 | 1.642458e-55 | 5.111046e-53 |
MsaG003537 | MsaG032149 | 0.856730 | 5.132412e-62 | 3.531188e-59 |
MsaG003560 | MsaG032149 | 0.830291 | 5.736477e-55 | 1.674046e-52 |
MsaG003589 | MsaG032149 | 0.801771 | 1.290703e-48 | 1.816361e-46 |
MsaG003630 | MsaG032149 | 0.812483 | 7.124735e-51 | 1.293117e-48 |
MsaG003703 | MsaG032149 | 0.830970 | 3.920555e-55 | 1.166553e-52 |
MsaG003708 | MsaG032149 | 0.824707 | 1.236112e-53 | 3.084621e-51 |
MsaG003870 | MsaG032149 | 0.857130 | 3.917935e-62 | 2.735088e-59 |
MsaG003912 | MsaG032149 | 0.826463 | 4.764918e-54 | 1.248258e-51 |
MsaG003927 | MsaG032149 | 0.822081 | 5.046716e-53 | 1.172879e-50 |
MsaG003960 | MsaG032149 | 0.808909 | 4.188024e-50 | 6.966269e-48 |
MsaG003963 | MsaG032149 | 0.861825 | 1.543679e-63 | 1.286748e-60 |
MsaG003964 | MsaG032149 | 0.886832 | 5.263026e-72 | 1.319458e-68 |
MsaG003972 | MsaG032149 | 0.828020 | 2.026780e-54 | 5.545651e-52 |
MsaG003974 | MsaG032149 | 0.823924 | 1.884846e-53 | 4.604234e-51 |
MsaG004041 | MsaG032149 | 0.843316 | 2.816748e-58 | 1.221851e-55 |
MsaG004059 | MsaG032149 | 0.815302 | 1.715443e-51 | 3.341587e-49 |
MsaG004094 | MsaG032149 | 0.857372 | 3.325116e-62 | 2.342378e-59 |
MsaG004097 | MsaG032149 | 0.833696 | 8.345060e-56 | 2.688927e-53 |
MsaG004164 | MsaG032149 | 0.850133 | 3.936417e-60 | 2.142903e-57 |
MsaG004230 | MsaG032149 | 0.819874 | 1.617191e-52 | 3.544750e-50 |
MsaG004201 | MsaG032149 | 0.827160 | 3.252701e-54 | 8.687715e-52 |
MsaG004277 | MsaG032149 | 0.860916 | 2.914742e-63 | 2.346482e-60 |
MsaG004308 | MsaG032149 | 0.833633 | 8.653875e-56 | 2.783126e-53 |
MsaG004314 | MsaG032149 | 0.844342 | 1.501278e-58 | 6.731543e-56 |
MsaG004370 | MsaG032149 | 0.883171 | 1.201900e-70 | 2.519967e-67 |
MsaG004340 | MsaG032149 | 0.837292 | 1.038738e-56 | 3.727706e-54 |
MsaG004344 | MsaG032149 | 0.816056 | 1.167215e-51 | 2.317511e-49 |
MsaG004361 | MsaG032149 | 0.822264 | 4.579753e-53 | 1.069588e-50 |
MsaG004428 | MsaG032149 | 0.800024 | 2.922870e-48 | 3.954128e-46 |
MsaG004431 | MsaG032149 | 0.823661 | 2.170915e-53 | 5.265664e-51 |
MsaG004447 | MsaG032149 | 0.830726 | 4.496654e-55 | 1.328588e-52 |
MsaG004554 | MsaG032149 | 0.881866 | 3.572064e-70 | 7.036808e-67 |
MsaG004603 | MsaG032149 | 0.831339 | 3.184740e-55 | 9.577761e-53 |
MsaG004744 | MsaG032149 | 0.815571 | 1.495841e-51 | 2.933647e-49 |
MsaG004754 | MsaG032149 | 0.844544 | 1.325261e-58 | 5.981945e-56 |
MsaG004806 | MsaG032149 | 0.819686 | 1.784290e-52 | 3.891559e-50 |
MsaG004807 | MsaG032149 | 0.833522 | 9.219947e-56 | 2.955541e-53 |
MsaG004824 | MsaG032149 | 0.800120 | 2.795277e-48 | 3.789539e-46 |
MsaG004881 | MsaG032149 | 0.814425 | 2.678792e-51 | 5.103957e-49 |
MsaG004981 | MsaG032149 | 0.806591 | 1.295193e-49 | 2.038324e-47 |
MsaG005045 | MsaG032149 | 0.814532 | 2.536975e-51 | 4.846624e-49 |
MsaG005035 | MsaG032149 | 0.804093 | 4.297350e-49 | 6.379694e-47 |
MsaG005104 | MsaG032149 | 0.852238 | 1.008332e-60 | 5.906410e-58 |
MsaG005138 | MsaG032149 | 0.809617 | 2.957971e-50 | 5.004875e-48 |
MsaG005310 | MsaG032149 | 0.832537 | 1.616441e-55 | 5.034092e-53 |
MsaG005201 | MsaG032149 | 0.827623 | 2.522900e-54 | 6.826591e-52 |
MsaG005217 | MsaG032149 | 0.835936 | 2.291908e-56 | 7.895451e-54 |
MsaG005289 | MsaG032149 | 0.843693 | 2.236135e-58 | 9.818341e-56 |
MsaG005325 | MsaG032149 | 0.806468 | 1.374455e-49 | 2.156835e-47 |
MsaG005368 | MsaG032149 | 0.819334 | 2.143981e-52 | 4.633533e-50 |
MsaG005425 | MsaG032149 | 0.814693 | 2.339059e-51 | 4.486620e-49 |
MsaG005486 | MsaG032149 | 0.828970 | 1.197931e-54 | 3.366234e-52 |
MsaG005560 | MsaG032149 | 0.862720 | 8.226962e-64 | 7.101230e-61 |
MsaG005564 | MsaG032149 | 0.867962 | 1.875334e-65 | 1.997142e-62 |
MsaG005584 | MsaG032149 | 0.854244 | 2.700744e-61 | 1.698458e-58 |
MsaG005761 | MsaG032149 | 0.809654 | 2.904500e-50 | 4.918779e-48 |
MsaG005770 | MsaG032149 | 0.823175 | 2.817563e-53 | 6.744169e-51 |
MsaG005812 | MsaG032149 | 0.827524 | 2.663168e-54 | 7.186186e-52 |
MsaG006016 | MsaG032149 | 0.825931 | 6.366360e-54 | 1.643320e-51 |
MsaG006035 | MsaG032149 | 0.819263 | 2.225567e-52 | 4.800742e-50 |
MsaG005957 | MsaG032149 | 0.872225 | 7.673092e-67 | 9.775851e-64 |
MsaG006145 | MsaG032149 | 0.851293 | 1.863521e-60 | 1.056041e-57 |
MsaG006165 | MsaG032149 | 0.817888 | 4.546807e-52 | 9.462849e-50 |
MsaG006049 | MsaG032149 | 0.823678 | 2.151658e-53 | 5.221302e-51 |
MsaG006052 | MsaG032149 | 0.884922 | 2.727099e-71 | 6.222339e-68 |
MsaG006120 | MsaG032149 | 0.822718 | 3.594652e-53 | 8.498983e-51 |
MsaG006178 | MsaG032149 | 0.809778 | 2.732494e-50 | 4.641371e-48 |
MsaG006218 | MsaG032149 | 0.837052 | 1.195735e-56 | 4.260144e-54 |
MsaG006250 | MsaG032149 | 0.818190 | 3.888209e-52 | 8.155635e-50 |
MsaG006254 | MsaG032149 | 0.870060 | 3.946025e-66 | 4.584330e-63 |
MsaG006256 | MsaG032149 | 0.820239 | 1.335163e-52 | 2.955297e-50 |
MsaG006257 | MsaG032149 | 0.803638 | 5.336207e-49 | 7.838387e-47 |
MsaG006304 | MsaG032149 | 0.842959 | 3.503981e-58 | 1.502552e-55 |
MsaG006307 | MsaG032149 | 0.815118 | 1.884713e-51 | 3.654012e-49 |
MsaG006339 | MsaG032149 | 0.811258 | 1.313007e-50 | 2.312207e-48 |
MsaG006387 | MsaG032149 | 0.862541 | 9.333770e-64 | 8.000658e-61 |
MsaG006412 | MsaG032149 | 0.840258 | 1.791401e-57 | 7.050077e-55 |
MsaG006420 | MsaG032149 | 0.813477 | 4.324576e-51 | 8.045945e-49 |
MsaG006430 | MsaG032149 | 0.801438 | 1.508749e-48 | 2.107290e-46 |
MsaG006440 | MsaG032149 | 0.839540 | 2.750196e-57 | 1.058196e-54 |
MsaG006477 | MsaG032149 | 0.832833 | 1.366073e-55 | 4.291135e-53 |
MsaG006480 | MsaG032149 | 0.826444 | 4.815043e-54 | 1.260721e-51 |
MsaG006482 | MsaG032149 | 0.805961 | 1.755619e-49 | 2.721910e-47 |
MsaG006513 | MsaG032149 | 0.874951 | 9.352139e-68 | 1.342128e-64 |
MsaG006560 | MsaG032149 | 0.826851 | 3.853250e-54 | 1.020346e-51 |
MsaG006679 | MsaG032149 | 0.805853 | 1.848764e-49 | 2.859112e-47 |
MsaG006710 | MsaG032149 | 0.811132 | 1.398185e-50 | 2.454533e-48 |
MsaG006715 | MsaG032149 | 0.821518 | 6.803686e-53 | 1.557679e-50 |
MsaG006725 | MsaG032149 | 0.872759 | 5.100235e-67 | 6.648490e-64 |
MsaG006755 | MsaG032149 | 0.808997 | 4.010835e-50 | 6.685690e-48 |
MsaG006763 | MsaG032149 | 0.848775 | 9.372039e-60 | 4.871407e-57 |
MsaG006841 | MsaG032149 | 0.815109 | 1.893308e-51 | 3.669883e-49 |
MsaG006862 | MsaG032149 | 0.823687 | 2.140752e-53 | 5.196234e-51 |
MsaG006884 | MsaG032149 | 0.808975 | 4.053790e-50 | 6.753717e-48 |
MsaG006901 | MsaG032149 | 0.817178 | 6.561240e-52 | 1.340832e-49 |
MsaG006942 | MsaG032149 | 0.844380 | 1.465793e-58 | 6.580757e-56 |
MsaG006943 | MsaG032149 | 0.811193 | 1.356226e-50 | 2.384494e-48 |
MsaG006944 | MsaG032149 | 0.816014 | 1.192668e-51 | 2.365524e-49 |
MsaG006956 | MsaG032149 | 0.811620 | 1.096783e-50 | 1.948620e-48 |
MsaG007035 | MsaG032149 | 0.804738 | 3.157826e-49 | 4.758388e-47 |
MsaG007038 | MsaG032149 | 0.849106 | 7.592503e-60 | 3.991645e-57 |
MsaG007114 | MsaG032149 | 0.805572 | 2.116463e-49 | 3.251588e-47 |
MsaG007112 | MsaG032149 | 0.872868 | 4.692692e-67 | 6.146795e-64 |
MsaG007171 | MsaG032149 | 0.869872 | 4.541878e-66 | 5.234971e-63 |
MsaG007206 | MsaG032149 | 0.813686 | 3.891619e-51 | 7.278483e-49 |
MsaG007413 | MsaG032149 | 0.831836 | 2.405568e-55 | 7.341050e-53 |
MsaG007426 | MsaG032149 | 0.807233 | 9.487402e-50 | 1.515776e-47 |
MsaG007526 | MsaG032149 | 0.826514 | 4.632692e-54 | 1.215328e-51 |
MsaG007480 | MsaG032149 | 0.857612 | 2.824647e-62 | 2.007468e-59 |
MsaG007600 | MsaG032149 | 0.855639 | 1.067744e-61 | 7.059661e-59 |
MsaG007602 | MsaG032149 | 0.856504 | 5.976906e-62 | 4.078678e-59 |
MsaG007641 | MsaG032149 | 0.860061 | 5.274646e-63 | 4.110820e-60 |
MsaG007626 | MsaG032149 | 0.801392 | 1.541676e-48 | 2.151027e-46 |
MsaG007646 | MsaG032149 | 0.805135 | 2.610549e-49 | 3.970262e-47 |
MsaG007652 | MsaG032149 | 0.839135 | 3.499213e-57 | 1.329480e-54 |
MsaG007655 | MsaG032149 | 0.837867 | 7.409374e-57 | 2.706217e-54 |
MsaG007658 | MsaG032149 | 0.801703 | 1.332464e-48 | 1.872264e-46 |
MsaG007713 | MsaG032149 | 0.811961 | 9.250282e-51 | 1.657359e-48 |
MsaG007755 | MsaG032149 | 0.805976 | 1.742696e-49 | 2.702829e-47 |
MsaG007767 | MsaG032149 | 0.900568 | 1.482348e-77 | 7.842358e-74 |
MsaG007792 | MsaG032149 | 0.801000 | 1.852892e-48 | 2.562370e-46 |
MsaG007919 | MsaG032149 | 0.806444 | 1.390673e-49 | 2.181027e-47 |
MsaG007918 | MsaG032149 | 0.809106 | 3.802713e-50 | 6.355415e-48 |
MsaG008035 | MsaG032149 | 0.818178 | 3.912635e-52 | 8.204223e-50 |
MsaG008069 | MsaG032149 | 0.847637 | 1.926501e-59 | 9.637044e-57 |
MsaG008079 | MsaG032149 | 0.806499 | 1.354132e-49 | 2.126460e-47 |
MsaG008081 | MsaG032149 | 0.898090 | 1.699093e-76 | 7.781642e-73 |
MsaG008112 | MsaG032149 | 0.807460 | 8.495132e-50 | 1.364666e-47 |
MsaG008113 | MsaG032149 | 0.874719 | 1.121008e-67 | 1.592322e-64 |
MsaG008164 | MsaG032149 | 0.829805 | 7.529451e-55 | 2.166890e-52 |
MsaG008166 | MsaG032149 | 0.821447 | 7.061425e-53 | 1.613673e-50 |
MsaG008225 | MsaG032149 | 0.808890 | 4.227555e-50 | 7.028875e-48 |
MsaG008193 | MsaG032149 | 0.845722 | 6.389361e-59 | 2.998580e-56 |
MsaG008246 | MsaG032149 | 0.836748 | 1.428496e-56 | 5.042630e-54 |
MsaG008288 | MsaG032149 | 0.803097 | 6.900882e-49 | 1.001102e-46 |
MsaG008291 | MsaG032149 | 0.814188 | 3.021288e-51 | 5.722227e-49 |
MsaG008368 | MsaG032149 | 0.881848 | 3.625491e-70 | 7.136201e-67 |
MsaG008443 | MsaG032149 | 0.826771 | 4.025102e-54 | 1.063472e-51 |
MsaG008442 | MsaG032149 | 0.854636 | 2.082606e-61 | 1.328005e-58 |
MsaG008480 | MsaG032149 | 0.804341 | 3.818164e-49 | 5.700811e-47 |
MsaG008405 | MsaG032149 | 0.804018 | 4.454529e-49 | 6.601358e-47 |
MsaG008425 | MsaG032149 | 0.808118 | 6.165529e-50 | 1.006226e-47 |
MsaG008631 | MsaG032149 | 0.810355 | 2.054759e-50 | 3.539519e-48 |
MsaG008815 | MsaG032149 | 0.807061 | 1.031554e-49 | 1.641415e-47 |
MsaG008915 | MsaG032149 | 0.827156 | 3.259547e-54 | 8.704979e-52 |
MsaG009073 | MsaG032149 | 0.857115 | 3.955345e-62 | 2.759903e-59 |
MsaG009140 | MsaG032149 | 0.851787 | 1.352300e-60 | 7.796977e-58 |
MsaG009206 | MsaG032149 | 0.833373 | 1.004229e-55 | 3.204972e-53 |
MsaG009179 | MsaG032149 | 0.849446 | 6.112736e-60 | 3.251227e-57 |
MsaG009184 | MsaG032149 | 0.807025 | 1.049262e-49 | 1.668222e-47 |
MsaG009230 | MsaG032149 | 0.832865 | 1.341095e-55 | 4.216732e-53 |
MsaG009281 | MsaG032149 | 0.813941 | 3.422414e-51 | 6.442164e-49 |
MsaG009392 | MsaG032149 | 0.807685 | 7.614986e-50 | 1.229881e-47 |
MsaG009472 | MsaG032149 | 0.882701 | 1.782454e-70 | 3.653703e-67 |
MsaG009456 | MsaG032149 | 0.813157 | 5.082035e-51 | 9.379673e-49 |
MsaG009521 | MsaG032149 | 0.822482 | 4.077136e-53 | 9.578338e-51 |
MsaG009672 | MsaG032149 | 0.843683 | 2.250188e-58 | 9.876571e-56 |
MsaG009765 | MsaG032149 | 0.847066 | 2.759314e-59 | 1.354185e-56 |
MsaG009781 | MsaG032149 | 0.827204 | 3.176101e-54 | 8.493422e-52 |
MsaG009787 | MsaG032149 | 0.812066 | 8.780455e-51 | 1.577124e-48 |
MsaG009859 | MsaG032149 | 0.844611 | 1.271383e-58 | 5.751733e-56 |
MsaG010029 | MsaG032149 | 0.817652 | 5.137696e-52 | 1.062744e-49 |
MsaG010051 | MsaG032149 | 0.809561 | 3.040962e-50 | 5.138418e-48 |
MsaG010062 | MsaG032149 | 0.860741 | 3.292232e-63 | 2.633380e-60 |
MsaG010098 | MsaG032149 | 0.831567 | 2.799308e-55 | 8.475482e-53 |
MsaG010275 | MsaG032149 | 0.833139 | 1.147609e-55 | 3.637795e-53 |
MsaG010328 | MsaG032149 | 0.800982 | 1.868476e-48 | 2.582902e-46 |
MsaG010382 | MsaG032149 | 0.821548 | 6.694153e-53 | 1.533854e-50 |
MsaG010499 | MsaG032149 | 0.806357 | 1.449922e-49 | 2.269254e-47 |
MsaG010696 | MsaG032149 | 0.808634 | 4.791127e-50 | 7.916865e-48 |
MsaG010697 | MsaG032149 | 0.813633 | 3.997836e-51 | 7.467145e-49 |
MsaG011044 | MsaG032149 | 0.850579 | 2.955285e-60 | 1.634013e-57 |
MsaG011079 | MsaG032149 | 0.822803 | 3.436554e-53 | 8.143834e-51 |
MsaG011256 | MsaG032149 | 0.829903 | 7.127702e-55 | 2.057084e-52 |
MsaG011257 | MsaG032149 | 0.857496 | 3.056466e-62 | 2.162998e-59 |
MsaG011286 | MsaG032149 | 0.841929 | 6.551024e-58 | 2.718233e-55 |
MsaG011339 | MsaG032149 | 0.840496 | 1.553727e-57 | 6.160443e-55 |
MsaG011346 | MsaG032149 | 0.844561 | 1.311756e-58 | 5.924323e-56 |
MsaG011348 | MsaG032149 | 0.805124 | 2.624984e-49 | 3.991115e-47 |
MsaG011405 | MsaG032149 | 0.846076 | 5.126482e-59 | 2.434067e-56 |
MsaG011443 | MsaG032149 | 0.862648 | 8.653181e-64 | 7.448533e-61 |
MsaG011506 | MsaG032149 | 0.847964 | 1.567185e-59 | 7.927076e-57 |
MsaG011473 | MsaG032149 | 0.802630 | 8.605162e-49 | 1.235031e-46 |
MsaG011580 | MsaG032149 | 0.845781 | 6.160805e-59 | 2.896647e-56 |
MsaG011586 | MsaG032149 | 0.858714 | 1.333407e-62 | 9.873981e-60 |
MsaG011639 | MsaG032149 | 0.803313 | 6.228792e-49 | 9.081082e-47 |
MsaG011697 | MsaG032149 | 0.855406 | 1.247183e-61 | 8.176603e-59 |
MsaG011773 | MsaG032149 | 0.851835 | 1.311068e-60 | 7.571877e-58 |
MsaG011775 | MsaG032149 | 0.822804 | 3.434212e-53 | 8.138552e-51 |
MsaG011915 | MsaG032149 | 0.821088 | 8.536579e-53 | 1.932352e-50 |
MsaG011946 | MsaG032149 | 0.803664 | 5.271390e-49 | 7.747995e-47 |
MsaG011996 | MsaG032149 | 0.815870 | 1.284048e-51 | 2.537441e-49 |
MsaG011997 | MsaG032149 | 0.815583 | 1.487091e-51 | 2.917360e-49 |
MsaG012047 | MsaG032149 | 0.800875 | 1.964736e-48 | 2.709415e-46 |
MsaG012141 | MsaG032149 | 0.804885 | 2.943379e-49 | 4.450488e-47 |
MsaG012169 | MsaG032149 | 0.860134 | 5.015480e-63 | 3.919963e-60 |
MsaG012226 | MsaG032149 | 0.802970 | 7.327045e-49 | 1.059797e-46 |
MsaG012204 | MsaG032149 | 0.807022 | 1.050905e-49 | 1.670712e-47 |
MsaG012248 | MsaG032149 | 0.828208 | 1.827348e-54 | 5.026369e-52 |
MsaG012331 | MsaG032149 | 0.847767 | 1.774496e-59 | 8.916635e-57 |
MsaG012339 | MsaG032149 | 0.838085 | 6.514421e-57 | 2.395467e-54 |
MsaG012348 | MsaG032149 | 0.834696 | 4.698921e-56 | 1.559759e-53 |
MsaG012361 | MsaG032149 | 0.819819 | 1.664402e-52 | 3.642878e-50 |
MsaG012378 | MsaG032149 | 0.849890 | 4.599508e-60 | 2.483353e-57 |
MsaG012454 | MsaG032149 | 0.828043 | 2.001379e-54 | 5.479626e-52 |
MsaG012468 | MsaG032149 | 0.832347 | 1.800938e-55 | 5.577607e-53 |
MsaG012492 | MsaG032149 | 0.815226 | 1.783642e-51 | 3.467706e-49 |
MsaG012661 | MsaG032149 | 0.842755 | 3.965740e-58 | 1.689613e-55 |
MsaG012704 | MsaG032149 | 0.837615 | 8.591811e-57 | 3.114130e-54 |
MsaG012995 | MsaG032149 | 0.802874 | 7.668817e-49 | 1.106771e-46 |
MsaG013245 | MsaG032149 | 0.853512 | 4.378026e-61 | 2.682056e-58 |
MsaG013732 | MsaG032149 | 0.829757 | 7.732242e-55 | 2.222216e-52 |
MsaG013734 | MsaG032149 | 0.813169 | 5.049492e-51 | 9.322572e-49 |
MsaG013659 | MsaG032149 | 0.831811 | 2.438814e-55 | 7.437419e-53 |
MsaG013849 | MsaG032149 | 0.871381 | 1.458299e-66 | 1.791853e-63 |
MsaG013903 | MsaG032149 | 0.803733 | 5.101607e-49 | 7.510542e-47 |
MsaG013916 | MsaG032149 | 0.813064 | 5.323112e-51 | 9.802234e-49 |
MsaG013953 | MsaG032149 | 0.814056 | 3.229184e-51 | 6.095759e-49 |
MsaG014058 | MsaG032149 | 0.808968 | 4.068487e-50 | 6.777080e-48 |
MsaG014031 | MsaG032149 | 0.802011 | 1.152704e-48 | 1.631049e-46 |
MsaG014048 | MsaG032149 | 0.817644 | 5.158312e-52 | 1.066781e-49 |
MsaG014085 | MsaG032149 | 0.806005 | 1.718451e-49 | 2.667016e-47 |
MsaG014208 | MsaG032149 | 0.801252 | 1.646539e-48 | 2.290013e-46 |
MsaG014267 | MsaG032149 | 0.830080 | 6.456732e-55 | 1.872932e-52 |
MsaG014294 | MsaG032149 | 0.840897 | 1.221194e-57 | 4.903320e-55 |
MsaG014337 | MsaG032149 | 0.824715 | 1.231330e-53 | 3.073276e-51 |
MsaG014481 | MsaG032149 | 0.812874 | 5.857504e-51 | 1.073495e-48 |
MsaG014543 | MsaG032149 | 0.832589 | 1.569038e-55 | 4.893764e-53 |
MsaG014544 | MsaG032149 | 0.808311 | 5.611658e-50 | 9.200655e-48 |
MsaG014725 | MsaG032149 | 0.837420 | 9.637180e-57 | 3.472350e-54 |
MsaG014960 | MsaG032149 | 0.826511 | 4.641321e-54 | 1.217472e-51 |
MsaG015020 | MsaG032149 | 0.815956 | 1.228838e-51 | 2.433715e-49 |
MsaG015142 | MsaG032149 | 0.801879 | 1.226781e-48 | 1.730711e-46 |
MsaG015318 | MsaG032149 | 0.856536 | 5.849778e-62 | 3.996534e-59 |
MsaG015359 | MsaG032149 | 0.862918 | 7.152507e-64 | 6.222361e-61 |
MsaG015372 | MsaG032149 | 0.822616 | 3.795947e-53 | 8.950147e-51 |
MsaG015623 | MsaG032149 | 0.809185 | 3.657671e-50 | 6.124445e-48 |
MsaG015692 | MsaG032149 | 0.816542 | 9.101174e-52 | 1.829577e-49 |
MsaG015813 | MsaG032149 | 0.836726 | 1.446828e-56 | 5.103951e-54 |
MsaG015836 | MsaG032149 | 0.857472 | 3.107528e-62 | 2.197158e-59 |
MsaG015852 | MsaG032149 | 0.847826 | 1.709884e-59 | 8.609295e-57 |
MsaG015858 | MsaG032149 | 0.879911 | 1.786053e-69 | 3.209590e-66 |
MsaG015925 | MsaG032149 | 0.803266 | 6.366679e-49 | 9.272169e-47 |
MsaG015938 | MsaG032149 | 0.848014 | 1.518603e-59 | 7.694402e-57 |
MsaG016026 | MsaG032149 | 0.856131 | 7.680082e-62 | 5.169346e-59 |
MsaG016078 | MsaG032149 | 0.833542 | 9.112792e-56 | 2.922898e-53 |
MsaG016128 | MsaG032149 | 0.815528 | 1.529359e-51 | 2.996067e-49 |
MsaG016210 | MsaG032149 | 0.828475 | 1.576604e-54 | 4.369448e-52 |
MsaG016231 | MsaG032149 | 0.862075 | 1.296020e-63 | 1.090827e-60 |
MsaG016250 | MsaG032149 | 0.829176 | 1.068611e-54 | 3.020315e-52 |
MsaG016252 | MsaG032149 | 0.809066 | 3.877350e-50 | 6.473974e-48 |
MsaG016516 | MsaG032149 | 0.832985 | 1.252427e-55 | 3.951847e-53 |
MsaG016521 | MsaG032149 | 0.833301 | 1.046114e-55 | 3.331632e-53 |
MsaG016530 | MsaG032149 | 0.803390 | 6.005361e-49 | 8.771048e-47 |
MsaG016615 | MsaG032149 | 0.872823 | 4.857811e-67 | 6.350388e-64 |
MsaG016789 | MsaG032149 | 0.801622 | 1.384261e-48 | 1.941478e-46 |
MsaG016862 | MsaG032149 | 0.875812 | 4.761658e-68 | 7.100563e-65 |
MsaG016826 | MsaG032149 | 0.822551 | 3.930046e-53 | 9.249958e-51 |
MsaG016994 | MsaG032149 | 0.821367 | 7.368525e-53 | 1.680258e-50 |
MsaG017088 | MsaG032149 | 0.828964 | 1.202186e-54 | 3.377565e-52 |
MsaG017105 | MsaG032149 | 0.802835 | 7.812181e-49 | 1.126430e-46 |
MsaG017322 | MsaG032149 | 0.831845 | 2.393432e-55 | 7.305906e-53 |
MsaG017198 | MsaG032149 | 0.816585 | 8.900489e-52 | 1.791253e-49 |
MsaG017202 | MsaG032149 | 0.826857 | 3.839798e-54 | 1.016972e-51 |
MsaG017240 | MsaG032149 | 0.807173 | 9.767981e-50 | 1.558438e-47 |
MsaG017250 | MsaG032149 | 0.808370 | 5.452806e-50 | 8.952808e-48 |
MsaG017256 | MsaG032149 | 0.810606 | 1.815292e-50 | 3.146075e-48 |
MsaG017259 | MsaG032149 | 0.829044 | 1.149653e-54 | 3.237427e-52 |
MsaG017270 | MsaG032149 | 0.817037 | 7.056064e-52 | 1.436718e-49 |
MsaG017293 | MsaG032149 | 0.840636 | 1.428130e-57 | 5.687419e-55 |
MsaG017376 | MsaG032149 | 0.829944 | 6.966811e-55 | 2.013059e-52 |
MsaG017459 | MsaG032149 | 0.821713 | 6.134595e-53 | 1.411843e-50 |
MsaG017473 | MsaG032149 | 0.824056 | 1.756119e-53 | 4.305266e-51 |
MsaG017499 | MsaG032149 | 0.840298 | 1.749431e-57 | 6.893454e-55 |
MsaG017532 | MsaG032149 | 0.807955 | 6.677889e-50 | 1.085554e-47 |
MsaG017588 | MsaG032149 | 0.816833 | 7.836306e-52 | 1.587155e-49 |
MsaG017589 | MsaG032149 | 0.809015 | 3.975798e-50 | 6.630167e-48 |
MsaG017614 | MsaG032149 | 0.834548 | 5.117695e-56 | 1.691197e-53 |
MsaG017736 | MsaG032149 | 0.801854 | 1.241254e-48 | 1.750129e-46 |
MsaG017910 | MsaG032149 | 0.809153 | 3.715486e-50 | 6.216608e-48 |
MsaG018004 | MsaG032149 | 0.824491 | 1.388953e-53 | 3.445745e-51 |
MsaG018011 | MsaG032149 | 0.815500 | 1.551302e-51 | 3.036917e-49 |
MsaG018059 | MsaG032149 | 0.819075 | 2.454617e-52 | 5.268695e-50 |
MsaG018074 | MsaG032149 | 0.823038 | 3.030995e-53 | 7.228545e-51 |
MsaG018112 | MsaG032149 | 0.803057 | 7.031624e-49 | 1.019114e-46 |
MsaG018113 | MsaG032149 | 0.846025 | 5.292401e-59 | 2.508577e-56 |
MsaG018135 | MsaG032149 | 0.823449 | 2.432315e-53 | 5.865486e-51 |
MsaG018212 | MsaG032149 | 0.862256 | 1.140812e-63 | 9.669799e-61 |
MsaG018251 | MsaG032149 | 0.808514 | 5.081198e-50 | 8.371890e-48 |
MsaG018263 | MsaG032149 | 0.836948 | 1.270404e-56 | 4.511764e-54 |
MsaG018309 | MsaG032149 | 0.811685 | 1.061568e-50 | 1.889109e-48 |
MsaG018351 | MsaG032149 | 0.825861 | 6.614486e-54 | 1.704002e-51 |
MsaG018373 | MsaG032149 | 0.840510 | 1.540691e-57 | 6.111456e-55 |
MsaG018479 | MsaG032149 | 0.806028 | 1.699250e-49 | 2.638718e-47 |
MsaG018465 | MsaG032149 | 0.885461 | 1.719154e-71 | 4.026954e-68 |
MsaG018400 | MsaG032149 | 0.808717 | 4.600334e-50 | 7.617131e-48 |
MsaG018430 | MsaG032149 | 0.843864 | 2.013238e-58 | 8.887327e-56 |
MsaG018484 | MsaG032149 | 0.800976 | 1.874073e-48 | 2.590231e-46 |
MsaG018502 | MsaG032149 | 0.815191 | 1.815681e-51 | 3.526888e-49 |
MsaG018523 | MsaG032149 | 0.806612 | 1.281789e-49 | 2.018271e-47 |
MsaG018626 | MsaG032149 | 0.809234 | 3.571491e-50 | 5.986997e-48 |
MsaG018670 | MsaG032149 | 0.828532 | 1.527663e-54 | 4.240583e-52 |
MsaG018809 | MsaG032149 | 0.842738 | 4.009169e-58 | 1.707104e-55 |
MsaG018780 | MsaG032149 | 0.848240 | 1.316177e-59 | 6.718806e-57 |
MsaG018928 | MsaG032149 | 0.804170 | 4.143128e-49 | 6.161469e-47 |
MsaG018970 | MsaG032149 | 0.843708 | 2.215923e-58 | 9.733892e-56 |
MsaG018997 | MsaG032149 | 0.815683 | 1.412423e-51 | 2.777995e-49 |
MsaG019007 | MsaG032149 | 0.816855 | 7.749279e-52 | 1.570409e-49 |
MsaG019017 | MsaG032149 | 0.809277 | 3.496084e-50 | 5.866766e-48 |
MsaG019109 | MsaG032149 | 0.828615 | 1.458619e-54 | 4.058289e-52 |
MsaG019130 | MsaG032149 | 0.834341 | 5.764900e-56 | 1.893404e-53 |
MsaG019206 | MsaG032149 | 0.843088 | 3.238702e-58 | 1.394585e-55 |
MsaG019297 | MsaG032149 | 0.816736 | 8.237326e-52 | 1.664220e-49 |
MsaG019422 | MsaG032149 | 0.802862 | 7.713613e-49 | 1.112908e-46 |
MsaG019467 | MsaG032149 | 0.844079 | 1.764589e-58 | 7.844440e-56 |
MsaG019430 | MsaG032149 | 0.850314 | 3.504426e-60 | 1.919598e-57 |
MsaG019542 | MsaG032149 | 0.810327 | 2.083592e-50 | 3.586703e-48 |
MsaG019571 | MsaG032149 | 0.836076 | 2.113652e-56 | 7.311852e-54 |
MsaG019624 | MsaG032149 | 0.865137 | 1.468055e-64 | 1.394609e-61 |
MsaG019656 | MsaG032149 | 0.829365 | 9.619554e-55 | 2.733696e-52 |
MsaG019783 | MsaG032149 | 0.814271 | 2.896944e-51 | 5.498184e-49 |
MsaG020004 | MsaG032149 | 0.829725 | 7.869641e-55 | 2.259707e-52 |
MsaG020062 | MsaG032149 | 0.836588 | 1.568140e-56 | 5.508929e-54 |
MsaG020220 | MsaG032149 | 0.868849 | 9.735859e-66 | 1.075319e-62 |
MsaG020294 | MsaG032149 | 0.875769 | 4.927181e-68 | 7.333098e-65 |
MsaG020323 | MsaG032149 | 0.813786 | 3.701348e-51 | 6.940243e-49 |
MsaG020429 | MsaG032149 | 0.836723 | 1.448901e-56 | 5.110894e-54 |
MsaG020424 | MsaG032149 | 0.811698 | 1.055005e-50 | 1.877996e-48 |
MsaG020449 | MsaG032149 | 0.812864 | 5.888051e-51 | 1.078807e-48 |
MsaG020469 | MsaG032149 | 0.850596 | 2.923385e-60 | 1.617370e-57 |
MsaG020522 | MsaG032149 | 0.828154 | 1.882300e-54 | 5.169683e-52 |
MsaG020481 | MsaG032149 | 0.818582 | 3.172931e-52 | 6.722971e-50 |
MsaG020559 | MsaG032149 | 0.835441 | 3.055629e-56 | 1.037126e-53 |
MsaG020645 | MsaG032149 | 0.868286 | 1.477403e-65 | 1.594554e-62 |
MsaG020686 | MsaG032149 | 0.809351 | 3.370567e-50 | 5.666264e-48 |
MsaG020784 | MsaG032149 | 0.869696 | 5.181857e-66 | 5.928988e-63 |
MsaG020787 | MsaG032149 | 0.831870 | 2.359092e-55 | 7.206517e-53 |
MsaG020806 | MsaG032149 | 0.813309 | 4.706549e-51 | 8.719584e-49 |
MsaG020814 | MsaG032149 | 0.808047 | 6.384959e-50 | 1.040237e-47 |
MsaG020815 | MsaG032149 | 0.811100 | 1.420544e-50 | 2.491891e-48 |
MsaG020888 | MsaG032149 | 0.832216 | 1.939087e-55 | 5.982795e-53 |
MsaG020889 | MsaG032149 | 0.814635 | 2.408818e-51 | 4.613611e-49 |
MsaG020892 | MsaG032149 | 0.813397 | 4.503494e-51 | 8.361962e-49 |
MsaG020896 | MsaG032149 | 0.808549 | 4.996177e-50 | 8.238634e-48 |
MsaG020934 | MsaG032149 | 0.803203 | 6.561626e-49 | 9.542247e-47 |
MsaG021108 | MsaG032149 | 0.834964 | 4.025168e-56 | 1.346810e-53 |
MsaG021098 | MsaG032149 | 0.829204 | 1.052047e-54 | 2.975795e-52 |
MsaG021410 | MsaG032149 | 0.819118 | 2.400656e-52 | 5.158740e-50 |
MsaG021423 | MsaG032149 | 0.828521 | 1.536988e-54 | 4.265133e-52 |
MsaG021520 | MsaG032149 | 0.820005 | 1.509418e-52 | 3.320240e-50 |
MsaG021531 | MsaG032149 | 0.802327 | 9.931286e-49 | 1.415510e-46 |
MsaG022116 | MsaG032149 | 0.805484 | 2.208096e-49 | 3.385370e-47 |
MsaG022066 | MsaG032149 | 0.816860 | 7.728941e-52 | 1.566490e-49 |
MsaG022193 | MsaG032149 | 0.837783 | 7.782650e-57 | 2.835410e-54 |
MsaG022215 | MsaG032149 | 0.816734 | 8.248148e-52 | 1.666290e-49 |
MsaG022227 | MsaG032149 | 0.833537 | 9.139465e-56 | 2.931037e-53 |
MsaG022437 | MsaG032149 | 0.894824 | 3.849949e-75 | 1.468747e-71 |
MsaG022737 | MsaG032149 | 0.856496 | 6.006727e-62 | 4.097952e-59 |
MsaG022728 | MsaG032149 | 0.852048 | 1.141287e-60 | 6.641565e-58 |
MsaG022780 | MsaG032149 | 0.808273 | 5.717712e-50 | 9.366109e-48 |
MsaG022894 | MsaG032149 | 0.860984 | 2.780478e-63 | 2.244074e-60 |
MsaG023119 | MsaG032149 | 0.807334 | 9.033623e-50 | 1.446793e-47 |
MsaG023120 | MsaG032149 | 0.838513 | 5.059544e-57 | 1.885370e-54 |
MsaG023205 | MsaG032149 | 0.830511 | 5.072873e-55 | 1.489640e-52 |
MsaG023249 | MsaG032149 | 0.807736 | 7.428228e-50 | 1.201204e-47 |
MsaG023277 | MsaG032149 | 0.828387 | 1.655376e-54 | 4.576392e-52 |
MsaG023341 | MsaG032149 | 0.861406 | 2.069984e-63 | 1.697893e-60 |
MsaG023396 | MsaG032149 | 0.801935 | 1.194391e-48 | 1.687161e-46 |
MsaG023415 | MsaG032149 | 0.801893 | 1.218332e-48 | 1.719383e-46 |
MsaG023503 | MsaG032149 | 0.817236 | 6.369969e-52 | 1.303678e-49 |
MsaG023545 | MsaG032149 | 0.815977 | 1.215487e-51 | 2.408559e-49 |
MsaG023667 | MsaG032149 | 0.823498 | 2.369859e-53 | 5.722441e-51 |
MsaG023680 | MsaG032149 | 0.835346 | 3.227566e-56 | 1.092367e-53 |
MsaG023810 | MsaG032149 | 0.832089 | 2.084681e-55 | 6.408821e-53 |
MsaG023823 | MsaG032149 | 0.823644 | 2.191224e-53 | 5.312521e-51 |
MsaG023887 | MsaG032149 | 0.868730 | 1.063262e-65 | 1.168644e-62 |
MsaG023967 | MsaG032149 | 0.801814 | 1.264602e-48 | 1.781435e-46 |
MsaG023991 | MsaG032149 | 0.845195 | 8.859262e-59 | 4.085397e-56 |
MsaG024060 | MsaG032149 | 0.806001 | 1.721988e-49 | 2.672246e-47 |
MsaG024036 | MsaG032149 | 0.863311 | 5.412493e-64 | 4.781797e-61 |
MsaG024263 | MsaG032149 | 0.807943 | 6.717394e-50 | 1.091683e-47 |
MsaG024314 | MsaG032149 | 0.858733 | 1.316029e-62 | 9.752395e-60 |
MsaG024331 | MsaG032149 | 0.872549 | 5.993827e-67 | 7.743835e-64 |
MsaG024548 | MsaG032149 | 0.826713 | 4.155395e-54 | 1.096161e-51 |
MsaG024620 | MsaG032149 | 0.801395 | 1.539828e-48 | 2.148578e-46 |
MsaG024640 | MsaG032149 | 0.840475 | 1.572883e-57 | 6.232463e-55 |
MsaG024831 | MsaG032149 | 0.830644 | 4.707815e-55 | 1.387692e-52 |
MsaG024908 | MsaG032149 | 0.809594 | 2.991648e-50 | 5.059068e-48 |
MsaG025145 | MsaG032149 | 0.808006 | 6.512736e-50 | 1.060033e-47 |
MsaG025152 | MsaG032149 | 0.838020 | 6.769524e-57 | 2.484286e-54 |
MsaG025282 | MsaG032149 | 0.859167 | 9.770149e-63 | 7.359346e-60 |
MsaG025324 | MsaG032149 | 0.803824 | 4.884990e-49 | 7.206662e-47 |
MsaG025325 | MsaG032149 | 0.815689 | 1.408742e-51 | 2.771122e-49 |
MsaG025351 | MsaG032149 | 0.823134 | 2.879838e-53 | 6.885645e-51 |
MsaG025502 | MsaG032149 | 0.817370 | 5.943904e-52 | 1.220671e-49 |
MsaG025542 | MsaG032149 | 0.808026 | 6.448937e-50 | 1.050161e-47 |
MsaG025714 | MsaG032149 | 0.835740 | 2.569343e-56 | 8.798844e-54 |
MsaG025722 | MsaG032149 | 0.800918 | 1.925198e-48 | 2.657442e-46 |
MsaG025845 | MsaG032149 | 0.828235 | 1.800469e-54 | 4.956049e-52 |
MsaG026041 | MsaG032149 | 0.852293 | 9.729724e-61 | 5.710712e-58 |
MsaG026220 | MsaG032149 | 0.832865 | 1.341187e-55 | 4.217010e-53 |
MsaG026479 | MsaG032149 | 0.850815 | 2.537686e-60 | 1.414601e-57 |
MsaG026672 | MsaG032149 | 0.802081 | 1.115205e-48 | 1.580540e-46 |
MsaG026937 | MsaG032149 | 0.858475 | 1.570069e-62 | 1.152435e-59 |
MsaG026892 | MsaG032149 | 0.826235 | 5.396184e-54 | 1.404610e-51 |
MsaG026974 | MsaG032149 | 0.819760 | 1.715822e-52 | 3.749604e-50 |
MsaG027022 | MsaG032149 | 0.810873 | 1.590283e-50 | 2.774095e-48 |
MsaG027159 | MsaG032149 | 0.819195 | 2.305606e-52 | 4.964528e-50 |
MsaG027160 | MsaG032149 | 0.849501 | 5.901932e-60 | 3.144999e-57 |
MsaG027171 | MsaG032149 | 0.805807 | 1.890163e-49 | 2.919965e-47 |
MsaG027208 | MsaG032149 | 0.828738 | 1.362368e-54 | 3.803429e-52 |
MsaG027250 | MsaG032149 | 0.801769 | 1.291484e-48 | 1.817407e-46 |
MsaG027359 | MsaG032149 | 0.857199 | 3.737908e-62 | 2.616063e-59 |
MsaG027414 | MsaG032149 | 0.829163 | 1.076225e-54 | 3.040830e-52 |
MsaG027462 | MsaG032149 | 0.838838 | 4.175160e-57 | 1.571766e-54 |
MsaG027447 | MsaG032149 | 0.807878 | 6.932110e-50 | 1.124843e-47 |
MsaG027469 | MsaG032149 | 0.814135 | 3.102417e-51 | 5.868057e-49 |
MsaG027652 | MsaG032149 | 0.817683 | 5.057147e-52 | 1.046897e-49 |
MsaG027672 | MsaG032149 | 0.847432 | 2.191256e-59 | 1.088773e-56 |
MsaG027749 | MsaG032149 | 0.808931 | 4.143664e-50 | 6.896106e-48 |
MsaG027897 | MsaG032149 | 0.815975 | 1.217023e-51 | 2.411494e-49 |
MsaG027957 | MsaG032149 | 0.853343 | 4.891546e-61 | 2.978781e-58 |
MsaG027991 | MsaG032149 | 0.819530 | 1.935839e-52 | 4.204899e-50 |
MsaG028091 | MsaG032149 | 0.841455 | 8.724504e-58 | 3.565614e-55 |
MsaG028204 | MsaG032149 | 0.825101 | 9.992090e-54 | 2.520485e-51 |
MsaG028256 | MsaG032149 | 0.801390 | 1.543526e-48 | 2.153486e-46 |
MsaG028250 | MsaG032149 | 0.827416 | 2.826970e-54 | 7.604892e-52 |
MsaG028308 | MsaG032149 | 0.843429 | 2.628065e-58 | 1.144126e-55 |
MsaG028318 | MsaG032149 | 0.812654 | 6.542507e-51 | 1.192439e-48 |
MsaG028370 | MsaG032149 | 0.843572 | 2.408770e-58 | 1.053459e-55 |
MsaG028328 | MsaG032149 | 0.847035 | 2.812941e-59 | 1.379065e-56 |
MsaG028350 | MsaG032149 | 0.807666 | 7.686346e-50 | 1.240829e-47 |
MsaG028510 | MsaG032149 | 0.811077 | 1.436861e-50 | 2.519107e-48 |
MsaG028481 | MsaG032149 | 0.865304 | 1.301310e-64 | 1.244477e-61 |
MsaG028487 | MsaG032149 | 0.863789 | 3.853776e-64 | 3.469574e-61 |
MsaG028529 | MsaG032149 | 0.805847 | 1.854435e-49 | 2.867498e-47 |
MsaG028590 | MsaG032149 | 0.809486 | 3.154804e-50 | 5.321326e-48 |
MsaG028644 | MsaG032149 | 0.827062 | 3.432992e-54 | 9.143906e-52 |
MsaG028664 | MsaG032149 | 0.816410 | 9.736823e-52 | 1.950766e-49 |
MsaG028681 | MsaG032149 | 0.854646 | 2.068528e-61 | 1.319531e-58 |
MsaG028688 | MsaG032149 | 0.835987 | 2.224831e-56 | 7.675851e-54 |
MsaG028708 | MsaG032149 | 0.808690 | 4.663529e-50 | 7.716591e-48 |
MsaG028711 | MsaG032149 | 0.808300 | 5.643000e-50 | 9.249697e-48 |
MsaG028713 | MsaG032149 | 0.868659 | 1.121152e-65 | 1.228743e-62 |
MsaG028821 | MsaG032149 | 0.831690 | 2.611981e-55 | 7.937164e-53 |
MsaG028868 | MsaG032149 | 0.804195 | 4.092683e-49 | 6.090136e-47 |
MsaG028862 | MsaG032149 | 0.806097 | 1.643657e-49 | 2.556647e-47 |
MsaG028873 | MsaG032149 | 0.854894 | 1.754510e-61 | 1.129151e-58 |
MsaG028935 | MsaG032149 | 0.803251 | 6.413151e-49 | 9.336528e-47 |
MsaG028982 | MsaG032149 | 0.833136 | 1.149282e-55 | 3.642839e-53 |
MsaG028916 | MsaG032149 | 0.808210 | 5.895207e-50 | 9.642208e-48 |
MsaG028990 | MsaG032149 | 0.841169 | 1.036743e-57 | 4.198986e-55 |
MsaG029044 | MsaG032149 | 0.833620 | 8.715439e-56 | 2.801912e-53 |
MsaG029132 | MsaG032149 | 0.831709 | 2.583852e-55 | 7.856268e-53 |
MsaG029082 | MsaG032149 | 0.827596 | 2.560414e-54 | 6.922870e-52 |
MsaG029083 | MsaG032149 | 0.808182 | 5.976658e-50 | 9.768883e-48 |
MsaG029342 | MsaG032149 | 0.863368 | 5.199703e-64 | 4.604416e-61 |
MsaG029362 | MsaG032149 | 0.852344 | 9.409581e-61 | 5.532748e-58 |
MsaG029459 | MsaG032149 | 0.880157 | 1.460342e-69 | 2.654752e-66 |
MsaG029470 | MsaG032149 | 0.835259 | 3.393976e-56 | 1.145646e-53 |
MsaG029512 | MsaG032149 | 0.855557 | 1.127727e-61 | 7.434172e-59 |
MsaG029480 | MsaG032149 | 0.874843 | 1.017952e-67 | 1.454201e-64 |
MsaG029545 | MsaG032149 | 0.828505 | 1.550083e-54 | 4.299579e-52 |
MsaG029595 | MsaG032149 | 0.851626 | 1.501307e-60 | 8.606070e-58 |
MsaG029734 | MsaG032149 | 0.808666 | 4.718086e-50 | 7.802381e-48 |
MsaG029781 | MsaG032149 | 0.840549 | 1.504533e-57 | 5.975540e-55 |
MsaG029762 | MsaG032149 | 0.823298 | 2.637875e-53 | 6.335347e-51 |
MsaG029838 | MsaG032149 | 0.804119 | 4.245323e-49 | 6.306039e-47 |
MsaG029868 | MsaG032149 | 0.842453 | 4.767814e-58 | 2.011781e-55 |
MsaG029852 | MsaG032149 | 0.811908 | 9.500582e-51 | 1.699975e-48 |
MsaG029878 | MsaG032149 | 0.832375 | 1.772441e-55 | 5.493936e-53 |
MsaG029939 | MsaG032149 | 0.817771 | 4.831634e-52 | 1.002537e-49 |
MsaG029941 | MsaG032149 | 0.810648 | 1.777735e-50 | 3.084221e-48 |
MsaG030158 | MsaG032149 | 0.876030 | 4.013034e-68 | 6.042163e-65 |
MsaG030267 | MsaG032149 | 0.858422 | 1.627265e-62 | 1.192080e-59 |
MsaG030222 | MsaG032149 | 0.801939 | 1.192082e-48 | 1.684073e-46 |
MsaG030237 | MsaG032149 | 0.869278 | 7.076363e-66 | 7.956112e-63 |
MsaG030510 | MsaG032149 | 0.825382 | 8.580515e-54 | 2.181178e-51 |
MsaG030548 | MsaG032149 | 0.850746 | 2.653149e-60 | 1.475309e-57 |
MsaG030605 | MsaG032149 | 0.818214 | 3.840736e-52 | 8.060956e-50 |
MsaG030602 | MsaG032149 | 0.805795 | 1.901824e-49 | 2.937112e-47 |
MsaG030710 | MsaG032149 | 0.828251 | 1.784026e-54 | 4.913025e-52 |
MsaG030774 | MsaG032149 | 0.843997 | 1.855272e-58 | 8.224971e-56 |
MsaG030785 | MsaG032149 | 0.816250 | 1.057236e-51 | 2.109573e-49 |
MsaG030786 | MsaG032149 | 0.852348 | 9.383664e-61 | 5.518384e-58 |
MsaG030804 | MsaG032149 | 0.801058 | 1.803665e-48 | 2.497486e-46 |
MsaG030986 | MsaG032149 | 0.801990 | 1.163891e-48 | 1.646114e-46 |
MsaG031021 | MsaG032149 | 0.868945 | 9.067493e-66 | 1.005463e-62 |
MsaG031057 | MsaG032149 | 0.816012 | 1.193959e-51 | 2.367954e-49 |
MsaG031090 | MsaG032149 | 0.831425 | 3.033634e-55 | 9.146771e-53 |
MsaG031241 | MsaG032149 | 0.811050 | 1.456282e-50 | 2.551472e-48 |
MsaG031393 | MsaG032149 | 0.834462 | 5.376162e-56 | 1.772092e-53 |
MsaG031420 | MsaG032149 | 0.811059 | 1.449376e-50 | 2.539982e-48 |
MsaG031645 | MsaG032149 | 0.855480 | 1.186981e-61 | 7.803035e-59 |
MsaG031819 | MsaG032149 | 0.813126 | 5.160988e-51 | 9.518016e-49 |
MsaG032101 | MsaG032149 | 0.825775 | 6.931633e-54 | 1.781384e-51 |
MsaG032149 | MsaG032026 | 0.808651 | 4.752430e-50 | 7.856158e-48 |
MsaG032149 | MsaG032298 | 0.821650 | 6.341935e-53 | 1.457119e-50 |
MsaG032149 | MsaG032208 | 0.805263 | 2.455352e-49 | 3.745206e-47 |
MsaG032149 | MsaG032404 | 0.881073 | 6.885220e-70 | 1.306350e-66 |
MsaG032149 | MsaG032569 | 0.824893 | 1.118371e-53 | 2.805057e-51 |
MsaG032149 | MsaG032571 | 0.810745 | 1.694277e-50 | 2.946307e-48 |
MsaG032149 | MsaG032806 | 0.801842 | 1.247988e-48 | 1.759146e-46 |
MsaG032149 | MsaG033134 | 0.820774 | 1.007539e-52 | 2.261704e-50 |
MsaG032149 | MsaG033410 | 0.847801 | 1.736766e-59 | 8.737458e-57 |
MsaG032149 | MsaG033524 | 0.814329 | 2.812016e-51 | 5.344799e-49 |
MsaG032149 | MsaG033639 | 0.870952 | 2.017764e-66 | 2.434554e-63 |
MsaG032149 | MsaG033712 | 0.842704 | 4.092156e-58 | 1.740612e-55 |
MsaG032149 | MsaG033805 | 0.809029 | 3.948481e-50 | 6.586788e-48 |
MsaG032149 | MsaG033823 | 0.805622 | 2.066385e-49 | 3.178410e-47 |
MsaG032149 | MsaG033863 | 0.802090 | 1.110516e-48 | 1.574207e-46 |
MsaG032149 | MsaG033961 | 0.840672 | 1.397797e-57 | 5.572962e-55 |
MsaG032149 | MsaG033989 | 0.822996 | 3.100227e-53 | 7.385081e-51 |
MsaG032149 | MsaG034204 | 0.833751 | 8.088923e-56 | 2.610479e-53 |
MsaG032149 | MsaG034221 | 0.825696 | 7.236370e-54 | 1.855624e-51 |
MsaG032149 | MsaG034149 | 0.864259 | 2.755461e-64 | 2.527502e-61 |
MsaG032149 | MsaG034173 | 0.825943 | 6.326642e-54 | 1.633609e-51 |
MsaG032149 | MsaG034248 | 0.856171 | 7.472188e-62 | 5.037104e-59 |
MsaG032149 | MsaG034252 | 0.834854 | 4.288687e-56 | 1.430330e-53 |
MsaG032149 | MsaG034308 | 0.868984 | 8.804678e-66 | 9.779503e-63 |
MsaG032149 | MsaG034398 | 0.833802 | 7.854522e-56 | 2.538573e-53 |
MsaG032149 | MsaG034416 | 0.856633 | 5.479500e-62 | 3.756541e-59 |
MsaG032149 | MsaG034439 | 0.839271 | 3.228671e-57 | 1.231870e-54 |
MsaG032149 | MsaG034544 | 0.854875 | 1.777008e-61 | 1.142839e-58 |
MsaG032149 | MsaG034548 | 0.820193 | 1.367794e-52 | 3.023836e-50 |
MsaG032149 | MsaG034559 | 0.809323 | 3.418076e-50 | 5.742089e-48 |
MsaG032149 | MsaG034605 | 0.806145 | 1.606606e-49 | 2.501771e-47 |
MsaG032149 | MsaG034676 | 0.823749 | 2.070615e-53 | 5.034291e-51 |
MsaG032149 | MsaG034798 | 0.851561 | 1.566134e-60 | 8.957489e-58 |
MsaG032149 | MsaG034851 | 0.821234 | 7.904609e-53 | 1.796224e-50 |
MsaG032149 | MsaG034957 | 0.825964 | 6.252288e-54 | 1.615365e-51 |
MsaG032149 | MsaG035104 | 0.832454 | 1.694509e-55 | 5.264461e-53 |
MsaG032149 | MsaG035118 | 0.834653 | 4.818026e-56 | 1.597232e-53 |
MsaG032149 | MsaG035152 | 0.800867 | 1.971797e-48 | 2.718665e-46 |
MsaG032149 | MsaG035254 | 0.800326 | 2.539668e-48 | 3.459061e-46 |
MsaG032149 | MsaG035296 | 0.812338 | 7.663577e-51 | 1.385864e-48 |
MsaG032149 | MsaG035317 | 0.801499 | 1.466360e-48 | 2.050886e-46 |
MsaG032149 | MsaG035409 | 0.816663 | 8.551336e-52 | 1.724370e-49 |
MsaG032149 | MsaG035377 | 0.867592 | 2.462473e-65 | 2.583400e-62 |
MsaG032149 | MsaG035412 | 0.805123 | 2.626592e-49 | 3.993420e-47 |
MsaG032149 | MsaG035414 | 0.820102 | 1.434477e-52 | 3.163578e-50 |
MsaG032149 | MsaG035644 | 0.811086 | 1.430494e-50 | 2.508472e-48 |
MsaG032149 | MsaG035634 | 0.806271 | 1.511480e-49 | 2.360821e-47 |
MsaG032149 | MsaG035683 | 0.812798 | 6.083811e-51 | 1.112863e-48 |
MsaG032149 | MsaG035731 | 0.806240 | 1.534112e-49 | 2.394402e-47 |
MsaG032149 | MsaG035700 | 0.837214 | 1.087305e-56 | 3.892850e-54 |
MsaG032149 | MsaG035749 | 0.882496 | 2.114476e-70 | 4.290888e-67 |
MsaG032149 | MsaG035804 | 0.804526 | 3.494856e-49 | 5.240433e-47 |
MsaG032149 | MsaG036062 | 0.843536 | 2.462120e-58 | 1.075586e-55 |
MsaG032149 | MsaG036289 | 0.810389 | 2.020800e-50 | 3.483925e-48 |
MsaG032149 | MsaG036421 | 0.805204 | 2.525577e-49 | 3.847157e-47 |
MsaG032149 | MsaG036523 | 0.848516 | 1.104825e-59 | 5.692143e-57 |
MsaG032149 | MsaG036577 | 0.821533 | 6.750322e-53 | 1.546088e-50 |
MsaG032149 | MsaG036690 | 0.821146 | 8.280759e-53 | 1.877385e-50 |
MsaG032149 | MsaG036718 | 0.831758 | 2.513926e-55 | 7.654453e-53 |
MsaG032149 | MsaG036844 | 0.801980 | 1.169506e-48 | 1.653696e-46 |
MsaG032149 | MsaG037713 | 0.835405 | 3.119594e-56 | 1.057677e-53 |
MsaG032149 | MsaG037816 | 0.825323 | 8.858354e-54 | 2.248232e-51 |
MsaG032149 | MsaG037874 | 0.849808 | 4.846838e-60 | 2.609667e-57 |
MsaG032149 | MsaG038011 | 0.820690 | 1.053292e-52 | 2.359103e-50 |
MsaG032149 | MsaG038043 | 0.809992 | 2.458075e-50 | 4.196907e-48 |
MsaG032149 | MsaG038354 | 0.815576 | 1.491946e-51 | 2.926389e-49 |
MsaG032149 | MsaG038973 | 0.842431 | 4.831153e-58 | 2.037041e-55 |
MsaG032149 | MsaG039166 | 0.806750 | 1.199002e-49 | 1.894023e-47 |
MsaG032149 | MsaG039418 | 0.835760 | 2.539039e-56 | 8.700353e-54 |
MsaG032149 | MsaG039397 | 0.831431 | 3.023776e-55 | 9.118514e-53 |
MsaG032149 | MsaG039424 | 0.874081 | 1.841724e-67 | 2.544038e-64 |
MsaG032149 | MsaG039578 | 0.827202 | 3.178328e-54 | 8.499033e-52 |
MsaG032149 | MsaG039760 | 0.836770 | 1.410124e-56 | 4.981235e-54 |
MsaG032149 | MsaG039946 | 0.839202 | 3.363805e-57 | 1.280626e-54 |
MsaG032149 | MsaG039918 | 0.820532 | 1.144649e-52 | 2.553185e-50 |
MsaG032149 | MsaG039840 | 0.801851 | 1.242747e-48 | 1.752119e-46 |
MsaG032149 | MsaG040143 | 0.824495 | 1.386621e-53 | 3.440280e-51 |
MsaG032149 | MsaG040171 | 0.812135 | 8.482699e-51 | 1.526251e-48 |
MsaG032149 | MsaG040191 | 0.824503 | 1.380282e-53 | 3.425338e-51 |
MsaG032149 | MsaG040208 | 0.824241 | 1.589503e-53 | 3.916379e-51 |
MsaG032149 | MsaG040343 | 0.831336 | 3.189330e-55 | 9.590824e-53 |
MsaG032149 | MsaG040365 | 0.847827 | 1.708505e-59 | 8.602735e-57 |
MsaG032149 | MsaG040480 | 0.853622 | 4.072525e-61 | 2.504627e-58 |
MsaG032149 | MsaG040407 | 0.825456 | 8.242443e-54 | 2.099547e-51 |
MsaG032149 | MsaG040578 | 0.844729 | 1.182104e-58 | 5.368504e-56 |
MsaG032149 | MsaG040583 | 0.845692 | 6.507989e-59 | 3.051120e-56 |
MsaG032149 | MsaG040666 | 0.804223 | 4.038439e-49 | 6.013340e-47 |
MsaG032149 | MsaG040673 | 0.817109 | 6.798902e-52 | 1.386924e-49 |
MsaG032149 | MsaG040683 | 0.802441 | 9.410696e-49 | 1.344792e-46 |
MsaG032149 | MsaG040747 | 0.849985 | 4.329056e-60 | 2.345058e-57 |
MsaG032149 | MsaG040767 | 0.862707 | 8.301520e-64 | 7.162122e-61 |
MsaG032149 | MsaG041210 | 0.808255 | 5.767879e-50 | 9.444250e-48 |
MsaG032149 | MsaG041320 | 0.800453 | 2.393662e-48 | 3.269664e-46 |
MsaG032149 | MsaG041350 | 0.828470 | 1.581068e-54 | 4.381227e-52 |
MsaG032149 | MsaG041481 | 0.813720 | 3.826433e-51 | 7.162576e-49 |
MsaG032149 | MsaG041597 | 0.828457 | 1.592281e-54 | 4.410719e-52 |
MsaG032149 | MsaG041785 | 0.831907 | 2.310162e-55 | 7.064596e-53 |
MsaG032149 | MsaG041817 | 0.832810 | 1.383697e-55 | 4.343671e-53 |
MsaG032149 | MsaG041920 | 0.823605 | 2.237367e-53 | 5.418558e-51 |
MsaG032149 | MsaG041926 | 0.849713 | 5.153450e-60 | 2.765918e-57 |
MsaG032149 | MsaG041973 | 0.831418 | 3.045642e-55 | 9.180980e-53 |
MsaG032149 | MsaG042072 | 0.878984 | 3.792861e-69 | 6.532499e-66 |
MsaG032149 | MsaG042124 | 0.839419 | 2.956264e-57 | 1.133144e-54 |
MsaG032149 | MsaG042138 | 0.835395 | 3.138112e-56 | 1.063616e-53 |
MsaG032149 | MsaG042142 | 0.867816 | 2.089311e-65 | 2.212029e-62 |
MsaG032149 | MsaG042535 | 0.851148 | 2.045982e-60 | 1.153643e-57 |
MsaG032149 | MsaG042546 | 0.816663 | 8.551601e-52 | 1.724422e-49 |
MsaG032149 | MsaG042755 | 0.816745 | 8.199558e-52 | 1.656997e-49 |
MsaG032149 | MsaG042767 | 0.837220 | 1.083241e-56 | 3.879063e-54 |
MsaG032149 | MsaG042823 | 0.801546 | 1.434598e-48 | 2.008584e-46 |
MsaG032149 | MsaG042825 | 0.813517 | 4.239159e-51 | 7.895070e-49 |
MsaG032149 | MsaG043225 | 0.825608 | 7.589484e-54 | 1.941331e-51 |
MsaG032149 | MsaG043285 | 0.819033 | 2.508960e-52 | 5.379470e-50 |
MsaG032149 | MsaG043390 | 0.810024 | 2.419637e-50 | 4.134428e-48 |
MsaG032149 | MsaG043563 | 0.804010 | 4.470828e-49 | 6.624315e-47 |
MsaG032149 | MsaG043881 | 0.824641 | 1.281255e-53 | 3.191435e-51 |
MsaG032149 | MsaG044018 | 0.824345 | 1.503332e-53 | 3.714760e-51 |
MsaG032149 | MsaG044052 | 0.833304 | 1.044589e-55 | 3.327041e-53 |
MsaG032149 | MsaG044120 | 0.806500 | 1.353400e-49 | 2.125348e-47 |
MsaG032149 | MsaG044233 | 0.837481 | 9.296364e-57 | 3.355844e-54 |
MsaG032149 | MsaG044333 | 0.823725 | 2.097767e-53 | 5.096948e-51 |
MsaG032149 | MsaG044382 | 0.830488 | 5.137087e-55 | 1.507496e-52 |
MsaG032149 | MsaG044383 | 0.808859 | 4.293066e-50 | 7.132418e-48 |
MsaG032149 | MsaG044390 | 0.843898 | 1.972301e-58 | 8.716200e-56 |
MsaG032149 | MsaG044522 | 0.809437 | 3.232132e-50 | 5.445134e-48 |
MsaG032149 | MsaG044614 | 0.903480 | 7.768864e-79 | 4.885522e-75 |
MsaG032149 | MsaG044621 | 0.835371 | 3.181313e-56 | 1.077532e-53 |
MsaG032149 | MsaG044623 | 0.811924 | 9.424752e-51 | 1.687082e-48 |
MsaG032149 | MsaG044633 | 0.803536 | 5.602955e-49 | 8.210966e-47 |
MsaG032149 | MsaG044710 | 0.821032 | 8.793633e-53 | 1.987656e-50 |
MsaG032149 | MsaG044691 | 0.840640 | 1.424849e-57 | 5.675086e-55 |
MsaG032149 | MsaG044760 | 0.816717 | 8.318670e-52 | 1.679841e-49 |
MsaG032149 | MsaG044894 | 0.806585 | 1.298530e-49 | 2.043302e-47 |
MsaG032149 | MsaG044904 | 0.836548 | 1.604810e-56 | 5.631165e-54 |
MsaG032149 | MsaG044912 | 0.805133 | 2.613750e-49 | 3.974893e-47 |
MsaG032149 | MsaG044925 | 0.831943 | 2.263871e-55 | 6.930247e-53 |
MsaG032149 | MsaG045113 | 0.807782 | 7.263366e-50 | 1.175852e-47 |
MsaG032149 | MsaG045179 | 0.836847 | 1.347663e-56 | 4.771683e-54 |
MsaG032149 | MsaG045212 | 0.816044 | 1.174871e-51 | 2.331964e-49 |
MsaG032149 | MsaG045263 | 0.832710 | 1.465482e-55 | 4.587036e-53 |
MsaG032149 | MsaG045357 | 0.860101 | 5.132096e-63 | 4.005756e-60 |
MsaG032149 | MsaG045438 | 0.819539 | 1.926715e-52 | 4.186033e-50 |
MsaG032149 | MsaG045461 | 0.888358 | 1.383038e-72 | 3.744307e-69 |
MsaG032149 | MsaG045508 | 0.857850 | 2.403548e-62 | 1.723571e-59 |
MsaG032149 | MsaG045558 | 0.813579 | 4.107469e-51 | 7.661709e-49 |
MsaG032149 | MsaG045574 | 0.823292 | 2.645973e-53 | 6.353839e-51 |
MsaG032149 | MsaG045738 | 0.830743 | 4.452304e-55 | 1.316174e-52 |
MsaG032149 | MsaG045695 | 0.880640 | 9.831951e-70 | 1.828822e-66 |
MsaG032149 | MsaG045760 | 0.813201 | 4.969031e-51 | 9.181361e-49 |
MsaG032149 | MsaG045764 | 0.807144 | 9.908092e-50 | 1.579700e-47 |
MsaG032149 | MsaG045788 | 0.849584 | 5.596845e-60 | 2.990944e-57 |
MsaG032149 | MsaG045813 | 0.900899 | 1.065182e-77 | 5.746296e-74 |
MsaG032149 | MsaG045870 | 0.811638 | 1.086676e-50 | 1.931529e-48 |
MsaG032149 | MsaG045873 | 0.864139 | 3.002348e-64 | 2.740705e-61 |
MsaG032149 | MsaG045904 | 0.810643 | 1.782285e-50 | 3.091700e-48 |
MsaG032149 | MsaG045945 | 0.853348 | 4.875143e-61 | 2.969404e-58 |
MsaG032149 | MsaG045950 | 0.807137 | 9.939014e-50 | 1.584362e-47 |
MsaG032149 | MsaG045965 | 0.802099 | 1.105846e-48 | 1.567874e-46 |
MsaG032149 | MsaG045974 | 0.801106 | 1.763103e-48 | 2.444043e-46 |
MsaG032149 | MsaG046107 | 0.816877 | 7.663207e-52 | 1.553852e-49 |
MsaG032149 | MsaG046153 | 0.802667 | 8.455759e-49 | 1.214612e-46 |
MsaG032149 | MsaG046268 | 0.871352 | 1.491127e-66 | 1.829876e-63 |
MsaG032149 | MsaG046299 | 0.830423 | 5.328920e-55 | 1.560970e-52 |
MsaG032149 | MsaG046303 | 0.832045 | 2.136604e-55 | 6.560224e-53 |
MsaG032149 | MsaG046308 | 0.803034 | 7.108659e-49 | 1.029730e-46 |
MsaG032149 | MsaG046312 | 0.846114 | 5.005427e-59 | 2.379669e-56 |
MsaG032149 | MsaG046403 | 0.846323 | 4.391939e-59 | 2.102616e-56 |
MsaG032149 | MsaG046404 | 0.822894 | 3.272838e-53 | 7.774866e-51 |
MsaG032149 | MsaG046411 | 0.860904 | 2.938169e-63 | 2.364349e-60 |
MsaG032149 | MsaG046360 | 0.814089 | 3.175425e-51 | 5.999345e-49 |
MsaG032149 | MsaG046537 | 0.803735 | 5.095410e-49 | 7.501888e-47 |
MsaG032149 | MsaG046439 | 0.810298 | 2.114000e-50 | 3.636376e-48 |
MsaG032149 | MsaG046444 | 0.804061 | 4.363271e-49 | 6.472756e-47 |
MsaG032149 | MsaG046445 | 0.809484 | 3.157850e-50 | 5.326175e-48 |
MsaG032149 | MsaG046446 | 0.801952 | 1.185087e-48 | 1.674643e-46 |
MsaG032149 | MsaG046665 | 0.822740 | 3.553049e-53 | 8.405764e-51 |
MsaG032149 | MsaG046638 | 0.814686 | 2.347160e-51 | 4.501373e-49 |
MsaG032149 | MsaG046662 | 0.840584 | 1.473708e-57 | 5.859481e-55 |
MsaG032149 | MsaG046702 | 0.847945 | 1.586276e-59 | 8.018519e-57 |
MsaG032149 | MsaG046742 | 0.814230 | 2.956978e-51 | 5.606512e-49 |
MsaG032149 | MsaG046786 | 0.809419 | 3.260687e-50 | 5.490797e-48 |
MsaG032149 | MsaG046956 | 0.804846 | 2.998483e-49 | 4.529753e-47 |
MsaG032149 | MsaG047030 | 0.808606 | 4.857589e-50 | 8.021099e-48 |
MsaG032149 | MsaG047044 | 0.822977 | 3.131942e-53 | 7.456903e-51 |
MsaG032149 | MsaG047081 | 0.811019 | 1.478468e-50 | 2.588358e-48 |
MsaG032149 | MsaG047118 | 0.827890 | 2.177927e-54 | 5.937481e-52 |
MsaG032149 | MsaG001077 | 0.813365 | 4.576503e-51 | 8.490673e-49 |
MsaG032149 | MsaG002031 | 0.844813 | 1.122114e-58 | 5.110571e-56 |
MsaG032149 | MsaG002231 | 0.841904 | 6.649773e-58 | 2.757060e-55 |
MsaG032149 | MsaG003278 | 0.829345 | 9.729586e-55 | 2.763331e-52 |
MsaG032149 | MsaG001947 | 0.853775 | 3.681176e-61 | 2.276476e-58 |
MsaG032149 | MsaG002445 | 0.834601 | 4.961974e-56 | 1.642417e-53 |
MsaG032149 | MsaG002582 | 0.807063 | 1.030276e-49 | 1.639478e-47 |
MsaG032149 | MsaG002307 | 0.807846 | 7.040836e-50 | 1.141582e-47 |
MsaG032149 | MsaG000843 | 0.816828 | 7.856923e-52 | 1.591129e-49 |
MsaG032149 | MsaG006154 | 0.832032 | 2.152117e-55 | 6.605273e-53 |
MsaG032149 | MsaG007338 | 0.832484 | 1.666217e-55 | 5.181077e-53 |
MsaG032149 | MsaG007923 | 0.809047 | 3.913983e-50 | 6.532161e-48 |
MsaG032149 | MsaG009719 | 0.876561 | 2.636946e-68 | 4.065510e-65 |
MsaG032149 | MsaG010441 | 0.803316 | 6.217928e-49 | 9.065925e-47 |
MsaG032149 | MsaG009633 | 0.834549 | 5.113931e-56 | 1.690022e-53 |
MsaG032149 | MsaG009207 | 0.801470 | 1.486293e-48 | 2.077401e-46 |
MsaG032149 | MsaG007871 | 0.822244 | 4.628836e-53 | 1.080493e-50 |
MsaG032149 | MsaG008905 | 0.813620 | 4.023674e-51 | 7.513026e-49 |
MsaG032149 | MsaG008820 | 0.821959 | 5.384450e-53 | 1.247315e-50 |
MsaG032149 | MsaG008541 | 0.803878 | 4.759991e-49 | 7.031034e-47 |
MsaG032149 | MsaG010534 | 0.839688 | 2.518421e-57 | 9.735731e-55 |
MsaG032149 | MsaG006772 | 0.800673 | 2.159258e-48 | 2.964244e-46 |
MsaG032149 | MsaG007163 | 0.814768 | 2.251735e-51 | 4.327359e-49 |
MsaG032149 | MsaG010555 | 0.846032 | 5.267179e-59 | 2.497266e-56 |
MsaG032149 | MsaG014302 | 0.839529 | 2.769093e-57 | 1.065049e-54 |
MsaG032149 | MsaG013008 | 0.856594 | 5.622809e-62 | 3.849494e-59 |
MsaG032149 | MsaG013186 | 0.877881 | 9.216642e-69 | 1.508593e-65 |
MsaG032149 | MsaG013872 | 0.874056 | 1.877220e-67 | 2.590182e-64 |
MsaG032149 | MsaG016152 | 0.855330 | 1.312638e-61 | 8.581774e-59 |
MsaG032149 | MsaG011491 | 0.886870 | 5.090578e-72 | 1.278676e-68 |
MsaG032149 | MsaG016790 | 0.830250 | 5.869259e-55 | 1.710756e-52 |
MsaG032149 | MsaG011682 | 0.823735 | 2.086155e-53 | 5.070235e-51 |
MsaG032149 | MsaG012253 | 0.835029 | 3.876523e-56 | 1.299683e-53 |
MsaG032149 | MsaG012734 | 0.867078 | 3.587763e-65 | 3.686184e-62 |
MsaG032149 | MsaG013115 | 0.808615 | 4.836564e-50 | 7.988072e-48 |
MsaG032149 | MsaG012242 | 0.802628 | 8.615561e-49 | 1.236443e-46 |
MsaG032149 | MsaG016720 | 0.848263 | 1.297151e-59 | 6.626720e-57 |
MsaG032149 | MsaG011653 | 0.863899 | 3.563589e-64 | 3.222034e-61 |
MsaG032149 | MsaG011818 | 0.837835 | 7.550017e-57 | 2.754917e-54 |
MsaG032149 | MsaG011654 | 0.822065 | 5.090575e-53 | 1.182579e-50 |
MsaG032149 | MsaG011633 | 0.832744 | 1.437401e-55 | 4.503700e-53 |
MsaG032149 | MsaG013842 | 0.833297 | 1.048406e-55 | 3.338568e-53 |
MsaG032149 | MsaG011836 | 0.816928 | 7.461593e-52 | 1.515038e-49 |
MsaG032149 | MsaG016849 | 0.812196 | 8.226869e-51 | 1.482480e-48 |
MsaG032149 | MsaG013237 | 0.827769 | 2.327311e-54 | 6.323310e-52 |
MsaG032149 | MsaG013857 | 0.801091 | 1.775647e-48 | 2.460600e-46 |
MsaG032149 | MsaG014799 | 0.801313 | 1.600055e-48 | 2.228459e-46 |
MsaG032149 | MsaG013434 | 0.834106 | 6.598511e-56 | 2.151809e-53 |
MsaG032149 | MsaG013071 | 0.861488 | 1.954967e-63 | 1.608602e-60 |
MsaG032149 | MsaG019389 | 0.814872 | 2.135056e-51 | 4.114002e-49 |
MsaG032149 | MsaG021945 | 0.837046 | 1.199318e-56 | 4.272170e-54 |
MsaG032149 | MsaG024279 | 0.829541 | 8.720171e-55 | 2.490754e-52 |
MsaG032149 | MsaG023050 | 0.839267 | 3.236035e-57 | 1.234541e-54 |
MsaG032149 | MsaG019319 | 0.866069 | 7.482681e-65 | 7.378243e-62 |
MsaG032149 | MsaG019753 | 0.838212 | 6.046044e-57 | 2.231993e-54 |
MsaG032149 | MsaG028385 | 0.866435 | 5.737030e-65 | 5.740824e-62 |
MsaG032149 | MsaG027945 | 0.802293 | 1.009089e-48 | 1.437115e-46 |
MsaG032149 | MsaG028104 | 0.808235 | 5.825736e-50 | 9.534226e-48 |
MsaG032149 | MsaG029395 | 0.855876 | 9.107493e-62 | 6.073055e-59 |
MsaG032149 | MsaG025855 | 0.815166 | 1.838720e-51 | 3.569263e-49 |
MsaG032149 | MsaG027031 | 0.820219 | 1.349458e-52 | 2.985356e-50 |
MsaG032149 | MsaG027453 | 0.829311 | 9.911047e-55 | 2.812187e-52 |
MsaG032149 | MsaG032723 | 0.822094 | 5.012584e-53 | 1.165354e-50 |
MsaG032149 | MsaG034293 | 0.851859 | 1.290861e-60 | 7.461240e-58 |
MsaG032149 | MsaG033142 | 0.828609 | 1.463788e-54 | 4.071959e-52 |
MsaG032149 | MsaG033056 | 0.838394 | 5.427695e-57 | 2.014999e-54 |
MsaG032149 | MsaG033838 | 0.831797 | 2.458269e-55 | 7.493609e-53 |
MsaG032149 | MsaG032967 | 0.845589 | 6.939521e-59 | 3.242145e-56 |
MsaG032149 | MsaG031512 | 0.806307 | 1.485601e-49 | 2.322341e-47 |
MsaG032149 | MsaG031626 | 0.852349 | 9.378261e-61 | 5.515336e-58 |
MsaG032149 | MsaG031428 | 0.803882 | 4.751313e-49 | 7.018843e-47 |
MsaG032149 | MsaG031473 | 0.808078 | 6.289373e-50 | 1.025433e-47 |
MsaG032149 | MsaG033438 | 0.831197 | 3.450127e-55 | 1.033289e-52 |
MsaG032149 | MsaG031225 | 0.831813 | 2.437053e-55 | 7.432352e-53 |
MsaG032149 | MsaG030582 | 0.888328 | 1.420933e-72 | 3.841447e-69 |
MsaG032149 | MsaG033085 | 0.838337 | 5.615217e-57 | 2.080934e-54 |
MsaG032149 | MsaG032865 | 0.862040 | 1.327811e-63 | 1.116125e-60 |
MsaG032149 | MsaG033440 | 0.821072 | 8.611744e-53 | 1.948534e-50 |
MsaG032149 | MsaG034520 | 0.833025 | 1.224475e-55 | 3.868111e-53 |
MsaG032149 | MsaG032081 | 0.812248 | 8.014195e-51 | 1.445989e-48 |
MsaG032149 | MsaG031702 | 0.839824 | 2.322377e-57 | 9.016141e-55 |
MsaG032149 | MsaG031977 | 0.805240 | 2.482599e-49 | 3.784828e-47 |
MsaG032149 | MsaG034539 | 0.811612 | 1.100990e-50 | 1.955734e-48 |
MsaG032149 | MsaG031808 | 0.870796 | 2.269461e-66 | 2.719839e-63 |
MsaG032149 | MsaG033622 | 0.801702 | 1.333097e-48 | 1.873115e-46 |
MsaG032149 | MsaG031718 | 0.841642 | 7.795105e-58 | 3.204668e-55 |
MsaG032149 | MsaG031850 | 0.813661 | 3.941568e-51 | 7.367201e-49 |
MsaG032149 | MsaG031900 | 0.835401 | 3.126526e-56 | 1.059899e-53 |
MsaG032149 | MsaG031391 | 0.804041 | 4.405983e-49 | 6.533075e-47 |
MsaG032149 | MsaG031507 | 0.839881 | 2.244040e-57 | 8.727789e-55 |
MsaG032149 | MsaG032809 | 0.829568 | 8.590799e-55 | 2.455697e-52 |
MsaG032149 | MsaG031279 | 0.816550 | 9.065437e-52 | 1.822758e-49 |
MsaG032149 | MsaG030727 | 0.821785 | 5.906317e-53 | 1.361823e-50 |
MsaG032149 | MsaG031810 | 0.837242 | 1.069535e-56 | 3.832450e-54 |
MsaG032149 | MsaG033182 | 0.835547 | 2.873535e-56 | 9.784261e-54 |
MsaG032149 | MsaG033058 | 0.815328 | 1.692908e-51 | 3.299829e-49 |
MsaG032149 | MsaG030207 | 0.836733 | 1.440779e-56 | 5.083745e-54 |
MsaG032149 | MsaG032866 | 0.806684 | 1.237994e-49 | 1.952588e-47 |
MsaG032149 | MsaG031699 | 0.846154 | 4.883305e-59 | 2.324664e-56 |
MsaG032149 | MsaG037377 | 0.801037 | 1.821018e-48 | 2.520407e-46 |
MsaG032149 | MsaG035814 | 0.827261 | 3.077454e-54 | 8.242994e-52 |
MsaG032149 | MsaG037392 | 0.866649 | 4.908151e-65 | 4.955634e-62 |
MsaG032149 | MsaG037840 | 0.815541 | 1.518859e-51 | 2.976530e-49 |
MsaG032149 | MsaG038277 | 0.811529 | 1.147806e-50 | 2.034712e-48 |
MsaG032149 | MsaG039794 | 0.826817 | 3.926701e-54 | 1.038766e-51 |
MsaG032149 | MsaG036600 | 0.803204 | 6.557165e-49 | 9.536089e-47 |
MsaG032149 | MsaG037022 | 0.827104 | 3.355172e-54 | 8.947410e-52 |
MsaG032149 | MsaG036868 | 0.840816 | 1.282292e-57 | 5.135547e-55 |
MsaG032149 | MsaG040619 | 0.865293 | 1.312140e-64 | 1.254289e-61 |
MsaG032149 | MsaG036648 | 0.810351 | 2.058485e-50 | 3.545670e-48 |
MsaG032149 | MsaG038711 | 0.804126 | 4.229836e-49 | 6.284124e-47 |
MsaG032149 | MsaG035726 | 0.856901 | 4.572593e-62 | 3.165637e-59 |
MsaG032149 | MsaG036963 | 0.816216 | 1.075888e-51 | 2.144920e-49 |
MsaG032149 | MsaG035918 | 0.808864 | 4.280837e-50 | 7.113037e-48 |
MsaG032149 | MsaG036743 | 0.853762 | 3.712316e-61 | 2.294662e-58 |
MsaG032149 | MsaG039091 | 0.841665 | 7.687524e-58 | 3.162839e-55 |
MsaG032149 | MsaG037217 | 0.843781 | 2.118472e-58 | 9.327140e-56 |
MsaG032149 | MsaG037488 | 0.801673 | 1.351004e-48 | 1.897054e-46 |
MsaG032149 | MsaG034934 | 0.810152 | 2.271735e-50 | 3.893793e-48 |
MsaG032149 | MsaG036499 | 0.807236 | 9.475641e-50 | 1.513990e-47 |
MsaG032149 | MsaG037254 | 0.800886 | 1.955009e-48 | 2.696640e-46 |
MsaG032149 | MsaG041479 | 0.812150 | 8.418198e-51 | 1.515189e-48 |
MsaG032149 | MsaG042304 | 0.882979 | 1.411624e-70 | 2.933062e-67 |
MsaG032149 | MsaG042525 | 0.810777 | 1.667665e-50 | 2.902343e-48 |
MsaG032149 | MsaG041446 | 0.809478 | 3.167789e-50 | 5.342098e-48 |
MsaG032149 | MsaG043685 | 0.834207 | 6.226933e-56 | 2.036820e-53 |
MsaG032149 | MsaG044400 | 0.813313 | 4.698627e-51 | 8.705735e-49 |
MsaG032149 | MsaG041441 | 0.802432 | 9.449020e-49 | 1.349994e-46 |
MsaG032149 | MsaG043242 | 0.855132 | 1.497869e-61 | 9.722511e-59 |
MsaG032149 | MsaG043164 | 0.813978 | 3.359738e-51 | 6.329883e-49 |
MsaG032149 | MsaG043528 | 0.864064 | 3.168354e-64 | 2.883649e-61 |
MsaG032149 | MsaG046894 | 0.817068 | 6.943557e-52 | 1.414930e-49 |
MsaG032149 | MsaG047176 | 0.853457 | 4.539165e-61 | 2.775474e-58 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG032149 | MtrunA17_Chr6g0462071 | 90.100 | 1505 | 125 | 7 | 1 | 1486 | 1 | 1500 | 0.0 | 2706 |
MsaG032149 | MtrunA17_Chr1g0200001 | 49.665 | 1343 | 575 | 31 | 1 | 1309 | 1 | 1276 | 0.0 | 1087 |
MsaG032149 | MtrunA17_Chr1g0200001 | 44.512 | 164 | 56 | 7 | 1313 | 1460 | 1358 | 1502 | 1.27e-21 | 102 |
MsaG032149 | MtrunA17_Chr6g0462081 | 66.165 | 266 | 88 | 2 | 864 | 1128 | 1 | 265 | 3.92e-99 | 318 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG032149 | AT3G52250.2 | 34.457 | 1068 | 600 | 29 | 142 | 1165 | 238 | 1249 | 4.04e-129 | 440 |
MsaG032149 | AT3G52250.2 | 40.881 | 159 | 85 | 6 | 9 | 162 | 9 | 163 | 7.55e-17 | 87.4 |
MsaG032149 | AT3G52250.1 | 34.457 | 1068 | 600 | 29 | 142 | 1165 | 238 | 1249 | 4.04e-129 | 440 |
MsaG032149 | AT3G52250.1 | 40.881 | 159 | 85 | 6 | 9 | 162 | 9 | 163 | 7.55e-17 | 87.4 |
Find 351 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
TCAAGTTTCTTGTGAGATTT+TGG | 0.134420 | 6:+46182627 | None:intergenic |
GTATTTACTACGTCGGAATT+TGG | 0.141403 | 6:+46184512 | None:intergenic |
GTTTGGAAAAGCTGCAAATT+TGG | 0.153589 | 6:-46183651 | MsaT032149.1:CDS |
CCATTGGCTGAACCTGTTTC+TGG | 0.155469 | 6:+46176626 | None:intergenic |
GAAGATGCCAGCATTAATTT+TGG | 0.173904 | 6:-46177626 | MsaT032149.1:CDS |
TTGGGTGTATCTTCTGAATT+TGG | 0.181231 | 6:+46175855 | None:intergenic |
CTCTCGTCGGAACAACTTTC+AGG | 0.181391 | 6:+46176905 | None:intergenic |
CTAAGAAGCCTAGGTTAAAT+TGG | 0.191299 | 6:-46184172 | MsaT032149.1:CDS |
TGGCACTTGAATTAGGCTTC+TGG | 0.217500 | 6:+46175790 | None:intergenic |
CTGGTTTCTGATGGTTCTTC+TGG | 0.225224 | 6:-46176206 | MsaT032149.1:CDS |
CCTGCGACTCCTGAAACTTT+TGG | 0.235548 | 6:+46184014 | None:intergenic |
TGATGGTTCTTCTGGCCTTC+AGG | 0.240054 | 6:-46176198 | MsaT032149.1:CDS |
GCTTAATTCCCTGTACTTAC+AGG | 0.250146 | 6:-46183028 | MsaT032149.1:CDS |
TTTCTCTTGGCACTTGAATT+AGG | 0.251600 | 6:+46175783 | None:intergenic |
GATAAAAGCCCAAAAGTTTC+AGG | 0.253799 | 6:-46184023 | MsaT032149.1:CDS |
TTGGAGAAATTTGCTGCCTT+TGG | 0.258612 | 6:-46177481 | MsaT032149.1:CDS |
AGATTTCAATGTTCCCTATA+CGG | 0.261869 | 6:-46175613 | MsaT032149.1:CDS |
TTACTGGATTCCATATTAAA+AGG | 0.266342 | 6:+46184068 | None:intergenic |
CGCATGTCGTCATCTATAAA+TGG | 0.276143 | 6:+46175495 | None:intergenic |
TCATGATGGCACACTCATTA+TGG | 0.279938 | 6:-46182772 | MsaT032149.1:CDS |
CTTCTTCTGATGACTATTAT+TGG | 0.282962 | 6:+46182587 | None:intergenic |
ACACCCAATGTGAAAATATT+CGG | 0.296339 | 6:-46175840 | MsaT032149.1:CDS |
ATCTCGGATAGCACAGAAAT+TGG | 0.297991 | 6:-46176329 | MsaT032149.1:CDS |
ATTTCATACTTGACGGTATC+AGG | 0.298242 | 6:+46177305 | None:intergenic |
AAAACGCTCTGCATTGGAAT+TGG | 0.299070 | 6:+46176765 | None:intergenic |
AATAATTTCTCCTATGCATC+TGG | 0.305170 | 6:-46176449 | MsaT032149.1:CDS |
GGCACTTGAATTAGGCTTCT+GGG | 0.305345 | 6:+46175791 | None:intergenic |
GCCAGGATTGAGGAAATTAC+TGG | 0.313227 | 6:+46184052 | None:intergenic |
CAGGGGAGTTCGGAGTCTTT+AGG | 0.319006 | 6:-46185548 | MsaT032149.1:CDS |
TCATCGAAGTTCTTGAATCT+TGG | 0.319044 | 6:+46176090 | None:intergenic |
AGGCTGGTCAACAGCTGTTT+TGG | 0.323193 | 6:+46176586 | None:intergenic |
CTTCATGCTCTATCATCTTT+CGG | 0.326522 | 6:-46176830 | MsaT032149.1:CDS |
GGACTGCGATGTTGAAAATT+CGG | 0.328924 | 6:-46183630 | MsaT032149.1:CDS |
TGAGTCAGCTGACAGGTTCC+TGG | 0.332880 | 6:+46176517 | None:intergenic |
GGTGTAGAAGATGGAGTTGT+AGG | 0.334932 | 6:+46183981 | None:intergenic |
TACAGAATTGGTGTCTGATA+TGG | 0.335594 | 6:-46176273 | MsaT032149.1:CDS |
GGCAAAAGGGTCAGGAAGTC+GGG | 0.337721 | 6:-46176986 | MsaT032149.1:CDS |
AAATGGTTCAGAAGAGAAAA+AGG | 0.338878 | 6:-46175466 | MsaT032149.1:CDS |
CGGTGATAATAATTCATCTT+TGG | 0.339436 | 6:-46182982 | MsaT032149.1:CDS |
TTGACTGGAAGCCACTTAAA+TGG | 0.341863 | 6:-46184388 | MsaT032149.1:CDS |
AAAGTATGAAAGGGGAAATA+AGG | 0.343807 | 6:-46184678 | MsaT032149.1:CDS |
TAAGAAGCCTAGGTTAAATT+GGG | 0.345550 | 6:-46184171 | MsaT032149.1:CDS |
TGTCTCAAGAACAATAATAT+TGG | 0.345719 | 6:-46182816 | MsaT032149.1:CDS |
AAATGAAAGACCAACATAAT+AGG | 0.346313 | 6:-46184475 | MsaT032149.1:CDS |
TCGGGTCGTTCACCTGGTCC+TGG | 0.348043 | 6:-46183611 | MsaT032149.1:CDS |
TGGCCTTCAGGGAAATGAAT+TGG | 0.358431 | 6:-46176186 | MsaT032149.1:CDS |
GTTTGCCTCCTGGACATATT+CGG | 0.363505 | 6:+46184590 | None:intergenic |
GATGGTTCTTCTGGCCTTCA+GGG | 0.364106 | 6:-46176197 | MsaT032149.1:CDS |
GCCAAGAGAAATGAAGAAAA+TGG | 0.367721 | 6:-46175771 | MsaT032149.1:CDS |
ATGTGATAGGGATAGTTCTC+TGG | 0.368355 | 6:-46184417 | MsaT032149.1:CDS |
TCTACAAATTTAGATCTTGC+AGG | 0.368817 | 6:+46183149 | None:intergenic |
AGAGAGGAAGCAGGGGAGTT+CGG | 0.370960 | 6:-46185558 | MsaT032149.1:CDS |
AAGTGAATCAATTTCAGTTT+CGG | 0.370982 | 6:+46183388 | None:intergenic |
GTGTTCCCATCACCCGTATA+GGG | 0.375289 | 6:+46175600 | None:intergenic |
TGAATAACGGCATGACTGTT+TGG | 0.375762 | 6:+46177121 | None:intergenic |
CTGAATTTGGCAAACACTGC+GGG | 0.378250 | 6:+46175868 | None:intergenic |
TTAGAATTTGTCTCTTCAAA+TGG | 0.378773 | 6:+46184191 | None:intergenic |
GGTTTATGACAATGATTTCC+AGG | 0.380130 | 6:-46175709 | MsaT032149.1:CDS |
ATTGATTCATTGACTAGGTT+GGG | 0.384484 | 6:-46183539 | MsaT032149.1:CDS |
ATCTGATAAGAAGCTGTATC+AGG | 0.384799 | 6:-46176561 | MsaT032149.1:CDS |
GACTGCGATGTTGAAAATTC+GGG | 0.385656 | 6:-46183629 | MsaT032149.1:CDS |
CAGATGGCATTGCGCTTAAT+CGG | 0.386249 | 6:-46177225 | MsaT032149.1:CDS |
TGTGCAGATGATAAATTGTT+TGG | 0.391566 | 6:-46183668 | MsaT032149.1:CDS |
GCTTCTGTGAATGTCATGTT+TGG | 0.394198 | 6:+46177654 | None:intergenic |
GTTTGGATTCTGAGAGTAGT+TGG | 0.400865 | 6:+46177671 | None:intergenic |
GCAAAGTATCCTGCTGCATT+TGG | 0.403728 | 6:-46175531 | MsaT032149.1:CDS |
GTACAGGTCAAAGATGTGAT+AGG | 0.405139 | 6:-46184430 | MsaT032149.1:CDS |
CGACGAGAGCTGCGGTGAAA+TGG | 0.405897 | 6:-46176891 | MsaT032149.1:CDS |
CACCCAATGTGAAAATATTC+GGG | 0.406635 | 6:-46175839 | MsaT032149.1:CDS |
AGACGTGACGTGGGGAGATA+TGG | 0.406882 | 6:-46183098 | MsaT032149.1:CDS |
TACAGATGTTGTAATTGAAT+TGG | 0.409060 | 6:-46176123 | MsaT032149.1:CDS |
CTTAGGAGGGACAAATTTGT+TGG | 0.411409 | 6:-46184309 | MsaT032149.1:CDS |
TCTAACTTGCTTGACAATCC+TGG | 0.412138 | 6:-46183173 | MsaT032149.1:CDS |
GAATTCCATTTCATACTTGA+CGG | 0.413629 | 6:+46177298 | None:intergenic |
TTCGACAGCGGTTGGCTCTC+TGG | 0.415388 | 6:-46183315 | MsaT032149.1:CDS |
TTCTGCTGCTGCGGATAGAC+TGG | 0.416419 | 6:-46176225 | MsaT032149.1:CDS |
AACATGTGCTCACGTTCTAC+TGG | 0.416666 | 6:+46184767 | None:intergenic |
AAACGCTCTGCATTGGAATT+GGG | 0.417642 | 6:+46176766 | None:intergenic |
CTCTCTTTCCTCTTGAATAA+CGG | 0.419103 | 6:+46177108 | None:intergenic |
CTAGAGACTGCATTAATCAT+AGG | 0.419249 | 6:+46183119 | None:intergenic |
TACACCTTGCAGCTCTTCAC+CGG | 0.423552 | 6:-46183964 | MsaT032149.1:CDS |
AGCTGCAAACAAACTAAGAT+TGG | 0.424695 | 6:-46177725 | MsaT032149.1:CDS |
AGGATACTTTGCGAGCAAAA+TGG | 0.426909 | 6:+46175542 | None:intergenic |
ATGAATCGGAGAAAATTAAC+AGG | 0.427634 | 6:-46176493 | MsaT032149.1:CDS |
GAATGGTGGCAAATCTAAAC+TGG | 0.430354 | 6:-46176426 | MsaT032149.1:CDS |
TGGTAATTGCTTTGAAGACT+TGG | 0.433361 | 6:-46183078 | MsaT032149.1:CDS |
ATGGATAGTGTTAATCGGTT+TGG | 0.433686 | 6:-46184452 | MsaT032149.1:CDS |
GGAAGCTGTGAAGGGAAGGA+TGG | 0.434270 | 6:-46184287 | MsaT032149.1:CDS |
TATTGATTCATTGACTAGGT+TGG | 0.436173 | 6:-46183540 | MsaT032149.1:CDS |
TGATACCGTCAAGTATGAAA+TGG | 0.436875 | 6:-46177303 | MsaT032149.1:CDS |
CTGATCCTGTGAAAGGCAAA+AGG | 0.438936 | 6:-46177000 | MsaT032149.1:CDS |
AATGCATGCATTCCAGAAAC+AGG | 0.440976 | 6:-46176638 | MsaT032149.1:CDS |
GATTTCAATGTTCCCTATAC+GGG | 0.443239 | 6:-46175612 | MsaT032149.1:CDS |
TGTGTTCCCATCACCCGTAT+AGG | 0.443770 | 6:+46175599 | None:intergenic |
ATTCCGACGTAGTAAATACT+TGG | 0.446307 | 6:-46184508 | MsaT032149.1:CDS |
CATCGGAGGTTGCTTGCATA+TGG | 0.446924 | 6:+46176952 | None:intergenic |
TCTCCATTCTCTGTGGCTAA+AGG | 0.448207 | 6:+46184643 | None:intergenic |
GGCAGCATGCCTGTAAGTAC+AGG | 0.448246 | 6:+46183019 | None:intergenic |
ATATTAAAAGGAGGTGAGAC+AGG | 0.448888 | 6:+46184080 | None:intergenic |
AAATCTTGTGATAAACATGT+TGG | 0.450717 | 6:-46183278 | MsaT032149.1:CDS |
CTCTGGCTATTGAGAAAGAA+AGG | 0.451886 | 6:-46177546 | MsaT032149.1:CDS |
CTGTGAAAGGCAAAAGGGTC+AGG | 0.452467 | 6:-46176994 | MsaT032149.1:CDS |
GGGATGATGTGGATGGTGGC+AGG | 0.452532 | 6:-46176673 | MsaT032149.1:CDS |
GACGACATGCGGAGAGCAAA+TGG | 0.453906 | 6:-46175483 | MsaT032149.1:CDS |
GTCATTGAGAGAGAGGAAGC+AGG | 0.455796 | 6:-46185567 | MsaT032149.1:CDS |
GAAGACCGCATGAGTTTAAT+CGG | 0.457127 | 6:-46185478 | MsaT032149.1:CDS |
TGGGCTGGTTGATGATCCTC+TGG | 0.457911 | 6:-46177563 | MsaT032149.1:CDS |
CTTAATCGGAAAATGCGTTC+AGG | 0.458740 | 6:-46177211 | MsaT032149.1:CDS |
CCGCATGAGTTTAATCGGTC+TGG | 0.459889 | 6:-46185473 | MsaT032149.1:CDS |
TCCAGTAATTTCCTCAATCC+TGG | 0.460282 | 6:-46184053 | MsaT032149.1:CDS |
TGATAATAATTCATCTTTGG+AGG | 0.460773 | 6:-46182979 | MsaT032149.1:CDS |
GATCTCATGGGTGAAATAGC+TGG | 0.460965 | 6:-46176713 | MsaT032149.1:CDS |
GTCAGCTGACTCAGATGAAT+CGG | 0.463425 | 6:-46176507 | MsaT032149.1:CDS |
AATTAATGCTGGCATCTTCA+AGG | 0.463472 | 6:+46177630 | None:intergenic |
TCGATCTTGTGACAAGAAGT+TGG | 0.466904 | 6:-46184741 | MsaT032149.1:CDS |
AATTTAGATCTTGCAGGTCC+AGG | 0.467794 | 6:+46183155 | None:intergenic |
ATAGGATGGATAGTGTTAAT+CGG | 0.469489 | 6:-46184457 | MsaT032149.1:CDS |
CGGGTCGTTCACCTGGTCCT+GGG | 0.470086 | 6:-46183610 | MsaT032149.1:CDS |
GTATAGGGAACATTGAAATC+TGG | 0.471245 | 6:+46175615 | None:intergenic |
ACACAAGCTTACTGTCTACT+AGG | 0.471389 | 6:-46182659 | MsaT032149.1:CDS |
TTCAGGACGTTCCCTATGGA+GGG | 0.471838 | 6:-46177194 | MsaT032149.1:CDS |
AATCTAATCCTGTGGAAGCC+AGG | 0.472609 | 6:-46176535 | MsaT032149.1:CDS |
AGGATCAGCTGAACTAGTTA+TGG | 0.473205 | 6:+46177015 | None:intergenic |
TGCTCTATCATCTTTCGGTA+AGG | 0.475088 | 6:-46176825 | MsaT032149.1:CDS |
GACAGGTTCCTGGCTTCCAC+AGG | 0.475637 | 6:+46176527 | None:intergenic |
AGCTGGAGTCGTCAGATCAC+CGG | 0.476078 | 6:-46176696 | MsaT032149.1:CDS |
ACAGAATTGGTGTCTGATAT+GGG | 0.477056 | 6:-46176272 | MsaT032149.1:CDS |
AATGTTCCCTATACGGGTGA+TGG | 0.478950 | 6:-46175606 | MsaT032149.1:CDS |
AGTGTTAATCGGTTTGGTAC+AGG | 0.479906 | 6:-46184446 | MsaT032149.1:CDS |
CTTCTGATGACTATTATTGG+TGG | 0.480012 | 6:+46182590 | None:intergenic |
ATGGAGGAACTCGCTGCCTC+AGG | 0.480085 | 6:+46177034 | None:intergenic |
AAAAGGACGACGACAAGCTA+GGG | 0.481934 | 6:-46177351 | MsaT032149.1:CDS |
GAACCTTTAGCCACAGAGAA+TGG | 0.482821 | 6:-46184646 | MsaT032149.1:CDS |
ACTTGCACCAGTTTGCCTCC+TGG | 0.483405 | 6:+46184580 | None:intergenic |
ATCTTCTGATGACCTTGTTG+TGG | 0.483739 | 6:-46183213 | MsaT032149.1:CDS |
TCAAGTGGCATGAGGAGCTT+AGG | 0.483808 | 6:-46184326 | MsaT032149.1:CDS |
AAGACGATCAGCAAGATTGA+AGG | 0.484063 | 6:-46182733 | MsaT032149.1:CDS |
CAGCTCATATTCACATTGAC+AGG | 0.485994 | 6:+46175957 | None:intergenic |
CACTATCCATCCTATTATGT+TGG | 0.487422 | 6:+46184465 | None:intergenic |
TAATGCAGCTGCTGATACAT+TGG | 0.488819 | 6:-46177083 | MsaT032149.1:CDS |
CCGCTGTTGTCTTGTGGTCA+AGG | 0.491935 | 6:+46177431 | None:intergenic |
CCTTCAGGGAAATGAATTGG+AGG | 0.493299 | 6:-46176183 | MsaT032149.1:CDS |
GAAAATTCGGGTCGTTCACC+TGG | 0.493680 | 6:-46183617 | MsaT032149.1:CDS |
TTCTTTCAATTTAGAGAAGG+TGG | 0.493820 | 6:-46183564 | MsaT032149.1:CDS |
TCAAGCAAGTTAGAAGAAAG+AGG | 0.494568 | 6:+46183182 | None:intergenic |
TTCTCCTATGCATCTGGGAA+TGG | 0.495144 | 6:-46176443 | MsaT032149.1:CDS |
AATATGTCCAGGAGGCAAAC+TGG | 0.495251 | 6:-46184587 | MsaT032149.1:CDS |
CCTGGATCTTCACGAGACTC+TGG | 0.495814 | 6:-46184359 | MsaT032149.1:CDS |
ACGCATTGGAATGGATCTCA+TGG | 0.497330 | 6:-46176726 | MsaT032149.1:CDS |
CCAGGTCGGGTCCATTTAAG+TGG | 0.500301 | 6:+46184377 | None:intergenic |
GCCAATGGCTCTGATACGTC+AGG | 0.500332 | 6:-46176611 | MsaT032149.1:CDS |
GCTGGAGTCGTCAGATCACC+GGG | 0.500493 | 6:-46176695 | MsaT032149.1:CDS |
CCACTTAAATGGACCCGACC+TGG | 0.502286 | 6:-46184377 | MsaT032149.1:CDS |
AGGCAAAAGGGTCAGGAAGT+CGG | 0.502960 | 6:-46176987 | MsaT032149.1:CDS |
GTTCTCTGGGTACAGTTGAC+TGG | 0.503691 | 6:-46184403 | MsaT032149.1:CDS |
TCTTTGTTTGAAGTTACCTC+AGG | 0.503730 | 6:+46184107 | None:intergenic |
TGGAGGTGCTGTTACAGAAT+TGG | 0.506687 | 6:-46176285 | MsaT032149.1:CDS |
CTGCTGATGAGTCATATTCA+AGG | 0.507101 | 6:-46184244 | MsaT032149.1:CDS |
CCGTCATTCTCTCGAGGGGA+TGG | 0.508388 | 6:-46184701 | MsaT032149.1:CDS |
CCAGAGTCTCGTGAAGATCC+AGG | 0.509576 | 6:+46184359 | None:intergenic |
GTCTCGTGAAGATCCAGGTC+GGG | 0.510305 | 6:+46184364 | None:intergenic |
AGCGAACACTTCTTCGCTTG+AGG | 0.511782 | 6:-46177272 | MsaT032149.1:CDS |
TACAGCTTCTTATCAGATGC+AGG | 0.512245 | 6:+46176566 | None:intergenic |
CTTCTCCACATCTGTCCAAT+CGG | 0.513579 | 6:+46176862 | None:intergenic |
GAGCTGCAAGGTGTAGAAGA+TGG | 0.515837 | 6:+46183972 | None:intergenic |
GAATAAGTTGATGTTATTGA+AGG | 0.516443 | 6:-46183438 | MsaT032149.1:CDS |
CCAGAGTGCTATAGTTATCT+CGG | 0.517020 | 6:-46176345 | MsaT032149.1:CDS |
TGCAAGACTCACAAACGCAT+TGG | 0.517176 | 6:-46176740 | MsaT032149.1:CDS |
TGCGTTCAGGACGTTCCCTA+TGG | 0.517909 | 6:-46177198 | MsaT032149.1:CDS |
TTAGGCTTCTGGGTGGATGA+AGG | 0.519936 | 6:+46175801 | None:intergenic |
TCTTTCTCTTCTGAAGTCCA+AGG | 0.521180 | 6:+46177511 | None:intergenic |
GATAAGAAGGCCATGTCAAA+GGG | 0.521573 | 6:-46177166 | MsaT032149.1:CDS |
TAACTATAGCACTCTGGTGC+CGG | 0.523458 | 6:+46176351 | None:intergenic |
TTAAAGCATTGCAACACTTG+TGG | 0.523604 | 6:-46182689 | MsaT032149.1:CDS |
TTAGGAGGGACAAATTTGTT+GGG | 0.524901 | 6:-46184308 | MsaT032149.1:CDS |
GCCTGACGTATCAGAGCCAT+TGG | 0.526569 | 6:+46176610 | None:intergenic |
TACTTGATCATCTCAGATGT+TGG | 0.528056 | 6:+46177700 | None:intergenic |
GACTCACAAACGCATTGGAA+TGG | 0.528455 | 6:-46176735 | MsaT032149.1:CDS |
TTGGACTTCAGAAGAGAAAG+AGG | 0.528606 | 6:-46177509 | MsaT032149.1:CDS |
AATTTGTTGGGAAGCTGTGA+AGG | 0.529111 | 6:-46184296 | MsaT032149.1:CDS |
TCTTATCATAACCCCTCCAT+AGG | 0.530003 | 6:+46177182 | None:intergenic |
TGATAAGAAGGCCATGTCAA+AGG | 0.530246 | 6:-46177167 | MsaT032149.1:CDS |
GCGATGATTGCTCAGTGTGT+TGG | 0.531362 | 6:-46176797 | MsaT032149.1:CDS |
CCCATGGCTAGAACTCATGA+TGG | 0.532113 | 6:+46175668 | None:intergenic |
TCTGACAAACCTGAGAATTG+AGG | 0.532128 | 6:+46175984 | None:intergenic |
GCCTAGGTTAAATTGGGGTG+AGG | 0.535961 | 6:-46184165 | MsaT032149.1:CDS |
CTTTAGGATCAGTAGCAAGA+TGG | 0.536242 | 6:-46185532 | MsaT032149.1:CDS |
GCGAGCAAAATGGAAGAAGC+AGG | 0.537277 | 6:+46175552 | None:intergenic |
CCAAAAGTTTCAGGAGTCGC+AGG | 0.537439 | 6:-46184014 | MsaT032149.1:CDS |
GAATACTTCACTATCACCCT+TGG | 0.537857 | 6:-46176069 | MsaT032149.1:CDS |
CCATGGCTAGAACTCATGAT+GGG | 0.538507 | 6:+46175669 | None:intergenic |
TCAGGAAGTCGGGGAAAGCG+AGG | 0.538717 | 6:-46176976 | MsaT032149.1:CDS |
TGACTTTGAGACCCAGGACC+AGG | 0.539807 | 6:+46183599 | None:intergenic |
GATTTGATTATTGATGTCGC+TGG | 0.540601 | 6:-46185618 | None:intergenic |
CTGACAGGACAGGTTCTGTC+CGG | 0.541173 | 6:-46176370 | MsaT032149.1:CDS |
AGACAAATTCTAAGAAGCCT+AGG | 0.541526 | 6:-46184181 | MsaT032149.1:CDS |
TCTTGAACAAGATGCTTCCA+AGG | 0.542554 | 6:+46176052 | None:intergenic |
GGGCATTGAAATCAATGCCC+TGG | 0.543279 | 6:+46175691 | None:intergenic |
ATGGAGGGGTTATGATAAGA+AGG | 0.543978 | 6:-46177179 | MsaT032149.1:CDS |
TATCTACTAAGCCAGGATTG+AGG | 0.544556 | 6:+46184042 | None:intergenic |
TCATTGAGAGAGAGGAAGCA+GGG | 0.545857 | 6:-46185566 | MsaT032149.1:CDS |
GCGTGTTGTATAGTTCTGAC+AGG | 0.546650 | 6:-46176385 | MsaT032149.1:CDS |
GTCATCGTAGGATGGGTAGT+TGG | 0.547053 | 6:-46184799 | MsaT032149.1:CDS |
ACACCTTGCAGCTCTTCACC+GGG | 0.549833 | 6:-46183963 | MsaT032149.1:intron |
AGGGGATGGAAAGTATGAAA+GGG | 0.552486 | 6:-46184687 | MsaT032149.1:CDS |
CACAATCCGCTGTTGTCTTG+TGG | 0.553168 | 6:+46177425 | None:intergenic |
GCTGCCAATGTTTCTGCCTG+CGG | 0.553285 | 6:-46183002 | MsaT032149.1:CDS |
TGCAGTCTCTAGACGTGACG+TGG | 0.553456 | 6:-46183108 | MsaT032149.1:CDS |
CAGTCATGCCGTTATTCAAG+AGG | 0.553730 | 6:-46177116 | MsaT032149.1:CDS |
CCTCCAATTCATTTCCCTGA+AGG | 0.554139 | 6:+46176183 | None:intergenic |
ATCTCTAAAATCTAAGTCTG+AGG | 0.555116 | 6:-46183351 | MsaT032149.1:CDS |
GCAGCTTCAGTGACGGCAGA+TGG | 0.556867 | 6:-46177241 | MsaT032149.1:CDS |
TTTGAAGGTCATCGTAGGAT+GGG | 0.557253 | 6:-46184806 | MsaT032149.1:intron |
CTTTCTCTTCTGAAGTCCAA+GGG | 0.557353 | 6:+46177512 | None:intergenic |
CATCAACTTATTCATTGTGG+TGG | 0.558543 | 6:+46183448 | None:intergenic |
CAATTCTCAGGTTTGTCAGA+GGG | 0.558911 | 6:-46175981 | MsaT032149.1:CDS |
CAGGCTGTACTGTGCTCCCA+TGG | 0.559128 | 6:+46175652 | None:intergenic |
GAAGCTGTGAAGGGAAGGAT+GGG | 0.559485 | 6:-46184286 | MsaT032149.1:CDS |
TACAGGTCAAAGATGTGATA+GGG | 0.562106 | 6:-46184429 | MsaT032149.1:CDS |
TGATCCTGTGAAAGGCAAAA+GGG | 0.562771 | 6:-46176999 | MsaT032149.1:CDS |
AAAGCTCGTCATTGAGAGAG+AGG | 0.563604 | 6:-46185574 | MsaT032149.1:CDS |
TGCTGATGAGTCATATTCAA+GGG | 0.563689 | 6:-46184243 | MsaT032149.1:CDS |
AGAATGGAGAGGACGTTCAT+CGG | 0.563712 | 6:-46184630 | MsaT032149.1:CDS |
ATTCATCTGAGTCAGCTGAC+AGG | 0.563734 | 6:+46176510 | None:intergenic |
AATGGTACCCATGATAATGC+TGG | 0.564415 | 6:-46175753 | MsaT032149.1:CDS |
ATCACCGCAGGCAGAAACAT+TGG | 0.564821 | 6:+46182998 | None:intergenic |
CTTTGAGTCATGACTGGCAT+CGG | 0.565674 | 6:+46176935 | None:intergenic |
GCGGATAGACTGGTTTCTGA+TGG | 0.565793 | 6:-46176215 | MsaT032149.1:CDS |
AGATGAATTATTATCACCGC+AGG | 0.567052 | 6:+46182986 | None:intergenic |
TGTGATAGGGATAGTTCTCT+GGG | 0.567753 | 6:-46184416 | MsaT032149.1:CDS |
GCTTCTTATCAGATGCAGGC+TGG | 0.568078 | 6:+46176570 | None:intergenic |
TTGTATAGTTCTGACAGGAC+AGG | 0.568223 | 6:-46176380 | MsaT032149.1:CDS |
TCCTATGCATCTGGGAATGG+TGG | 0.569452 | 6:-46176440 | MsaT032149.1:CDS |
CCAGAAACAGGTTCAGCCAA+TGG | 0.570679 | 6:-46176626 | MsaT032149.1:CDS |
AGCTCCTCATGCCACTTGAA+CGG | 0.570700 | 6:+46184330 | None:intergenic |
TGAAGTCCAAGGGTTAATCA+TGG | 0.571044 | 6:+46177522 | None:intergenic |
GGATCAGTAGCAAGATGGAG+AGG | 0.571332 | 6:-46185527 | MsaT032149.1:CDS |
CTTCTGGGTGGATGAAGGAA+TGG | 0.571648 | 6:+46175806 | None:intergenic |
CTACTCTAATTCTGCTGCTG+CGG | 0.572527 | 6:-46176234 | MsaT032149.1:CDS |
GAGGGGATGGAAAGTATGAA+AGG | 0.572665 | 6:-46184688 | MsaT032149.1:CDS |
CCACCATCCACATCATCCCC+CGG | 0.572908 | 6:+46176677 | None:intergenic |
GTTGGGAAGCTGTGAAGGGA+AGG | 0.574290 | 6:-46184291 | MsaT032149.1:CDS |
CAGGAAGTCGGGGAAAGCGA+GGG | 0.574629 | 6:-46176975 | MsaT032149.1:CDS |
ATGTTCCCTATACGGGTGAT+GGG | 0.574725 | 6:-46175605 | MsaT032149.1:CDS |
GAGCTGAGATTATCAAATTG+TGG | 0.575142 | 6:+46183494 | None:intergenic |
AAAGGGCCATGATTAACCCT+TGG | 0.575607 | 6:-46177528 | MsaT032149.1:CDS |
AGTGGCATGAGGAGCTTAGG+AGG | 0.575652 | 6:-46184323 | MsaT032149.1:CDS |
GTCGCTGGAGCCGATACCGT+TGG | 0.576025 | 6:-46185603 | MsaT032149.1:CDS |
TCAATACTTTGAGTCATGAC+TGG | 0.576407 | 6:+46176929 | None:intergenic |
GTTCAGGACGTTCCCTATGG+AGG | 0.577250 | 6:-46177195 | MsaT032149.1:CDS |
ATAATTTCTCCTATGCATCT+GGG | 0.577921 | 6:-46176448 | MsaT032149.1:CDS |
ATCGGCCGTCATTCTCTCGA+GGG | 0.578662 | 6:-46184706 | MsaT032149.1:CDS |
TCTGGCTATTGAGAAAGAAA+GGG | 0.579078 | 6:-46177545 | MsaT032149.1:CDS |
GCATTCAGACCAAATGCAGC+AGG | 0.579481 | 6:+46175522 | None:intergenic |
TCTCTAAAATCTAAGTCTGA+GGG | 0.580011 | 6:-46183350 | MsaT032149.1:CDS |
GAAAGACCAACATAATAGGA+TGG | 0.580315 | 6:-46184471 | MsaT032149.1:CDS |
GATGGGAACACAATACAGTC+TGG | 0.581167 | 6:-46175588 | MsaT032149.1:CDS |
GCCACCATTCCCAGATGCAT+AGG | 0.582005 | 6:+46176439 | None:intergenic |
TACAAAATCAGCGAAGCTGA+AGG | 0.582263 | 6:-46175730 | MsaT032149.1:CDS |
CATTTCACCGCAGCTCTCGT+CGG | 0.584245 | 6:+46176892 | None:intergenic |
TCCGAACACATCTAACTACT+CGG | 0.585928 | 6:+46175441 | None:intergenic |
GTGAAATGGAGCTTACCGAT+TGG | 0.587122 | 6:-46176877 | MsaT032149.1:CDS |
AATAATATTGGAGCTAGTAG+TGG | 0.587415 | 6:-46182804 | MsaT032149.1:CDS |
CCGAGATAACTATAGCACTC+TGG | 0.587986 | 6:+46176345 | None:intergenic |
AAAGATAAGCCGAGTGAAGG+TGG | 0.588194 | 6:-46176305 | MsaT032149.1:CDS |
TCAGGACGTTCCCTATGGAG+GGG | 0.588272 | 6:-46177193 | MsaT032149.1:CDS |
GGAACATTGAAATCTGGAAG+TGG | 0.588653 | 6:+46175621 | None:intergenic |
CTTTCTTTCTCAATAGCCAG+AGG | 0.589301 | 6:+46177547 | None:intergenic |
TGCACATGACTTTGAGACCC+AGG | 0.589709 | 6:+46183593 | None:intergenic |
CCTAGGTTAAATTGGGGTGA+GGG | 0.590217 | 6:-46184164 | MsaT032149.1:CDS |
ACAACGCTCCGAATATGTCC+AGG | 0.590664 | 6:-46184598 | MsaT032149.1:CDS |
CGATTGGACAGATGTGGAGA+AGG | 0.591263 | 6:-46176861 | MsaT032149.1:CDS |
CTGGCCACGGATGATAATGT+TGG | 0.591336 | 6:-46176407 | MsaT032149.1:CDS |
CCATCATGAGTTCTAGCCAT+GGG | 0.592587 | 6:-46175668 | MsaT032149.1:CDS |
TGGCAAATCTAAACTGGCCA+CGG | 0.593030 | 6:-46176420 | MsaT032149.1:CDS |
TAACATCAACTTATTCATTG+TGG | 0.593508 | 6:+46183445 | None:intergenic |
TGGATATTGATTCATTGACT+AGG | 0.593611 | 6:-46183544 | MsaT032149.1:CDS |
TCTGGAAGTGGTGAGAATGC+AGG | 0.594069 | 6:+46175633 | None:intergenic |
CGAGTTGATAGAGATGAAGC+TGG | 0.594782 | 6:-46176146 | MsaT032149.1:CDS |
GTTTATGACAATGATTTCCA+GGG | 0.595004 | 6:-46175708 | MsaT032149.1:CDS |
CTTATCATAACCCCTCCATA+GGG | 0.595052 | 6:+46177183 | None:intergenic |
AGTGGTTCATGCTCTCATGA+TGG | 0.595691 | 6:-46182786 | MsaT032149.1:CDS |
CCCTCACCCCAATTTAACCT+AGG | 0.596745 | 6:+46184164 | None:intergenic |
ATAATAGTCATCAGAAGAAG+CGG | 0.596870 | 6:-46182584 | MsaT032149.1:CDS |
TTTGAGAGCAGCTTCAGTGA+CGG | 0.598103 | 6:-46177248 | MsaT032149.1:CDS |
AGTTCAGCTGATCCTGTGAA+AGG | 0.598452 | 6:-46177007 | MsaT032149.1:CDS |
CGCATTGGAATGGATCTCAT+GGG | 0.600221 | 6:-46176725 | MsaT032149.1:CDS |
AGGGGAAATAAGGAAAGTAG+AGG | 0.600418 | 6:-46184668 | MsaT032149.1:CDS |
GCTTACCGATTGGACAGATG+TGG | 0.603842 | 6:-46176867 | MsaT032149.1:CDS |
CATTGAGAGAGAGGAAGCAG+GGG | 0.607234 | 6:-46185565 | MsaT032149.1:CDS |
ATTTGTTGGGAAGCTGTGAA+GGG | 0.609596 | 6:-46184295 | MsaT032149.1:CDS |
TACGTCGGAATTTGGACGAG+AGG | 0.609662 | 6:+46184520 | None:intergenic |
TCAATTCTCAGGTTTGTCAG+AGG | 0.610881 | 6:-46175982 | MsaT032149.1:CDS |
GATGGCACACTCATTATGGA+AGG | 0.610991 | 6:-46182768 | MsaT032149.1:CDS |
TCAGAAGATACAATTTGCAA+TGG | 0.611399 | 6:+46183227 | None:intergenic |
AGTTGGAGGAAGATAACTAT+CGG | 0.611721 | 6:-46184724 | MsaT032149.1:CDS |
TTCCGACGTAGTAAATACTT+GGG | 0.612048 | 6:-46184507 | MsaT032149.1:CDS |
CCCATCATGAGTTCTAGCCA+TGG | 0.612513 | 6:-46175669 | MsaT032149.1:CDS |
CAATGTGAAAATATTCGGGA+AGG | 0.612907 | 6:-46175835 | MsaT032149.1:CDS |
ATCAGCTGAACTAGTTATGG+AGG | 0.613032 | 6:+46177018 | None:intergenic |
TGACATTTCAAAGTTACTAG+AGG | 0.613288 | 6:-46183414 | MsaT032149.1:CDS |
GCAAAAGGGTCAGGAAGTCG+GGG | 0.614199 | 6:-46176985 | MsaT032149.1:CDS |
CTGGATTCCATATTAAAAGG+AGG | 0.614285 | 6:+46184071 | None:intergenic |
GGGGATGGAAAGTATGAAAG+GGG | 0.615685 | 6:-46184686 | MsaT032149.1:CDS |
CTCCCAAGTATTTACTACGT+CGG | 0.616025 | 6:+46184505 | None:intergenic |
TATCGGCCGTCATTCTCTCG+AGG | 0.618153 | 6:-46184707 | MsaT032149.1:CDS |
TGAGTCATGACTGGCATCGG+AGG | 0.619324 | 6:+46176938 | None:intergenic |
CGATTATGATGAGAAGGTGA+CGG | 0.621399 | 6:+46185500 | None:intergenic |
AAAATGTGCAACCTTGTCAG+AGG | 0.622233 | 6:+46183253 | None:intergenic |
GGAAAAGATAAGCCGAGTGA+AGG | 0.623484 | 6:-46176308 | MsaT032149.1:CDS |
CCATCCCCTCGAGAGAATGA+CGG | 0.624930 | 6:+46184701 | None:intergenic |
GCAGCAGAATTAGAGTAGCA+TGG | 0.625068 | 6:+46176239 | None:intergenic |
CAGAATTGGTGTCTGATATG+GGG | 0.626814 | 6:-46176271 | MsaT032149.1:CDS |
AAAACAAGTTGAGGTGCCTG+AGG | 0.628937 | 6:-46184123 | MsaT032149.1:CDS |
GAAGTGTCCATACCAGGGGA+AGG | 0.630456 | 6:+46182546 | None:intergenic |
ATCTTGTGACAAGAAGTTGG+AGG | 0.631228 | 6:-46184738 | MsaT032149.1:CDS |
AAGAAGCCTAGGTTAAATTG+GGG | 0.631728 | 6:-46184170 | MsaT032149.1:CDS |
CACGCCAACATTATCATCCG+TGG | 0.633659 | 6:+46176403 | None:intergenic |
CCTTGACCACAAGACAACAG+CGG | 0.635128 | 6:-46177431 | MsaT032149.1:CDS |
TCTGAATTTGGCAAACACTG+CGG | 0.635761 | 6:+46175867 | None:intergenic |
CATTTATAGATGACGACATG+CGG | 0.637601 | 6:-46175494 | MsaT032149.1:CDS |
TTAGCCGTTCAAGTGGCATG+AGG | 0.638398 | 6:-46184334 | MsaT032149.1:CDS |
GCATATCATCAACTGACTTG+CGG | 0.640200 | 6:+46184552 | None:intergenic |
GCAGTCTCTAGACGTGACGT+GGG | 0.644112 | 6:-46183107 | MsaT032149.1:CDS |
TCAGGAGGAATCTAATCCTG+TGG | 0.645106 | 6:-46176543 | MsaT032149.1:CDS |
GGTCTTCGATTATGATGAGA+AGG | 0.649185 | 6:+46185494 | None:intergenic |
GTGGCATGAGGAGCTTAGGA+GGG | 0.649607 | 6:-46184322 | MsaT032149.1:CDS |
CATGGCTAGAACTCATGATG+GGG | 0.650282 | 6:+46175670 | None:intergenic |
CTTGAACAAGATGCTTCCAA+GGG | 0.650737 | 6:+46176053 | None:intergenic |
ACATGTTGGAGCCTCTGACA+AGG | 0.651243 | 6:-46183264 | MsaT032149.1:CDS |
TATTAAAAGGAGGTGAGACA+GGG | 0.652365 | 6:+46184081 | None:intergenic |
ACAGCACCTCCACCTTCACT+CGG | 0.655201 | 6:+46176296 | None:intergenic |
AGTTGTTCCGACGAGAGCTG+CGG | 0.655335 | 6:-46176899 | MsaT032149.1:CDS |
AGTCTCGTGAAGATCCAGGT+CGG | 0.656438 | 6:+46184363 | None:intergenic |
TGATAAGAAGCTGTATCAGG+AGG | 0.660600 | 6:-46176558 | MsaT032149.1:CDS |
GCAGCATGCCTGTAAGTACA+GGG | 0.664015 | 6:+46183020 | None:intergenic |
TCGGCCGTCATTCTCTCGAG+GGG | 0.672412 | 6:-46184705 | MsaT032149.1:CDS |
TGGAGTCGTCAGATCACCGG+GGG | 0.676653 | 6:-46176693 | MsaT032149.1:CDS |
AACGTCCTCTCCATTCTCTG+TGG | 0.679828 | 6:+46184636 | None:intergenic |
GAGGTGTCTTCTCCACAACA+AGG | 0.686703 | 6:+46183201 | None:intergenic |
GATAAGCCGAGTGAAGGTGG+AGG | 0.687152 | 6:-46176302 | MsaT032149.1:CDS |
CCAGACCGATTAAACTCATG+CGG | 0.691491 | 6:+46185473 | None:intergenic |
ATGGCTAGAACTCATGATGG+GGG | 0.691683 | 6:+46175671 | None:intergenic |
GATACATTGGCTAGTATATG+CGG | 0.704512 | 6:-46177070 | MsaT032149.1:CDS |
CAGTCTCTAGACGTGACGTG+GGG | 0.705768 | 6:-46183106 | MsaT032149.1:CDS |
ATACCCGGTGAAGAGCTGCA+AGG | 0.723162 | 6:+46183960 | None:intergenic |
ACTTGAATTAGGCTTCTGGG+TGG | 0.729300 | 6:+46175794 | None:intergenic |
ACGCTCCGAATATGTCCAGG+AGG | 0.731941 | 6:-46184595 | MsaT032149.1:CDS |
TTTAGCCACAGAGAATGGAG+AGG | 0.739761 | 6:-46184641 | MsaT032149.1:CDS |
CTGGAGTCGTCAGATCACCG+GGG | 0.780258 | 6:-46176694 | MsaT032149.1:CDS |
GAGCTTCTATTCTAGCACTG+AGG | 0.786972 | 6:-46182925 | MsaT032149.1:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr6 | gene | 46175452 | 46185627 | 46175452 | ID=MsaG032149 |
Chr6 | mRNA | 46175452 | 46185627 | 46175452 | ID=MsaT032149.1;Parent=MsaG032149 |
Chr6 | exon | 46175452 | 46177745 | 46175452 | ID=MsaT032149.1.exon4;Parent=MsaT032149.1 |
Chr6 | CDS | 46175452 | 46177745 | 46175452 | ID=cds.MsaT032149.1;Parent=MsaT032149.1 |
Chr6 | exon | 46182559 | 46183692 | 46182559 | ID=MsaT032149.1.exon3;Parent=MsaT032149.1 |
Chr6 | CDS | 46182559 | 46183692 | 46182559 | ID=cds.MsaT032149.1;Parent=MsaT032149.1 |
Chr6 | exon | 46183964 | 46184821 | 46183964 | ID=MsaT032149.1.exon2;Parent=MsaT032149.1 |
Chr6 | CDS | 46183964 | 46184821 | 46183964 | ID=cds.MsaT032149.1;Parent=MsaT032149.1 |
Chr6 | exon | 46185453 | 46185627 | 46185453 | ID=MsaT032149.1.exon1;Parent=MsaT032149.1 |
Chr6 | CDS | 46185453 | 46185627 | 46185453 | ID=cds.MsaT032149.1;Parent=MsaT032149.1 |
Gene Sequence |
Protein sequence |