Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG036353 | GAU32754.1 | 68.421 | 114 | 33 | 2 | 1 | 112 | 758 | 870 | 1.45e-47 | 174 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG036353 | tr|A0A2Z6MJF1|A0A2Z6MJF1_TRISU | 68.421 | 114 | 33 | 2 | 1 | 112 | 758 | 870 | 6.93e-48 | 174 |
| Gene ID | Type | Classification |
|---|---|---|
| MsaG036353 | TF | FAR1 |
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| MsaG000180 | MsaG036353 | 0.805867 | 1.836822e-49 | 2.841584e-47 |
| MsaG001279 | MsaG036353 | 0.803138 | 6.767425e-49 | 9.826670e-47 |
| MsaG004504 | MsaG036353 | 0.807127 | 9.986558e-50 | 1.591605e-47 |
| MsaG005329 | MsaG036353 | 0.803362 | 6.083255e-49 | 8.879215e-47 |
| MsaG006237 | MsaG036353 | 0.832169 | 1.991719e-55 | 6.137147e-53 |
| MsaG007122 | MsaG036353 | 0.816429 | 9.646131e-52 | 1.933485e-49 |
| MsaG008220 | MsaG036353 | 0.803118 | 6.832652e-49 | 9.916803e-47 |
| MsaG008324 | MsaG036353 | 0.806990 | 1.067286e-49 | 1.695495e-47 |
| MsaG011225 | MsaG036353 | 0.800463 | 2.381989e-48 | 3.254480e-46 |
| MsaG011314 | MsaG036353 | 0.819329 | 2.150201e-52 | 4.646324e-50 |
| MsaG012448 | MsaG036353 | 0.804218 | 4.049036e-49 | 6.028382e-47 |
| MsaG042510 | MsaG036353 | 0.811862 | 9.721500e-51 | 1.737512e-48 |
| MsaG045262 | MsaG036353 | 0.819421 | 2.049129e-52 | 4.438495e-50 |
| MsaG045392 | MsaG036353 | 0.810232 | 2.183320e-50 | 3.749642e-48 |
| MsaG045536 | MsaG036353 | 0.807766 | 7.320922e-50 | 1.184701e-47 |
| MsaG046498 | MsaG036353 | 0.801327 | 1.589583e-48 | 2.214608e-46 |
| MsaG014819 | MsaG036353 | 0.809520 | 3.102891e-50 | 5.237931e-48 |
| MsaG019592 | MsaG036353 | 0.817761 | 4.856593e-52 | 1.007445e-49 |
| MsaG032663 | MsaG036353 | 0.808231 | 5.836747e-50 | 9.551356e-48 |
| MsaG034613 | MsaG036353 | 0.820817 | 9.848180e-53 | 2.213240e-50 |
| MsaG033153 | MsaG036353 | 0.812907 | 5.760042e-51 | 1.056504e-48 |
| MsaG036665 | MsaG036353 | 0.824647 | 1.276792e-53 | 3.180878e-51 |
| MsaG037204 | MsaG036353 | 0.809208 | 3.616257e-50 | 6.058394e-48 |
| MsaG018134 | MsaG036353 | 0.823757 | 2.062660e-53 | 5.015994e-51 |
| MsaG026192 | MsaG036353 | 0.805452 | 2.242582e-49 | 3.435740e-47 |
| MsaG028416 | MsaG036353 | 0.804950 | 2.852803e-49 | 4.320064e-47 |
| MsaG028634 | MsaG036353 | 0.801897 | 1.216196e-48 | 1.716502e-46 |
| MsaG028665 | MsaG036353 | 0.816880 | 7.648274e-52 | 1.550967e-49 |
| MsaG029487 | MsaG036353 | 0.824480 | 1.397789e-53 | 3.466518e-51 |
| MsaG032064 | MsaG036353 | 0.800787 | 2.047253e-48 | 2.817738e-46 |
| MsaG034207 | MsaG036353 | 0.804086 | 4.311462e-49 | 6.399638e-47 |
| MsaG034633 | MsaG036353 | 0.822526 | 3.983907e-53 | 9.370316e-51 |
| MsaG036420 | MsaG036353 | 0.820381 | 1.239340e-52 | 2.753398e-50 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG036353 | MtrunA17_Chr7g0258861 | 45.946 | 111 | 57 | 3 | 4 | 112 | 7 | 116 | 2.18e-26 | 99.8 |
| MsaG036353 | MtrunA17_Chr2g0324011 | 43.243 | 111 | 61 | 2 | 4 | 113 | 7 | 116 | 8.40e-26 | 100 |
| MsaG036353 | MtrunA17_Chr7g0238821 | 42.718 | 103 | 57 | 2 | 11 | 112 | 1 | 102 | 3.34e-23 | 86.3 |
| MsaG036353 | MtrunA17_Chr5g0401121 | 43.810 | 105 | 55 | 2 | 6 | 107 | 55 | 158 | 3.45e-22 | 85.5 |
| MsaG036353 | MtrunA17_Chr3g0082121 | 42.056 | 107 | 58 | 2 | 4 | 107 | 40 | 145 | 1.47e-20 | 85.5 |
| MsaG036353 | MtrunA17_Chr6g0458391 | 33.333 | 105 | 69 | 1 | 4 | 107 | 222 | 326 | 1.38e-16 | 73.9 |
| MsaG036353 | MtrunA17_Chr4g0033611 | 32.407 | 108 | 71 | 2 | 7 | 113 | 76 | 182 | 1.37e-15 | 70.1 |
| MsaG036353 | MtrunA17_Chr2g0329421 | 33.333 | 102 | 66 | 2 | 7 | 107 | 27 | 127 | 3.48e-15 | 68.2 |
| MsaG036353 | MtrunA17_Chr2g0287061 | 36.036 | 111 | 55 | 3 | 7 | 115 | 29 | 125 | 2.64e-12 | 62.0 |
| MsaG036353 | MtrunA17_Chr1g0203721 | 33.673 | 98 | 64 | 1 | 9 | 105 | 65 | 162 | 2.16e-11 | 59.3 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG036353 | AT3G59470.3 | 38.835 | 103 | 59 | 3 | 7 | 107 | 70 | 170 | 1.56e-16 | 72.8 |
| MsaG036353 | AT3G59470.1 | 38.835 | 103 | 59 | 3 | 7 | 107 | 70 | 170 | 1.56e-16 | 72.8 |
| MsaG036353 | AT3G59470.2 | 38.835 | 103 | 59 | 3 | 7 | 107 | 82 | 182 | 1.84e-16 | 72.8 |
Find 11 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| TTCATGATGCTTGGAAGTTT+TGG | 0.207739 | 7:+32524373 | MsaT036353.1:CDS |
| TATGGTGGAAAAGTTGAATT+TGG | 0.232263 | 7:+32524402 | MsaT036353.1:CDS |
| ATACGTACACAAGAGCAAAA+AGG | 0.438036 | 7:+32524437 | MsaT036353.1:CDS |
| GGTACATAATGGAAGAAGAT+TGG | 0.442153 | 7:+32524319 | None:intergenic |
| TTAGTTCTAATCTCTTCTCT+TGG | 0.443145 | 7:-32524543 | None:intergenic |
| TTGATAACTTTCATGATGCT+TGG | 0.451904 | 7:+32524364 | MsaT036353.1:CDS |
| AGAGATTAGAACTAATTGTC+AGG | 0.496548 | 7:+32524551 | MsaT036353.1:CDS |
| TGGAAGAAGATTGGATGCCA+AGG | 0.547111 | 7:+32524328 | MsaT036353.1:CDS |
| ATTGTTGTGAGTGTAACATA+TGG | 0.579020 | 7:-32524638 | None:intergenic |
| ACACACAAAGATGCAAGAAG+TGG | 0.597380 | 7:-32524469 | None:intergenic |
| CACACAAAGATGCAAGAAGT+GGG | 0.629246 | 7:-32524468 | None:intergenic |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| Chr7 | gene | 32524327 | 32524674 | 32524327 | ID=MsaG036353 |
| Chr7 | mRNA | 32524327 | 32524674 | 32524327 | ID=MsaT036353.1;Parent=MsaG036353 |
| Chr7 | exon | 32524327 | 32524674 | 32524327 | ID=MsaT036353.1.exon1;Parent=MsaT036353.1 |
| Chr7 | CDS | 32524327 | 32524674 | 32524327 | ID=cds.MsaT036353.1;Parent=MsaT036353.1 |
| Gene Sequence |
| Protein sequence |