Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG034711 | XP_039690635.1 | 61.905 | 84 | 31 | 1 | 21 | 103 | 135 | 218 | 4.78e-25 | 109 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG034711 | tr|A0A2K3MAC5|A0A2K3MAC5_TRIPR | 57.447 | 94 | 39 | 1 | 14 | 106 | 129 | 222 | 8.41e-25 | 106 |
| Gene ID | Type | Classification |
|---|---|---|
| MsaG034711 | TF | FAR1 |
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG034711 | MtrunA17_Chr1g0203051 | 54.321 | 81 | 36 | 1 | 21 | 100 | 138 | 218 | 3.92e-23 | 92.4 |
| MsaG034711 | MtrunA17_Chr8g0389811 | 53.333 | 45 | 21 | 0 | 21 | 65 | 143 | 187 | 1.50e-11 | 58.5 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Find 19 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| ATATTCACAATCACACCTTT+TGG | 0.303082 | 6:-116698827 | MsaT034711.1:CDS |
| CCTTTGTTTGTCATAGTAGA+AGG | 0.327056 | 6:-116698981 | MsaT034711.1:CDS |
| CATTCTACGCCACGCATCTA+TGG | 0.368528 | 6:-116698722 | MsaT034711.1:CDS |
| ATAGTAGAAGGTTCTGAGGT+TGG | 0.490748 | 6:-116698969 | MsaT034711.1:CDS |
| GAGAGCAGAAGGCAACTAGT+AGG | 0.491224 | 6:-116698923 | MsaT034711.1:CDS |
| AACTAGTAGGTGTGGTTGCA+TGG | 0.492607 | 6:-116698910 | MsaT034711.1:CDS |
| CCTCATACTTCCCATCCAAA+AGG | 0.544833 | 6:+116698812 | None:intergenic |
| CGATAGGAAAAGAGAGCAGA+AGG | 0.554726 | 6:-116698934 | MsaT034711.1:CDS |
| AATGAAAATGATGAGGAAAG+TGG | 0.558325 | 6:-116698745 | MsaT034711.1:CDS |
| TGTCATAGTAGAAGGTTCTG+AGG | 0.583916 | 6:-116698973 | MsaT034711.1:CDS |
| CAGAAGGCAACTAGTAGGTG+TGG | 0.587238 | 6:-116698918 | MsaT034711.1:CDS |
| GTACACGTTGACGCTGGTAG+CGG | 0.591900 | 6:-116698876 | MsaT034711.1:CDS |
| TTGACGCTGGTAGCGGTCGA+TGG | 0.592302 | 6:-116698869 | MsaT034711.1:CDS |
| CCTTCTACTATGACAAACAA+AGG | 0.609591 | 6:+116698981 | None:intergenic |
| TTGGAAGTAATGCTGCCGAT+AGG | 0.626637 | 6:-116698950 | MsaT034711.1:CDS |
| ATCGCTCATCTTCCTATGTG+CGG | 0.630526 | 6:+116698782 | None:intergenic |
| AATACCAAATGAAAATGATG+AGG | 0.636392 | 6:-116698752 | MsaT034711.1:CDS |
| TGAGGAATGCTACCGCACAT+AGG | 0.641474 | 6:-116698794 | MsaT034711.1:CDS |
| ATTCAAGTACACGTTGACGC+TGG | 0.666323 | 6:-116698882 | MsaT034711.1:CDS |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| Chr6 | gene | 116698692 | 116699024 | 116698692 | ID=MsaG034711 |
| Chr6 | mRNA | 116698692 | 116699024 | 116698692 | ID=MsaT034711.1;Parent=MsaG034711 |
| Chr6 | exon | 116698692 | 116699024 | 116698692 | ID=MsaT034711.1.exon1;Parent=MsaT034711.1 |
| Chr6 | CDS | 116698692 | 116699024 | 116698692 | ID=cds.MsaT034711.1;Parent=MsaT034711.1 |
| Gene Sequence |
| Protein sequence |
