Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG032329 | XP_039687084.1 | 72.388 | 134 | 24 | 1 | 1 | 134 | 1 | 121 | 1.44e-58 | 187 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG032329 | tr|G7INX6|G7INX6_MEDTR | 72.388 | 134 | 24 | 1 | 1 | 134 | 1 | 121 | 6.86e-59 | 187 |
Gene ID | Type | Classification |
---|---|---|
MsaG032329 | TF | B3 |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG032329 | MtrunA17_Chr2g0281511 | 72.388 | 134 | 24 | 1 | 1 | 134 | 1 | 121 | 1.32e-62 | 187 |
MsaG032329 | MtrunA17_Chr2g0309121 | 69.403 | 134 | 27 | 2 | 1 | 134 | 1 | 120 | 4.73e-58 | 176 |
MsaG032329 | MtrunA17_Chr3g0081891 | 67.742 | 93 | 17 | 1 | 1 | 93 | 1 | 80 | 4.55e-35 | 116 |
MsaG032329 | MtrunA17_Chr7g0276661 | 36.029 | 136 | 76 | 5 | 7 | 135 | 38 | 169 | 1.77e-20 | 82.0 |
MsaG032329 | MtrunA17_Chr5g0430431 | 41.667 | 60 | 35 | 0 | 69 | 128 | 194 | 253 | 1.09e-12 | 63.2 |
MsaG032329 | MtrunA17_Chr8g0356961 | 36.275 | 102 | 50 | 3 | 24 | 123 | 77 | 165 | 1.26e-11 | 58.9 |
MsaG032329 | MtrunA17_Chr8g0372431 | 24.545 | 110 | 70 | 1 | 24 | 133 | 6 | 102 | 8.51e-11 | 55.1 |
MsaG032329 | MtrunA17_Chr7g0228081 | 30.263 | 76 | 53 | 0 | 58 | 133 | 17 | 92 | 9.04e-11 | 54.7 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Find 18 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
TAATGTTACTGCTTCTATTT+TGG | 0.123735 | 6:+49482550 | MsaT032329.1:CDS |
GAAGTCAATGATCCTGAATT+AGG | 0.214972 | 6:+49482491 | MsaT032329.1:CDS |
AAAATGTCGATGTTCATTAT+TGG | 0.262235 | 6:+49482522 | MsaT032329.1:CDS |
TACCAGTTTCTTCGTCAAAA+AGG | 0.263872 | 6:-49482739 | None:intergenic |
TGTATGCTACCGTCGTTAAC+TGG | 0.282411 | 6:+49482906 | MsaT032329.1:CDS |
GTATGACTTTGTTCTTGAAA+AGG | 0.406559 | 6:+49482829 | MsaT032329.1:CDS |
ACGGTAGCATACATCATATT+AGG | 0.417507 | 6:-49482896 | None:intergenic |
AAGTCAATGATCCTGAATTA+GGG | 0.438648 | 6:+49482492 | MsaT032329.1:CDS |
TATGACTTTGTTCTTGAAAA+GGG | 0.441122 | 6:+49482830 | MsaT032329.1:CDS |
GTATGCTACCGTCGTTAACT+GGG | 0.475193 | 6:+49482907 | MsaT032329.1:CDS |
CTTGAAAAGGGCGTAAAAGT+TGG | 0.486889 | 6:+49482842 | MsaT032329.1:CDS |
GCATGCATAAGAAGTACATA+GGG | 0.550408 | 6:+49482798 | MsaT032329.1:CDS |
AGCATGCATAAGAAGTACAT+AGG | 0.566294 | 6:+49482797 | MsaT032329.1:CDS |
AGAAGTACATAGGGAGAGGA+TGG | 0.574105 | 6:+49482807 | MsaT032329.1:CDS |
CATAAGAAGTACATAGGGAG+AGG | 0.578101 | 6:+49482803 | MsaT032329.1:CDS |
GTAGCATACATCATATTAGG+AGG | 0.617573 | 6:-49482893 | None:intergenic |
TATGCTACCGTCGTTAACTG+GGG | 0.696887 | 6:+49482908 | MsaT032329.1:CDS |
AAATTATCCCCAGTTAACGA+CGG | 0.712817 | 6:-49482915 | None:intergenic |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr6 | gene | 49482473 | 49482934 | 49482473 | ID=MsaG032329 |
Chr6 | mRNA | 49482473 | 49482934 | 49482473 | ID=MsaT032329.1;Parent=MsaG032329 |
Chr6 | exon | 49482473 | 49482640 | 49482473 | ID=MsaT032329.1.exon1;Parent=MsaT032329.1 |
Chr6 | CDS | 49482473 | 49482640 | 49482473 | ID=cds.MsaT032329.1;Parent=MsaT032329.1 |
Chr6 | exon | 49482695 | 49482934 | 49482695 | ID=MsaT032329.1.exon2;Parent=MsaT032329.1 |
Chr6 | CDS | 49482695 | 49482934 | 49482695 | ID=cds.MsaT032329.1;Parent=MsaT032329.1 |
Gene Sequence |
Protein sequence |