Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG036153 | PNX87313.1 | 77.824 | 239 | 53 | 0 | 257 | 495 | 106 | 344 | 2.13e-128 | 390 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG036153 | sp|Q9SZL8|FRS5_ARATH | 30.000 | 170 | 114 | 4 | 70 | 237 | 67 | 233 | 2.77e-15 | 82.4 |
MsaG036153 | sp|Q9SZL8|FRS5_ARATH | 25.263 | 190 | 134 | 4 | 263 | 447 | 470 | 656 | 1.95e-11 | 70.1 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG036153 | tr|A0A2K3M978|A0A2K3M978_TRIPR | 77.824 | 239 | 53 | 0 | 257 | 495 | 106 | 344 | 1.02e-128 | 390 |
Gene ID | Type | Classification |
---|---|---|
MsaG036153 | TF | FAR1 |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000033 | MsaG036153 | 0.827674 | 2.452941e-54 | 6.646633e-52 |
MsaG000063 | MsaG036153 | 0.803573 | 5.504018e-49 | 8.072855e-47 |
MsaG000431 | MsaG036153 | 0.804629 | 3.326873e-49 | 5.000402e-47 |
MsaG000609 | MsaG036153 | 0.831585 | 2.771184e-55 | 8.394753e-53 |
MsaG000683 | MsaG036153 | 0.823219 | 2.750973e-53 | 6.592774e-51 |
MsaG000717 | MsaG036153 | 0.802874 | 7.668941e-49 | 1.106788e-46 |
MsaG001531 | MsaG036153 | 0.826535 | 4.581508e-54 | 1.202531e-51 |
MsaG002069 | MsaG036153 | 0.812697 | 6.402294e-51 | 1.168164e-48 |
MsaG002926 | MsaG036153 | 0.828521 | 1.536524e-54 | 4.263943e-52 |
MsaG003180 | MsaG036153 | 0.838275 | 5.822302e-57 | 2.153635e-54 |
MsaG003468 | MsaG036153 | 0.800499 | 2.342163e-48 | 3.202615e-46 |
MsaG003555 | MsaG036153 | 0.802183 | 1.062756e-48 | 1.509706e-46 |
MsaG003648 | MsaG036153 | 0.826898 | 3.754796e-54 | 9.955739e-52 |
MsaG003768 | MsaG036153 | 0.832100 | 2.071147e-55 | 6.369310e-53 |
MsaG004006 | MsaG036153 | 0.832371 | 1.776735e-55 | 5.506537e-53 |
MsaG004014 | MsaG036153 | 0.800404 | 2.448194e-48 | 3.340539e-46 |
MsaG004047 | MsaG036153 | 0.821444 | 7.075758e-53 | 1.616788e-50 |
MsaG004373 | MsaG036153 | 0.819453 | 2.014796e-52 | 4.367896e-50 |
MsaG004424 | MsaG036153 | 0.809038 | 3.931699e-50 | 6.560262e-48 |
MsaG004556 | MsaG036153 | 0.847009 | 2.858416e-59 | 1.400154e-56 |
MsaG004798 | MsaG036153 | 0.808558 | 4.974365e-50 | 8.204444e-48 |
MsaG005107 | MsaG036153 | 0.824713 | 1.232706e-53 | 3.076529e-51 |
MsaG005113 | MsaG036153 | 0.831198 | 3.447148e-55 | 1.032439e-52 |
MsaG005189 | MsaG036153 | 0.814939 | 2.063680e-51 | 3.983148e-49 |
MsaG005210 | MsaG036153 | 0.806490 | 1.360103e-49 | 2.135344e-47 |
MsaG005329 | MsaG036153 | 0.861666 | 1.726482e-63 | 1.430199e-60 |
MsaG005423 | MsaG036153 | 0.852274 | 9.850867e-61 | 5.777653e-58 |
MsaG005452 | MsaG036153 | 0.831797 | 2.458269e-55 | 7.493609e-53 |
MsaG005510 | MsaG036153 | 0.876575 | 2.607760e-68 | 4.023302e-65 |
MsaG005660 | MsaG036153 | 0.825570 | 7.749109e-54 | 1.980093e-51 |
MsaG006025 | MsaG036153 | 0.858950 | 1.134064e-62 | 8.473054e-60 |
MsaG006020 | MsaG036153 | 0.829051 | 1.145582e-54 | 3.226587e-52 |
MsaG006262 | MsaG036153 | 0.817395 | 5.868008e-52 | 1.205855e-49 |
MsaG006452 | MsaG036153 | 0.802729 | 8.214083e-49 | 1.181517e-46 |
MsaG006529 | MsaG036153 | 0.820663 | 1.068055e-52 | 2.390525e-50 |
MsaG007040 | MsaG036153 | 0.862749 | 8.057983e-64 | 6.963824e-61 |
MsaG007353 | MsaG036153 | 0.811356 | 1.250647e-50 | 2.207679e-48 |
MsaG007570 | MsaG036153 | 0.838682 | 4.579023e-57 | 1.715339e-54 |
MsaG007614 | MsaG036153 | 0.834759 | 4.532373e-56 | 1.507329e-53 |
MsaG007877 | MsaG036153 | 0.823682 | 2.146444e-53 | 5.209302e-51 |
MsaG007880 | MsaG036153 | 0.815062 | 1.938759e-51 | 3.753651e-49 |
MsaG007722 | MsaG036153 | 0.802386 | 9.656423e-49 | 1.378190e-46 |
MsaG007828 | MsaG036153 | 0.862911 | 7.184895e-64 | 6.248941e-61 |
MsaG007834 | MsaG036153 | 0.824719 | 1.228102e-53 | 3.065606e-51 |
MsaG007914 | MsaG036153 | 0.864695 | 2.016987e-64 | 1.882571e-61 |
MsaG008198 | MsaG036153 | 0.870971 | 1.989118e-66 | 2.401845e-63 |
MsaG008218 | MsaG036153 | 0.855174 | 1.456382e-61 | 9.467713e-59 |
MsaG008356 | MsaG036153 | 0.818432 | 3.429733e-52 | 7.238899e-50 |
MsaG008434 | MsaG036153 | 0.800692 | 2.140002e-48 | 2.939098e-46 |
MsaG008634 | MsaG036153 | 0.815482 | 1.565657e-51 | 3.063543e-49 |
MsaG009389 | MsaG036153 | 0.820083 | 1.448971e-52 | 3.193881e-50 |
MsaG009409 | MsaG036153 | 0.806437 | 1.394949e-49 | 2.187436e-47 |
MsaG009657 | MsaG036153 | 0.859025 | 1.076917e-62 | 8.069105e-60 |
MsaG010050 | MsaG036153 | 0.814338 | 2.799310e-51 | 5.321927e-49 |
MsaG010066 | MsaG036153 | 0.800144 | 2.763827e-48 | 3.748976e-46 |
MsaG010104 | MsaG036153 | 0.822687 | 3.654745e-53 | 8.633627e-51 |
MsaG010394 | MsaG036153 | 0.885063 | 2.418601e-71 | 5.556729e-68 |
MsaG010902 | MsaG036153 | 0.809932 | 2.531978e-50 | 4.316749e-48 |
MsaG010942 | MsaG036153 | 0.800222 | 2.665240e-48 | 3.621597e-46 |
MsaG011080 | MsaG036153 | 0.859835 | 6.169546e-63 | 4.766701e-60 |
MsaG011774 | MsaG036153 | 0.806677 | 1.242014e-49 | 1.958583e-47 |
MsaG012263 | MsaG036153 | 0.881790 | 3.806664e-70 | 7.471993e-67 |
MsaG012489 | MsaG036153 | 0.803386 | 6.016778e-49 | 8.786917e-47 |
MsaG012568 | MsaG036153 | 0.815188 | 1.817847e-51 | 3.530870e-49 |
MsaG013644 | MsaG036153 | 0.830193 | 6.060416e-55 | 1.763646e-52 |
MsaG013845 | MsaG036153 | 0.819330 | 2.148835e-52 | 4.643511e-50 |
MsaG014727 | MsaG036153 | 0.827389 | 2.868949e-54 | 7.712265e-52 |
MsaG015018 | MsaG036153 | 0.809550 | 3.056901e-50 | 5.163994e-48 |
MsaG015705 | MsaG036153 | 0.858499 | 1.544241e-62 | 1.134509e-59 |
MsaG016471 | MsaG036153 | 0.817216 | 6.434995e-52 | 1.316329e-49 |
MsaG017059 | MsaG036153 | 0.801490 | 1.472974e-48 | 2.059679e-46 |
MsaG017068 | MsaG036153 | 0.807801 | 7.196978e-50 | 1.165632e-47 |
MsaG017286 | MsaG036153 | 0.857372 | 3.324299e-62 | 2.341832e-59 |
MsaG017324 | MsaG036153 | 0.845070 | 9.573464e-59 | 4.397257e-56 |
MsaG017546 | MsaG036153 | 0.860073 | 5.232862e-63 | 4.080021e-60 |
MsaG017620 | MsaG036153 | 0.806588 | 1.296927e-49 | 2.040904e-47 |
MsaG017719 | MsaG036153 | 0.804628 | 3.328180e-49 | 5.002283e-47 |
MsaG017778 | MsaG036153 | 0.820600 | 1.104373e-52 | 2.467698e-50 |
MsaG017873 | MsaG036153 | 0.801729 | 1.316486e-48 | 1.850917e-46 |
MsaG018040 | MsaG036153 | 0.803309 | 6.240587e-49 | 9.097361e-47 |
MsaG018202 | MsaG036153 | 0.808277 | 5.707018e-50 | 9.349503e-48 |
MsaG018257 | MsaG036153 | 0.833424 | 9.750449e-56 | 3.116724e-53 |
MsaG018447 | MsaG036153 | 0.849413 | 6.239320e-60 | 3.314950e-57 |
MsaG018438 | MsaG036153 | 0.816008 | 1.196572e-51 | 2.372866e-49 |
MsaG018489 | MsaG036153 | 0.862919 | 7.146046e-64 | 6.217077e-61 |
MsaG018638 | MsaG036153 | 0.817805 | 4.746411e-52 | 9.857255e-50 |
MsaG018749 | MsaG036153 | 0.804474 | 3.583427e-49 | 5.366682e-47 |
MsaG018770 | MsaG036153 | 0.857766 | 2.545339e-62 | 1.819552e-59 |
MsaG018777 | MsaG036153 | 0.865594 | 1.055905e-64 | 1.021415e-61 |
MsaG018786 | MsaG036153 | 0.827950 | 2.106346e-54 | 5.752046e-52 |
MsaG018793 | MsaG036153 | 0.813300 | 4.729087e-51 | 8.759186e-49 |
MsaG018913 | MsaG036153 | 0.802255 | 1.027499e-48 | 1.462002e-46 |
MsaG019108 | MsaG036153 | 0.819641 | 1.826526e-52 | 3.978964e-50 |
MsaG019193 | MsaG036153 | 0.867996 | 1.829808e-65 | 1.951461e-62 |
MsaG019267 | MsaG036153 | 0.852840 | 6.805518e-61 | 4.071341e-58 |
MsaG019356 | MsaG036153 | 0.807696 | 7.576680e-50 | 1.224023e-47 |
MsaG019452 | MsaG036153 | 0.813958 | 3.393816e-51 | 6.390942e-49 |
MsaG019526 | MsaG036153 | 0.820399 | 1.227720e-52 | 2.728886e-50 |
MsaG019564 | MsaG036153 | 0.826868 | 3.818371e-54 | 1.011581e-51 |
MsaG019628 | MsaG036153 | 0.829572 | 8.572472e-55 | 2.450753e-52 |
MsaG019809 | MsaG036153 | 0.800817 | 2.019102e-48 | 2.780776e-46 |
MsaG019911 | MsaG036153 | 0.836741 | 1.433838e-56 | 5.060504e-54 |
MsaG019913 | MsaG036153 | 0.851067 | 2.157044e-60 | 1.212874e-57 |
MsaG019935 | MsaG036153 | 0.818498 | 3.315030e-52 | 7.008685e-50 |
MsaG019985 | MsaG036153 | 0.818945 | 2.627086e-52 | 5.619658e-50 |
MsaG019977 | MsaG036153 | 0.811868 | 9.692885e-51 | 1.732648e-48 |
MsaG020078 | MsaG036153 | 0.807292 | 9.217255e-50 | 1.474742e-47 |
MsaG020233 | MsaG036153 | 0.810370 | 2.039363e-50 | 3.514296e-48 |
MsaG020288 | MsaG036153 | 0.805769 | 1.925360e-49 | 2.971675e-47 |
MsaG020334 | MsaG036153 | 0.805281 | 2.434365e-49 | 3.714706e-47 |
MsaG020371 | MsaG036153 | 0.826452 | 4.791587e-54 | 1.254901e-51 |
MsaG020415 | MsaG036153 | 0.844341 | 1.501986e-58 | 6.734509e-56 |
MsaG020420 | MsaG036153 | 0.840938 | 1.191542e-57 | 4.790516e-55 |
MsaG020467 | MsaG036153 | 0.845406 | 7.773884e-59 | 3.610179e-56 |
MsaG021200 | MsaG036153 | 0.850980 | 2.281581e-60 | 1.279057e-57 |
MsaG021488 | MsaG036153 | 0.803509 | 5.673687e-49 | 8.309424e-47 |
MsaG021668 | MsaG036153 | 0.849801 | 4.870688e-60 | 2.621832e-57 |
MsaG022100 | MsaG036153 | 0.827357 | 2.918971e-54 | 7.839631e-52 |
MsaG022345 | MsaG036153 | 0.841118 | 1.069144e-57 | 4.323107e-55 |
MsaG022515 | MsaG036153 | 0.878003 | 8.353675e-69 | 1.375017e-65 |
MsaG022533 | MsaG036153 | 0.806515 | 1.343461e-49 | 2.110492e-47 |
MsaG022547 | MsaG036153 | 0.815401 | 1.631238e-51 | 3.185510e-49 |
MsaG023275 | MsaG036153 | 0.832268 | 1.883705e-55 | 5.820640e-53 |
MsaG023343 | MsaG036153 | 0.854257 | 2.678008e-61 | 1.684969e-58 |
MsaG023642 | MsaG036153 | 0.800818 | 2.018303e-48 | 2.779700e-46 |
MsaG023938 | MsaG036153 | 0.813129 | 5.154363e-51 | 9.506416e-49 |
MsaG024010 | MsaG036153 | 0.828738 | 1.362811e-54 | 3.804591e-52 |
MsaG024037 | MsaG036153 | 0.825941 | 6.331043e-54 | 1.634675e-51 |
MsaG024114 | MsaG036153 | 0.861767 | 1.608610e-63 | 1.337855e-60 |
MsaG024119 | MsaG036153 | 0.823538 | 2.319267e-53 | 5.606489e-51 |
MsaG024304 | MsaG036153 | 0.828809 | 1.309949e-54 | 3.664442e-52 |
MsaG024382 | MsaG036153 | 0.800649 | 2.183895e-48 | 2.996422e-46 |
MsaG025289 | MsaG036153 | 0.815275 | 1.739818e-51 | 3.386691e-49 |
MsaG026022 | MsaG036153 | 0.842357 | 5.053578e-58 | 2.125714e-55 |
MsaG026515 | MsaG036153 | 0.812337 | 7.666973e-51 | 1.386449e-48 |
MsaG026738 | MsaG036153 | 0.824812 | 1.167972e-53 | 2.922985e-51 |
MsaG026849 | MsaG036153 | 0.814005 | 3.313708e-51 | 6.247348e-49 |
MsaG026830 | MsaG036153 | 0.802371 | 9.724256e-49 | 1.387414e-46 |
MsaG026985 | MsaG036153 | 0.842132 | 5.792363e-58 | 2.418786e-55 |
MsaG026987 | MsaG036153 | 0.821403 | 7.230048e-53 | 1.650261e-50 |
MsaG027291 | MsaG036153 | 0.825009 | 1.050145e-53 | 2.642316e-51 |
MsaG027364 | MsaG036153 | 0.843810 | 2.081991e-58 | 9.174865e-56 |
MsaG027776 | MsaG036153 | 0.814036 | 3.262748e-51 | 6.155899e-49 |
MsaG027750 | MsaG036153 | 0.806300 | 1.490190e-49 | 2.329160e-47 |
MsaG028026 | MsaG036153 | 0.817721 | 4.957942e-52 | 1.027385e-49 |
MsaG028109 | MsaG036153 | 0.871295 | 1.555979e-66 | 1.904958e-63 |
MsaG028163 | MsaG036153 | 0.832698 | 1.475097e-55 | 4.615456e-53 |
MsaG028334 | MsaG036153 | 0.808284 | 5.685690e-50 | 9.316240e-48 |
MsaG028442 | MsaG036153 | 0.801543 | 1.436321e-48 | 2.010890e-46 |
MsaG028979 | MsaG036153 | 0.823554 | 2.299519e-53 | 5.561127e-51 |
MsaG028911 | MsaG036153 | 0.804474 | 3.583427e-49 | 5.366682e-47 |
MsaG029017 | MsaG036153 | 0.834280 | 5.969316e-56 | 1.956900e-53 |
MsaG029188 | MsaG036153 | 0.816365 | 9.967752e-52 | 1.994764e-49 |
MsaG029204 | MsaG036153 | 0.844856 | 1.093257e-58 | 4.986126e-56 |
MsaG029349 | MsaG036153 | 0.809725 | 2.803934e-50 | 4.756613e-48 |
MsaG029413 | MsaG036153 | 0.856961 | 4.390905e-62 | 3.046385e-59 |
MsaG029473 | MsaG036153 | 0.819900 | 1.594618e-52 | 3.497800e-50 |
MsaG029802 | MsaG036153 | 0.846761 | 3.340780e-59 | 1.622955e-56 |
MsaG029889 | MsaG036153 | 0.800015 | 2.935418e-48 | 3.970316e-46 |
MsaG030045 | MsaG036153 | 0.811468 | 1.183045e-50 | 2.094092e-48 |
MsaG030198 | MsaG036153 | 0.818666 | 3.037221e-52 | 6.449593e-50 |
MsaG030546 | MsaG036153 | 0.817039 | 7.049403e-52 | 1.435420e-49 |
MsaG031043 | MsaG036153 | 0.801709 | 1.328473e-48 | 1.866912e-46 |
MsaG031129 | MsaG036153 | 0.817671 | 5.087289e-52 | 1.052832e-49 |
MsaG031364 | MsaG036153 | 0.828617 | 1.457588e-54 | 4.055547e-52 |
MsaG031427 | MsaG036153 | 0.808200 | 5.924698e-50 | 9.688163e-48 |
MsaG032115 | MsaG036153 | 0.806947 | 1.089767e-49 | 1.729420e-47 |
MsaG032272 | MsaG036153 | 0.826920 | 3.710398e-54 | 9.844166e-52 |
MsaG032221 | MsaG036153 | 0.839499 | 2.817971e-57 | 1.082888e-54 |
MsaG033301 | MsaG036153 | 0.803825 | 4.883531e-49 | 7.204568e-47 |
MsaG033593 | MsaG036153 | 0.813250 | 4.849316e-51 | 8.970913e-49 |
MsaG034337 | MsaG036153 | 0.840717 | 1.360774e-57 | 5.432900e-55 |
MsaG034977 | MsaG036153 | 0.866776 | 4.476095e-65 | 4.542667e-62 |
MsaG034946 | MsaG036153 | 0.818725 | 2.945438e-52 | 6.264224e-50 |
MsaG035511 | MsaG036153 | 0.821196 | 8.064139e-53 | 1.830666e-50 |
MsaG035682 | MsaG036153 | 0.847452 | 2.164371e-59 | 1.076096e-56 |
MsaG036153 | MsaG039489 | 0.810004 | 2.444168e-50 | 4.174327e-48 |
MsaG036153 | MsaG040385 | 0.835115 | 3.689462e-56 | 1.240082e-53 |
MsaG036153 | MsaG040425 | 0.824788 | 1.183522e-53 | 2.959901e-51 |
MsaG036153 | MsaG041116 | 0.806993 | 1.065984e-49 | 1.693497e-47 |
MsaG036153 | MsaG041271 | 0.805011 | 2.770337e-49 | 4.201160e-47 |
MsaG036153 | MsaG041336 | 0.855459 | 1.204323e-61 | 7.910719e-59 |
MsaG036153 | MsaG041800 | 0.805824 | 1.875232e-49 | 2.898082e-47 |
MsaG036153 | MsaG041819 | 0.823440 | 2.443996e-53 | 5.892247e-51 |
MsaG036153 | MsaG041949 | 0.822431 | 4.189587e-53 | 9.828908e-51 |
MsaG036153 | MsaG042054 | 0.829972 | 6.858286e-55 | 1.983275e-52 |
MsaG036153 | MsaG042103 | 0.853130 | 5.627288e-61 | 3.401276e-58 |
MsaG036153 | MsaG042126 | 0.812024 | 8.967316e-51 | 1.609072e-48 |
MsaG036153 | MsaG042579 | 0.856083 | 7.927597e-62 | 5.326807e-59 |
MsaG036153 | MsaG042717 | 0.818532 | 3.256154e-52 | 6.890455e-50 |
MsaG036153 | MsaG043788 | 0.849299 | 6.713791e-60 | 3.552770e-57 |
MsaG036153 | MsaG044278 | 0.852582 | 8.054955e-61 | 4.775476e-58 |
MsaG036153 | MsaG044453 | 0.806481 | 1.365974e-49 | 2.144169e-47 |
MsaG036153 | MsaG044584 | 0.905190 | 1.314647e-79 | 9.164652e-76 |
MsaG036153 | MsaG044889 | 0.801048 | 1.812321e-48 | 2.508915e-46 |
MsaG036153 | MsaG045021 | 0.813490 | 4.296830e-51 | 7.996803e-49 |
MsaG036153 | MsaG045046 | 0.800566 | 2.269973e-48 | 3.108695e-46 |
MsaG036153 | MsaG045238 | 0.840824 | 1.275828e-57 | 5.110983e-55 |
MsaG036153 | MsaG045371 | 0.831563 | 2.805739e-55 | 8.494008e-53 |
MsaG036153 | MsaG045548 | 0.829734 | 7.830431e-55 | 2.249012e-52 |
MsaG036153 | MsaG045549 | 0.809764 | 2.751419e-50 | 4.671944e-48 |
MsaG036153 | MsaG045767 | 0.807584 | 7.998312e-50 | 1.288649e-47 |
MsaG036153 | MsaG045769 | 0.841495 | 8.518422e-58 | 3.485769e-55 |
MsaG036153 | MsaG046051 | 0.819386 | 2.087286e-52 | 4.516994e-50 |
MsaG036153 | MsaG046488 | 0.808159 | 6.044127e-50 | 9.873688e-48 |
MsaG036153 | MsaG046498 | 0.852384 | 9.169529e-61 | 5.398940e-58 |
MsaG036153 | MsaG046507 | 0.854171 | 2.834030e-61 | 1.777561e-58 |
MsaG036153 | MsaG046589 | 0.849687 | 5.237363e-60 | 2.808612e-57 |
MsaG036153 | MsaG046695 | 0.800141 | 2.768778e-48 | 3.755369e-46 |
MsaG036153 | MsaG046816 | 0.839524 | 2.777533e-57 | 1.068134e-54 |
MsaG036153 | MsaG047011 | 0.838758 | 4.375796e-57 | 1.643161e-54 |
MsaG036153 | MsaG047091 | 0.851308 | 1.844822e-60 | 1.046027e-57 |
MsaG036153 | MsaG047092 | 0.810808 | 1.641708e-50 | 2.859401e-48 |
MsaG036153 | MsaG001564 | 0.837443 | 9.507951e-57 | 3.428202e-54 |
MsaG036153 | MsaG002242 | 0.854894 | 1.754510e-61 | 1.129151e-58 |
MsaG036153 | MsaG001950 | 0.818135 | 4.001732e-52 | 8.381663e-50 |
MsaG036153 | MsaG003734 | 0.867916 | 1.939735e-65 | 2.061970e-62 |
MsaG036153 | MsaG003742 | 0.836981 | 1.245947e-56 | 4.429301e-54 |
MsaG036153 | MsaG007590 | 0.833181 | 1.120065e-55 | 3.554869e-53 |
MsaG036153 | MsaG009512 | 0.846607 | 3.678357e-59 | 1.777590e-56 |
MsaG036153 | MsaG013712 | 0.807674 | 7.657723e-50 | 1.236439e-47 |
MsaG036153 | MsaG013252 | 0.829980 | 6.828979e-55 | 1.975210e-52 |
MsaG036153 | MsaG013873 | 0.814506 | 2.571718e-51 | 4.909729e-49 |
MsaG036153 | MsaG011676 | 0.847504 | 2.094735e-59 | 1.043253e-56 |
MsaG036153 | MsaG012091 | 0.806844 | 1.145593e-49 | 1.813584e-47 |
MsaG036153 | MsaG018864 | 0.809320 | 3.423072e-50 | 5.750120e-48 |
MsaG036153 | MsaG023445 | 0.800891 | 1.950530e-48 | 2.690750e-46 |
MsaG036153 | MsaG018678 | 0.838506 | 5.080147e-57 | 1.892673e-54 |
MsaG036153 | MsaG023179 | 0.823995 | 1.814990e-53 | 4.442113e-51 |
MsaG036153 | MsaG020399 | 0.813652 | 3.959386e-51 | 7.398837e-49 |
MsaG036153 | MsaG018912 | 0.813423 | 4.443398e-51 | 8.256026e-49 |
MsaG036153 | MsaG018378 | 0.879553 | 2.390061e-69 | 4.226337e-66 |
MsaG036153 | MsaG024084 | 0.831493 | 2.918856e-55 | 8.818185e-53 |
MsaG036153 | MsaG017935 | 0.850095 | 4.034450e-60 | 2.193351e-57 |
MsaG036153 | MsaG024179 | 0.801811 | 1.266442e-48 | 1.783909e-46 |
MsaG036153 | MsaG026285 | 0.811428 | 1.206596e-50 | 2.133668e-48 |
MsaG036153 | MsaG029390 | 0.809485 | 3.156907e-50 | 5.324694e-48 |
MsaG036153 | MsaG028903 | 0.806187 | 1.573751e-49 | 2.453164e-47 |
MsaG036153 | MsaG027575 | 0.823236 | 2.726638e-53 | 6.537492e-51 |
MsaG036153 | MsaG026407 | 0.815645 | 1.440548e-51 | 2.830597e-49 |
MsaG036153 | MsaG031280 | 0.810253 | 2.161623e-50 | 3.714255e-48 |
MsaG036153 | MsaG030007 | 0.863288 | 5.501520e-64 | 4.856034e-61 |
MsaG036153 | MsaG032092 | 0.821087 | 8.542338e-53 | 1.933595e-50 |
MsaG036153 | MsaG034262 | 0.860043 | 5.340300e-63 | 4.158931e-60 |
MsaG036153 | MsaG034730 | 0.817351 | 6.003295e-52 | 1.232234e-49 |
MsaG036153 | MsaG036873 | 0.800155 | 2.750704e-48 | 3.732037e-46 |
MsaG036153 | MsaG037384 | 0.807035 | 1.044442e-49 | 1.660923e-47 |
MsaG036153 | MsaG037161 | 0.832798 | 1.393230e-55 | 4.372156e-53 |
MsaG036153 | MsaG037484 | 0.811946 | 9.323129e-51 | 1.669780e-48 |
MsaG036153 | MsaG037726 | 0.824530 | 1.360452e-53 | 3.378579e-51 |
MsaG036153 | MsaG037051 | 0.854516 | 2.255298e-61 | 1.432085e-58 |
MsaG036153 | MsaG035294 | 0.829922 | 7.051832e-55 | 2.036315e-52 |
MsaG036153 | MsaG036984 | 0.802193 | 1.057961e-48 | 1.503230e-46 |
MsaG036153 | MsaG044531 | 0.804242 | 4.001686e-49 | 5.961218e-47 |
MsaG036153 | MsaG042234 | 0.809102 | 3.809873e-50 | 6.366824e-48 |
MsaG036153 | MsaG042291 | 0.847824 | 1.711263e-59 | 8.615847e-57 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG036153 | MtrunA17_Chr2g0308841 | 53.216 | 171 | 80 | 0 | 257 | 427 | 56 | 226 | 9.34e-64 | 208 |
MsaG036153 | MtrunA17_Chr1g0203051 | 39.524 | 210 | 122 | 2 | 28 | 237 | 34 | 238 | 1.73e-42 | 160 |
MsaG036153 | MtrunA17_Chr1g0203051 | 34.595 | 185 | 118 | 1 | 234 | 415 | 437 | 621 | 5.49e-28 | 117 |
MsaG036153 | MtrunA17_Chr1g0171741 | 36.041 | 197 | 124 | 2 | 11 | 206 | 65 | 260 | 3.30e-36 | 135 |
MsaG036153 | MtrunA17_Chr8g0389811 | 42.188 | 128 | 74 | 0 | 55 | 182 | 61 | 188 | 2.58e-32 | 122 |
MsaG036153 | MtrunA17_Chr2g0331371 | 38.608 | 158 | 95 | 1 | 27 | 182 | 2 | 159 | 5.95e-26 | 105 |
MsaG036153 | MtrunA17_Chr2g0287651 | 33.333 | 165 | 110 | 0 | 73 | 237 | 70 | 234 | 1.04e-25 | 111 |
MsaG036153 | MtrunA17_Chr2g0287651 | 35.260 | 173 | 112 | 0 | 256 | 428 | 460 | 632 | 1.33e-24 | 107 |
MsaG036153 | MtrunA17_Chr6g0473421 | 38.760 | 129 | 77 | 1 | 27 | 153 | 2 | 130 | 8.11e-24 | 97.4 |
MsaG036153 | MtrunA17_Chr5g0448761 | 30.061 | 163 | 112 | 2 | 77 | 237 | 59 | 221 | 2.85e-17 | 85.1 |
MsaG036153 | MtrunA17_Chr1g0202341 | 27.919 | 197 | 129 | 4 | 50 | 237 | 15 | 207 | 1.40e-16 | 82.8 |
MsaG036153 | MtrunA17_Chr1g0172931 | 36.634 | 101 | 64 | 0 | 60 | 160 | 58 | 158 | 3.45e-16 | 75.9 |
MsaG036153 | MtrunA17_Chr1g0198761 | 35.252 | 139 | 78 | 6 | 90 | 218 | 59 | 195 | 1.11e-14 | 77.0 |
MsaG036153 | MtrunA17_Chr2g0276841 | 31.429 | 140 | 89 | 4 | 84 | 218 | 76 | 213 | 9.31e-14 | 73.9 |
MsaG036153 | MtrunA17_Chr2g0294841 | 32.414 | 145 | 86 | 5 | 83 | 218 | 50 | 191 | 1.56e-13 | 73.2 |
MsaG036153 | MtrunA17_Chr3g0118611 | 23.889 | 180 | 132 | 3 | 276 | 453 | 350 | 526 | 1.29e-11 | 67.0 |
MsaG036153 | MtrunA17_Chr5g0431001 | 25.688 | 218 | 129 | 5 | 54 | 250 | 25 | 230 | 2.07e-11 | 66.2 |
MsaG036153 | MtrunA17_Chr6g0458391 | 23.741 | 278 | 170 | 11 | 6 | 250 | 10 | 278 | 2.67e-11 | 66.2 |
MsaG036153 | MtrunA17_Chr2g0324011 | 24.242 | 198 | 140 | 3 | 245 | 438 | 391 | 582 | 3.64e-11 | 65.5 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG036153 | AT4G38180.1 | 30.000 | 170 | 114 | 4 | 70 | 237 | 67 | 233 | 2.81e-16 | 82.4 |
MsaG036153 | AT4G38180.1 | 25.263 | 190 | 134 | 4 | 263 | 447 | 470 | 656 | 1.98e-12 | 70.1 |
MsaG036153 | AT1G10240.2 | 28.421 | 190 | 118 | 7 | 35 | 218 | 14 | 191 | 8.70e-16 | 80.9 |
MsaG036153 | AT1G10240.1 | 28.421 | 190 | 118 | 7 | 35 | 218 | 14 | 191 | 8.70e-16 | 80.9 |
MsaG036153 | AT5G28530.4 | 32.061 | 131 | 86 | 2 | 90 | 218 | 67 | 196 | 1.51e-14 | 76.6 |
MsaG036153 | AT5G28530.5 | 32.061 | 131 | 86 | 2 | 90 | 218 | 67 | 196 | 1.54e-14 | 76.6 |
MsaG036153 | AT5G28530.3 | 32.061 | 131 | 86 | 2 | 90 | 218 | 67 | 196 | 1.56e-14 | 76.6 |
MsaG036153 | AT5G28530.2 | 32.061 | 131 | 86 | 2 | 90 | 218 | 67 | 196 | 1.56e-14 | 76.6 |
MsaG036153 | AT5G28530.1 | 32.061 | 131 | 86 | 2 | 90 | 218 | 67 | 196 | 1.65e-14 | 76.6 |
MsaG036153 | AT4G38170.1 | 25.424 | 177 | 129 | 2 | 258 | 434 | 230 | 403 | 2.29e-11 | 66.6 |
Find 95 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
TGTTGGTTTGCAAAGATTAA+TGG | 0.202245 | 7:-28116753 | MsaT036153.1:CDS |
GAGTATCTAATAATGATATT+AGG | 0.223767 | 7:+28115401 | None:intergenic |
CTTACTAAGATTCACCAAAT+TGG | 0.273526 | 7:+28115087 | None:intergenic |
AGTTTCTGATTTGGCATATC+AGG | 0.280882 | 7:-28115062 | MsaT036153.1:CDS |
TGTCTTAGAATGGAATCTAT+TGG | 0.286177 | 7:-28115274 | MsaT036153.1:CDS |
GCTGATCACCAATCTCAATA+TGG | 0.303020 | 7:-28115529 | MsaT036153.1:CDS |
GGTTGCGAGACACGCCAATT+TGG | 0.319259 | 7:-28115101 | MsaT036153.1:CDS |
CTATGGCAATGCTGGAATAA+TGG | 0.328742 | 7:-28116418 | MsaT036153.1:CDS |
GTCTTAGAATGGAATCTATT+GGG | 0.342081 | 7:-28115273 | MsaT036153.1:CDS |
TGTGGGCAACATCTCATGTT+AGG | 0.342490 | 7:-28115688 | MsaT036153.1:CDS |
CCACACCTGGTTTCGTGTCT+TGG | 0.351926 | 7:+28116603 | None:intergenic |
ATCAAGATGGTTCACACTAC+TGG | 0.359918 | 7:-28115135 | MsaT036153.1:CDS |
AGTATCTAATAATGATATTA+GGG | 0.360092 | 7:+28115402 | None:intergenic |
TGTGTAATCTAGAAGGATTT+AGG | 0.362208 | 7:-28116665 | MsaT036153.1:CDS |
TAGTAAGGAAGTTTCTGATT+TGG | 0.367852 | 7:-28115071 | MsaT036153.1:CDS |
ACACTACTGGGATTCACATT+TGG | 0.373928 | 7:-28115122 | MsaT036153.1:CDS |
TGACACCGCTGGTGACGATT+TGG | 0.375975 | 7:-28116946 | MsaT036153.1:CDS |
CTTTAATAACGTGACCTTTG+CGG | 0.378527 | 7:+28116721 | None:intergenic |
TAAATGCACTTGTCTTAGAA+TGG | 0.394455 | 7:-28115284 | MsaT036153.1:CDS |
AGAGAAGCATTGCGGGTTGT+TGG | 0.401759 | 7:-28116487 | MsaT036153.1:CDS |
ATCGATAACTATGGCAATGC+TGG | 0.402549 | 7:-28116426 | MsaT036153.1:CDS |
GTGCATATTGATATAAATTC+AGG | 0.402681 | 7:-28116561 | MsaT036153.1:CDS |
AAATATCGAGACGAGGGATA+TGG | 0.410059 | 7:-28115343 | MsaT036153.1:CDS |
TGTTAATAGAGAAGCATTGC+GGG | 0.410334 | 7:-28116494 | MsaT036153.1:CDS |
AAGATTCAAATCGATAACTA+TGG | 0.410922 | 7:-28116435 | MsaT036153.1:CDS |
TGATTCAGCACAAGATACTT+AGG | 0.418044 | 7:+28115196 | None:intergenic |
CACAAAAGAAATATTCATCT+TGG | 0.422432 | 7:-28115449 | MsaT036153.1:CDS |
GCTTCTCTATTAACATATCA+TGG | 0.424924 | 7:+28116502 | None:intergenic |
TCGAGGTTTAGCCATGAAAA+TGG | 0.425862 | 7:-28114980 | MsaT036153.1:CDS |
AGTATCTTGTGCTGAATCAT+TGG | 0.438285 | 7:-28115192 | MsaT036153.1:CDS |
TCAATTAAGTAAGATTCGTC+TGG | 0.440807 | 7:+28116876 | None:intergenic |
TCAATGAGATGTTTGAGAAA+AGG | 0.443065 | 7:-28115715 | MsaT036153.1:CDS |
CAGTGTTGCAGACCAGTCTA+AGG | 0.459285 | 7:-28115501 | MsaT036153.1:CDS |
TTGATATAAATTCAGGTCGT+TGG | 0.459962 | 7:-28116554 | MsaT036153.1:CDS |
GTGGGCAACATCTCATGTTA+GGG | 0.462616 | 7:-28115687 | MsaT036153.1:CDS |
TTCATCTTTGAATGTACAAA+CGG | 0.464037 | 7:+28115616 | None:intergenic |
GCTGGTGGGTATGATAAGGT+TGG | 0.466209 | 7:-28116363 | MsaT036153.1:CDS |
TTGAATATAGACAACATTGA+TGG | 0.468403 | 7:-28117029 | MsaT036153.1:CDS |
CAATTTGGTGAATCTTAGTA+AGG | 0.472298 | 7:-28115086 | MsaT036153.1:CDS |
CTGATCACCAATCTCAATAT+GGG | 0.482888 | 7:-28115528 | MsaT036153.1:CDS |
CACGTTATTAAAGATAAGAA+TGG | 0.499881 | 7:-28116711 | MsaT036153.1:CDS |
GTCAATGTAACTCATGATGA+TGG | 0.504196 | 7:-28116999 | MsaT036153.1:CDS |
CTGGTGGGTATGATAAGGTT+GGG | 0.505137 | 7:-28116362 | MsaT036153.1:CDS |
GTCTACTCAGTTCATCAGTA+AGG | 0.506109 | 7:+28115008 | None:intergenic |
CACGAAACCAGGTGTGGTTG+TGG | 0.506910 | 7:-28116597 | MsaT036153.1:CDS |
TTTCACGCCACAACCACACC+TGG | 0.510809 | 7:+28116590 | None:intergenic |
GGTGCATTTGCAAATGCTGC+TGG | 0.519175 | 7:-28116381 | MsaT036153.1:CDS |
CCTCTCGAGCGACCTTAGAC+TGG | 0.519542 | 7:+28115489 | None:intergenic |
TGTTTGAGAAAAGGAATATG+TGG | 0.523368 | 7:-28115706 | MsaT036153.1:CDS |
TGTAGACAATATTGTGAAGA+TGG | 0.524311 | 7:-28116850 | MsaT036153.1:CDS |
GATTCAGCACAAGATACTTA+GGG | 0.524884 | 7:+28115197 | None:intergenic |
CTGCCTGCCCATATTGAGAT+TGG | 0.525441 | 7:+28115521 | None:intergenic |
GCGGGTTGTTGGCTGCTCAC+AGG | 0.526567 | 7:-28116476 | MsaT036153.1:CDS |
TCAAGATGGTTCACACTACT+GGG | 0.549463 | 7:-28115134 | MsaT036153.1:CDS |
TGTCAAGGAATAAATATCAA+AGG | 0.551099 | 7:+28115366 | None:intergenic |
ATAATGGTTACTCAAATGAT+TGG | 0.552942 | 7:-28116402 | MsaT036153.1:CDS |
AACCATCTTGATAGTTTCCA+CGG | 0.556190 | 7:+28115146 | None:intergenic |
GAAAATATTCTACACACTGG+TGG | 0.557474 | 7:+28115569 | None:intergenic |
CATTTAAATTCATCGTTGAG+TGG | 0.559914 | 7:+28115301 | None:intergenic |
TTGGCCTGGAAGAAAACAGT+TGG | 0.561624 | 7:-28115739 | MsaT036153.1:intron |
TCACCAATCTCAATATGGGC+AGG | 0.573156 | 7:-28115524 | MsaT036153.1:CDS |
GTTTGAGAAAAGGAATATGT+GGG | 0.574502 | 7:-28115705 | MsaT036153.1:CDS |
ATCCGTGGAAACTATCAAGA+TGG | 0.579257 | 7:-28115148 | MsaT036153.1:CDS |
GCATTTGCAAATGCTGCTGG+TGG | 0.585164 | 7:-28116378 | MsaT036153.1:CDS |
TCAATGTAACTCATGATGAT+GGG | 0.586905 | 7:-28116998 | MsaT036153.1:CDS |
CCAGTCTAAGGTCGCTCGAG+AGG | 0.592281 | 7:-28115489 | MsaT036153.1:CDS |
TGCTGCTGGTGGGTATGATA+AGG | 0.594589 | 7:-28116367 | MsaT036153.1:CDS |
GATCCCTTGTGAGCATATTG+TGG | 0.601137 | 7:-28115251 | MsaT036153.1:CDS |
GTGGTCCAAGACACGAAACC+AGG | 0.602270 | 7:-28116608 | MsaT036153.1:CDS |
GCAAACGACAATGACACCGC+TGG | 0.611845 | 7:-28116957 | MsaT036153.1:CDS |
CATTTGCAAATGCTGCTGGT+GGG | 0.618076 | 7:-28116377 | MsaT036153.1:CDS |
TCATTGGTCACAATTTGCAA+AGG | 0.618936 | 7:-28115176 | MsaT036153.1:CDS |
CTTGACAAAATATCGAGACG+AGG | 0.625437 | 7:-28115350 | MsaT036153.1:CDS |
TGAAGCATTTCATAGCCACA+TGG | 0.625788 | 7:-28115641 | MsaT036153.1:CDS |
ATCGAAAATATTCTACACAC+TGG | 0.626984 | 7:+28115566 | None:intergenic |
ACCGCCACAATATGCTCACA+AGG | 0.627656 | 7:+28115247 | None:intergenic |
TTCATCCAAATCGTCACCAG+CGG | 0.634435 | 7:+28116941 | None:intergenic |
ATAGACAACATTGATGGTGA+AGG | 0.635617 | 7:-28117023 | MsaT036153.1:CDS |
ATGTTAATAGAGAAGCATTG+CGG | 0.638277 | 7:-28116495 | MsaT036153.1:CDS |
AACTGAGTAGACTGAAATCG+AGG | 0.648645 | 7:-28114997 | MsaT036153.1:CDS |
AAGGATTTAGGTATGACAGA+GGG | 0.653871 | 7:-28116653 | MsaT036153.1:CDS |
AATAACGTGACCTTTGCGGA+CGG | 0.654807 | 7:+28116725 | None:intergenic |
TTGACAAAATATCGAGACGA+GGG | 0.659491 | 7:-28115349 | MsaT036153.1:CDS |
CCCTTGTGAGCATATTGTGG+CGG | 0.661298 | 7:-28115248 | MsaT036153.1:CDS |
CAATGTAACTCATGATGATG+GGG | 0.663298 | 7:-28116997 | MsaT036153.1:CDS |
TTTGCAAAGGAGTCTATCCG+TGG | 0.667803 | 7:-28115163 | MsaT036153.1:CDS |
TGGGCAACATCTCATGTTAG+GGG | 0.677310 | 7:-28115686 | MsaT036153.1:CDS |
GGGCAACATCTCATGTTAGG+GGG | 0.677920 | 7:-28115685 | MsaT036153.1:CDS |
ACATCAGAGAAACGCAAGCG+TGG | 0.681208 | 7:-28116627 | MsaT036153.1:CDS |
GAAGGATTTAGGTATGACAG+AGG | 0.687850 | 7:-28116654 | MsaT036153.1:CDS |
CCAAGACACGAAACCAGGTG+TGG | 0.688722 | 7:-28116603 | MsaT036153.1:CDS |
GAAGCATTTCATAGCCACAT+GGG | 0.694477 | 7:-28115640 | MsaT036153.1:CDS |
GGGGAATACGAACTACATCA+GGG | 0.695608 | 7:-28115666 | MsaT036153.1:CDS |
AATGTACAAACGGACCCATG+TGG | 0.708271 | 7:+28115626 | None:intergenic |
CCGCCACAATATGCTCACAA+GGG | 0.726641 | 7:+28115248 | None:intergenic |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr7 | gene | 28114973 | 28117057 | 28114973 | ID=MsaG036153 |
Chr7 | mRNA | 28114973 | 28117057 | 28114973 | ID=MsaT036153.1;Parent=MsaG036153 |
Chr7 | exon | 28114973 | 28115749 | 28114973 | ID=MsaT036153.1.exon2;Parent=MsaT036153.1 |
Chr7 | CDS | 28114973 | 28115749 | 28114973 | ID=cds.MsaT036153.1;Parent=MsaT036153.1 |
Chr7 | exon | 28116347 | 28117057 | 28116347 | ID=MsaT036153.1.exon1;Parent=MsaT036153.1 |
Chr7 | CDS | 28116347 | 28117057 | 28116347 | ID=cds.MsaT036153.1;Parent=MsaT036153.1 |
Gene Sequence |
Protein sequence |