Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG036699 | XP_039683162.1 | 90.461 | 304 | 27 | 1 | 1 | 302 | 1 | 304 | 0.0 | 539 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG036699 | sp|Q6P819|CNOT9_XENTR | 54.406 | 261 | 119 | 0 | 33 | 293 | 28 | 288 | 4.41e-94 | 283 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG036699 | tr|A0A396GV60|A0A396GV60_MEDTR | 89.869 | 306 | 27 | 2 | 1 | 302 | 1 | 306 | 0.0 | 534 |
Gene ID | Type | Classification |
---|---|---|
MsaG036699 | TR | Rcd1-like |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000081 | MsaG036699 | 0.825135 | 9.812002e-54 | 2.477355e-51 |
MsaG000234 | MsaG036699 | 0.876371 | 3.065775e-68 | 4.687056e-65 |
MsaG000364 | MsaG036699 | 0.838536 | 4.991904e-57 | 1.861577e-54 |
MsaG000379 | MsaG036699 | 0.852862 | 6.706938e-61 | 4.015667e-58 |
MsaG000520 | MsaG036699 | 0.859906 | 5.870545e-63 | 4.547759e-60 |
MsaG000583 | MsaG036699 | 0.811191 | 1.357532e-50 | 2.386686e-48 |
MsaG000999 | MsaG036699 | 0.835531 | 2.899114e-56 | 9.867002e-54 |
MsaG001246 | MsaG036699 | 0.810292 | 2.119653e-50 | 3.645610e-48 |
MsaG001281 | MsaG036699 | 0.821646 | 6.356664e-53 | 1.460339e-50 |
MsaG001283 | MsaG036699 | 0.832328 | 1.820627e-55 | 5.635443e-53 |
MsaG001875 | MsaG036699 | 0.865619 | 1.036339e-64 | 1.003507e-61 |
MsaG002405 | MsaG036699 | 0.810502 | 1.910327e-50 | 3.302535e-48 |
MsaG002731 | MsaG036699 | 0.897047 | 4.655747e-76 | 2.009675e-72 |
MsaG003089 | MsaG036699 | 0.800597 | 2.237381e-48 | 3.066212e-46 |
MsaG003252 | MsaG036699 | 0.886934 | 4.815732e-72 | 1.213642e-68 |
MsaG003292 | MsaG036699 | 0.805294 | 2.419735e-49 | 3.693500e-47 |
MsaG003743 | MsaG036699 | 0.857875 | 2.363044e-62 | 1.696088e-59 |
MsaG003750 | MsaG036699 | 0.852425 | 8.924628e-61 | 5.262469e-58 |
MsaG003769 | MsaG036699 | 0.871943 | 9.519211e-67 | 1.198281e-63 |
MsaG004004 | MsaG036699 | 0.897540 | 2.894640e-76 | 1.285444e-72 |
MsaG003934 | MsaG036699 | 0.806021 | 1.705270e-49 | 2.647613e-47 |
MsaG003938 | MsaG036699 | 0.862656 | 8.605092e-64 | 7.409217e-61 |
MsaG004227 | MsaG036699 | 0.880048 | 1.596048e-69 | 2.886713e-66 |
MsaG004306 | MsaG036699 | 0.821992 | 5.292194e-53 | 1.227015e-50 |
MsaG004367 | MsaG036699 | 0.823649 | 2.185185e-53 | 5.298585e-51 |
MsaG004465 | MsaG036699 | 0.804175 | 4.133498e-49 | 6.147880e-47 |
MsaG004466 | MsaG036699 | 0.804638 | 3.312901e-49 | 4.980452e-47 |
MsaG004686 | MsaG036699 | 0.826494 | 4.685410e-54 | 1.228459e-51 |
MsaG004703 | MsaG036699 | 0.812764 | 6.191071e-51 | 1.131494e-48 |
MsaG005348 | MsaG036699 | 0.815269 | 1.744407e-51 | 3.395199e-49 |
MsaG005351 | MsaG036699 | 0.864377 | 2.531896e-64 | 2.333321e-61 |
MsaG005403 | MsaG036699 | 0.816595 | 8.856358e-52 | 1.782795e-49 |
MsaG005559 | MsaG036699 | 0.826099 | 5.809696e-54 | 1.506633e-51 |
MsaG005598 | MsaG036699 | 0.827204 | 3.175469e-54 | 8.491906e-52 |
MsaG005799 | MsaG036699 | 0.828585 | 1.483481e-54 | 4.123992e-52 |
MsaG006357 | MsaG036699 | 0.865657 | 1.008480e-64 | 9.780239e-62 |
MsaG006425 | MsaG036699 | 0.861663 | 1.729635e-63 | 1.432663e-60 |
MsaG006526 | MsaG036699 | 0.837117 | 1.150520e-56 | 4.107160e-54 |
MsaG006586 | MsaG036699 | 0.851127 | 2.074130e-60 | 1.168673e-57 |
MsaG006549 | MsaG036699 | 0.803268 | 6.362737e-49 | 9.266790e-47 |
MsaG006743 | MsaG036699 | 0.901071 | 8.971450e-78 | 4.889124e-74 |
MsaG006910 | MsaG036699 | 0.902859 | 1.468877e-78 | 8.898707e-75 |
MsaG006937 | MsaG036699 | 0.830655 | 4.677194e-55 | 1.379150e-52 |
MsaG007094 | MsaG036699 | 0.827624 | 2.521334e-54 | 6.822565e-52 |
MsaG007317 | MsaG036699 | 0.896177 | 1.070483e-75 | 4.399326e-72 |
MsaG007585 | MsaG036699 | 0.827386 | 2.872704e-54 | 7.721860e-52 |
MsaG007665 | MsaG036699 | 0.871322 | 1.525051e-66 | 1.869153e-63 |
MsaG007759 | MsaG036699 | 0.877271 | 1.500317e-68 | 2.388297e-65 |
MsaG008168 | MsaG036699 | 0.878475 | 5.719541e-69 | 9.619632e-66 |
MsaG009172 | MsaG036699 | 0.858965 | 1.122442e-62 | 8.390755e-60 |
MsaG009256 | MsaG036699 | 0.899465 | 4.427398e-77 | 2.194970e-73 |
MsaG009372 | MsaG036699 | 0.847517 | 2.077164e-59 | 1.034998e-56 |
MsaG009495 | MsaG036699 | 0.830710 | 4.536843e-55 | 1.339848e-52 |
MsaG009864 | MsaG036699 | 0.830755 | 4.422676e-55 | 1.307891e-52 |
MsaG009880 | MsaG036699 | 0.881797 | 3.783850e-70 | 7.430145e-67 |
MsaG010418 | MsaG036699 | 0.875863 | 4.577038e-68 | 6.840527e-65 |
MsaG010445 | MsaG036699 | 0.836668 | 1.496803e-56 | 5.270981e-54 |
MsaG010621 | MsaG036699 | 0.855441 | 1.218288e-61 | 7.997416e-59 |
MsaG010994 | MsaG036699 | 0.808631 | 4.798537e-50 | 7.928500e-48 |
MsaG011133 | MsaG036699 | 0.933601 | 4.094218e-95 | 2.248924e-90 |
MsaG011657 | MsaG036699 | 0.831369 | 3.130679e-55 | 9.423624e-53 |
MsaG011650 | MsaG036699 | 0.800487 | 2.355746e-48 | 3.220321e-46 |
MsaG011749 | MsaG036699 | 0.942667 | 1.437413e-101 | 1.719279e-96 |
MsaG011918 | MsaG036699 | 0.838261 | 5.873437e-57 | 2.171525e-54 |
MsaG012301 | MsaG036699 | 0.824915 | 1.104869e-53 | 2.772946e-51 |
MsaG012438 | MsaG036699 | 0.831852 | 2.382933e-55 | 7.275476e-53 |
MsaG012458 | MsaG036699 | 0.824416 | 1.446850e-53 | 3.581942e-51 |
MsaG012461 | MsaG036699 | 0.859335 | 8.703660e-63 | 6.598545e-60 |
MsaG012747 | MsaG036699 | 0.821065 | 8.644749e-53 | 1.955659e-50 |
MsaG012774 | MsaG036699 | 0.808679 | 4.686633e-50 | 7.752927e-48 |
MsaG012982 | MsaG036699 | 0.844797 | 1.133724e-58 | 5.160472e-56 |
MsaG013708 | MsaG036699 | 0.827539 | 2.641609e-54 | 7.131074e-52 |
MsaG013895 | MsaG036699 | 0.827467 | 2.748014e-54 | 7.403208e-52 |
MsaG014043 | MsaG036699 | 0.828732 | 1.367018e-54 | 3.815777e-52 |
MsaG014300 | MsaG036699 | 0.801020 | 1.835666e-48 | 2.539728e-46 |
MsaG014615 | MsaG036699 | 0.816021 | 1.188440e-51 | 2.357588e-49 |
MsaG014720 | MsaG036699 | 0.802358 | 9.788155e-49 | 1.396091e-46 |
MsaG014726 | MsaG036699 | 0.836935 | 1.279851e-56 | 4.543602e-54 |
MsaG014841 | MsaG036699 | 0.874256 | 1.607596e-67 | 2.237662e-64 |
MsaG014945 | MsaG036699 | 0.820397 | 1.228990e-52 | 2.731586e-50 |
MsaG015096 | MsaG036699 | 0.834508 | 5.237581e-56 | 1.728779e-53 |
MsaG015113 | MsaG036699 | 0.855788 | 9.663393e-62 | 6.422976e-59 |
MsaG015329 | MsaG036699 | 0.852930 | 6.413535e-61 | 3.849395e-58 |
MsaG015347 | MsaG036699 | 0.878661 | 4.920965e-69 | 8.348986e-66 |
MsaG015358 | MsaG036699 | 0.858411 | 1.639824e-62 | 1.200780e-59 |
MsaG016387 | MsaG036699 | 0.832296 | 1.853845e-55 | 5.732991e-53 |
MsaG016688 | MsaG036699 | 0.851465 | 1.667161e-60 | 9.504262e-58 |
MsaG016827 | MsaG036699 | 0.836027 | 2.174909e-56 | 7.512613e-54 |
MsaG016906 | MsaG036699 | 0.807755 | 7.360404e-50 | 1.190770e-47 |
MsaG016972 | MsaG036699 | 0.864825 | 1.836535e-64 | 1.723045e-61 |
MsaG017085 | MsaG036699 | 0.850815 | 2.537924e-60 | 1.414732e-57 |
MsaG017107 | MsaG036699 | 0.831545 | 2.835000e-55 | 8.577980e-53 |
MsaG017181 | MsaG036699 | 0.853387 | 4.753859e-61 | 2.899513e-58 |
MsaG017380 | MsaG036699 | 0.817870 | 4.590144e-52 | 9.548678e-50 |
MsaG017418 | MsaG036699 | 0.848027 | 1.506114e-59 | 7.634705e-57 |
MsaG017545 | MsaG036699 | 0.808558 | 4.974803e-50 | 8.205141e-48 |
MsaG017571 | MsaG036699 | 0.858200 | 1.894403e-62 | 1.376190e-59 |
MsaG017802 | MsaG036699 | 0.818217 | 3.835266e-52 | 8.050128e-50 |
MsaG018097 | MsaG036699 | 0.837488 | 9.259998e-57 | 3.343450e-54 |
MsaG018305 | MsaG036699 | 0.834044 | 6.837869e-56 | 2.225790e-53 |
MsaG018504 | MsaG036699 | 0.855621 | 1.080327e-61 | 7.138345e-59 |
MsaG018726 | MsaG036699 | 0.878316 | 6.497501e-69 | 1.085043e-65 |
MsaG018806 | MsaG036699 | 0.863731 | 4.015947e-64 | 3.607405e-61 |
MsaG018847 | MsaG036699 | 0.800214 | 2.674974e-48 | 3.634145e-46 |
MsaG018863 | MsaG036699 | 0.819350 | 2.127061e-52 | 4.598792e-50 |
MsaG018919 | MsaG036699 | 0.821633 | 6.402005e-53 | 1.470217e-50 |
MsaG018920 | MsaG036699 | 0.836532 | 1.620138e-56 | 5.682109e-54 |
MsaG019031 | MsaG036699 | 0.822092 | 5.018155e-53 | 1.166587e-50 |
MsaG019034 | MsaG036699 | 0.833494 | 9.370852e-56 | 3.001418e-53 |
MsaG019214 | MsaG036699 | 0.885836 | 1.245936e-71 | 2.973971e-68 |
MsaG019300 | MsaG036699 | 0.802171 | 1.068955e-48 | 1.518093e-46 |
MsaG019453 | MsaG036699 | 0.883011 | 1.374275e-70 | 2.859431e-67 |
MsaG019456 | MsaG036699 | 0.810627 | 1.795892e-50 | 3.114104e-48 |
MsaG019492 | MsaG036699 | 0.819755 | 1.720418e-52 | 3.759108e-50 |
MsaG019621 | MsaG036699 | 0.807673 | 7.661340e-50 | 1.237005e-47 |
MsaG019623 | MsaG036699 | 0.896894 | 5.390661e-76 | 2.306771e-72 |
MsaG019629 | MsaG036699 | 0.817980 | 4.335107e-52 | 9.043965e-50 |
MsaG020016 | MsaG036699 | 0.827573 | 2.592331e-54 | 7.004856e-52 |
MsaG020017 | MsaG036699 | 0.802160 | 1.074443e-48 | 1.525488e-46 |
MsaG020075 | MsaG036699 | 0.815799 | 1.331797e-51 | 2.627084e-49 |
MsaG020135 | MsaG036699 | 0.851923 | 1.237674e-60 | 7.170807e-58 |
MsaG020312 | MsaG036699 | 0.887284 | 3.549403e-72 | 9.104717e-69 |
MsaG020365 | MsaG036699 | 0.864302 | 2.672207e-64 | 2.455438e-61 |
MsaG020370 | MsaG036699 | 0.860422 | 4.108233e-63 | 3.246451e-60 |
MsaG020529 | MsaG036699 | 0.816372 | 9.931940e-52 | 1.987952e-49 |
MsaG020578 | MsaG036699 | 0.833904 | 7.406617e-56 | 2.401046e-53 |
MsaG020670 | MsaG036699 | 0.886360 | 7.926733e-72 | 1.941341e-68 |
MsaG020667 | MsaG036699 | 0.803575 | 5.500130e-49 | 8.067433e-47 |
MsaG021077 | MsaG036699 | 0.820520 | 1.151667e-52 | 2.568058e-50 |
MsaG021079 | MsaG036699 | 0.870282 | 3.339956e-66 | 3.916500e-63 |
MsaG022009 | MsaG036699 | 0.806610 | 1.283215e-49 | 2.020405e-47 |
MsaG023265 | MsaG036699 | 0.899803 | 3.169314e-77 | 1.603045e-73 |
MsaG023269 | MsaG036699 | 0.879698 | 2.123960e-69 | 3.780274e-66 |
MsaG023817 | MsaG036699 | 0.865449 | 1.172232e-64 | 1.127488e-61 |
MsaG023907 | MsaG036699 | 0.860529 | 3.814225e-63 | 3.026322e-60 |
MsaG023897 | MsaG036699 | 0.898024 | 1.811936e-76 | 8.268357e-73 |
MsaG023993 | MsaG036699 | 0.884397 | 4.266481e-71 | 9.488973e-68 |
MsaG024058 | MsaG036699 | 0.827116 | 3.331664e-54 | 8.887832e-52 |
MsaG024136 | MsaG036699 | 0.826499 | 4.670516e-54 | 1.224743e-51 |
MsaG024150 | MsaG036699 | 0.823592 | 2.252860e-53 | 5.454083e-51 |
MsaG024152 | MsaG036699 | 0.859279 | 9.048549e-63 | 6.845656e-60 |
MsaG024360 | MsaG036699 | 0.816078 | 1.154534e-51 | 2.293603e-49 |
MsaG024586 | MsaG036699 | 0.816630 | 8.696592e-52 | 1.752203e-49 |
MsaG024652 | MsaG036699 | 0.910820 | 2.964882e-82 | 2.955887e-78 |
MsaG025081 | MsaG036699 | 0.896248 | 9.999241e-76 | 4.127052e-72 |
MsaG025160 | MsaG036699 | 0.827344 | 2.940780e-54 | 7.895128e-52 |
MsaG025262 | MsaG036699 | 0.868903 | 9.352892e-66 | 1.035318e-62 |
MsaG025618 | MsaG036699 | 0.881793 | 3.797650e-70 | 7.455724e-67 |
MsaG025779 | MsaG036699 | 0.809735 | 2.791017e-50 | 4.735820e-48 |
MsaG026848 | MsaG036699 | 0.912241 | 5.971519e-83 | 6.536388e-79 |
MsaG026926 | MsaG036699 | 0.865762 | 9.350040e-65 | 9.106592e-62 |
MsaG026966 | MsaG036699 | 0.857678 | 2.702535e-62 | 1.925414e-59 |
MsaG027046 | MsaG036699 | 0.818263 | 3.743598e-52 | 7.866938e-50 |
MsaG027054 | MsaG036699 | 0.817024 | 7.104329e-52 | 1.446060e-49 |
MsaG027424 | MsaG036699 | 0.907727 | 8.858700e-81 | 7.234377e-77 |
MsaG027474 | MsaG036699 | 0.823068 | 2.982378e-53 | 7.118404e-51 |
MsaG027830 | MsaG036699 | 0.802746 | 8.147446e-49 | 1.172405e-46 |
MsaG027999 | MsaG036699 | 0.864026 | 3.255088e-64 | 2.958066e-61 |
MsaG028342 | MsaG036699 | 0.842901 | 3.628961e-58 | 1.553327e-55 |
MsaG028353 | MsaG036699 | 0.838699 | 4.532822e-57 | 1.698945e-54 |
MsaG028607 | MsaG036699 | 0.844091 | 1.751073e-58 | 7.787844e-56 |
MsaG028850 | MsaG036699 | 0.827712 | 2.401174e-54 | 6.513598e-52 |
MsaG028950 | MsaG036699 | 0.861970 | 1.394931e-63 | 1.169372e-60 |
MsaG028985 | MsaG036699 | 0.849035 | 7.940277e-60 | 4.164294e-57 |
MsaG029236 | MsaG036699 | 0.926576 | 1.033903e-90 | 3.206839e-86 |
MsaG029813 | MsaG036699 | 0.805137 | 2.608075e-49 | 3.966705e-47 |
MsaG030518 | MsaG036699 | 0.842051 | 6.082669e-58 | 2.533685e-55 |
MsaG031491 | MsaG036699 | 0.822936 | 3.201034e-53 | 7.612924e-51 |
MsaG032127 | MsaG036699 | 0.828708 | 1.385324e-54 | 3.864229e-52 |
MsaG032378 | MsaG036699 | 0.906482 | 3.359266e-80 | 2.533936e-76 |
MsaG033702 | MsaG036699 | 0.814022 | 3.284506e-51 | 6.194909e-49 |
MsaG033856 | MsaG036699 | 0.803435 | 5.877047e-49 | 8.592487e-47 |
MsaG033966 | MsaG036699 | 0.836946 | 1.271894e-56 | 4.516814e-54 |
MsaG034790 | MsaG036699 | 0.875683 | 5.273966e-68 | 7.817351e-65 |
MsaG034949 | MsaG036699 | 0.867270 | 3.118882e-65 | 3.228921e-62 |
MsaG034999 | MsaG036699 | 0.821196 | 8.064945e-53 | 1.830841e-50 |
MsaG035269 | MsaG036699 | 0.901854 | 4.079605e-78 | 2.327726e-74 |
MsaG035275 | MsaG036699 | 0.851743 | 1.391314e-60 | 8.009107e-58 |
MsaG035323 | MsaG036699 | 0.877869 | 9.304744e-69 | 1.522159e-65 |
MsaG035395 | MsaG036699 | 0.840524 | 1.527829e-57 | 6.063171e-55 |
MsaG035523 | MsaG036699 | 0.819906 | 1.589766e-52 | 3.487748e-50 |
MsaG035558 | MsaG036699 | 0.815209 | 1.798583e-51 | 3.495325e-49 |
MsaG035572 | MsaG036699 | 0.815216 | 1.792741e-51 | 3.484525e-49 |
MsaG036111 | MsaG036699 | 0.883741 | 7.436339e-71 | 1.602636e-67 |
MsaG036130 | MsaG036699 | 0.894195 | 6.934330e-75 | 2.556859e-71 |
MsaG036131 | MsaG036699 | 0.893828 | 9.765394e-75 | 3.529650e-71 |
MsaG036294 | MsaG036699 | 0.825741 | 7.061181e-54 | 1.812958e-51 |
MsaG036699 | MsaG036701 | 0.934444 | 1.126019e-95 | 6.607368e-91 |
MsaG036699 | MsaG037805 | 0.836302 | 1.852989e-56 | 6.454183e-54 |
MsaG036699 | MsaG038022 | 0.833062 | 1.199171e-55 | 3.792356e-53 |
MsaG036699 | MsaG038460 | 0.823595 | 2.249070e-53 | 5.445447e-51 |
MsaG036699 | MsaG038546 | 0.817417 | 5.799595e-52 | 1.192513e-49 |
MsaG036699 | MsaG039591 | 0.879994 | 1.668502e-69 | 3.009974e-66 |
MsaG036699 | MsaG040755 | 0.869856 | 4.596891e-66 | 5.294785e-63 |
MsaG036699 | MsaG041015 | 0.889287 | 6.079051e-73 | 1.726204e-69 |
MsaG036699 | MsaG041017 | 0.896284 | 9.668742e-76 | 3.998676e-72 |
MsaG036699 | MsaG041018 | 0.837013 | 1.222841e-56 | 4.351432e-54 |
MsaG036699 | MsaG041019 | 0.882453 | 2.192538e-70 | 4.440218e-67 |
MsaG036699 | MsaG041044 | 0.876990 | 1.876933e-68 | 2.950483e-65 |
MsaG036699 | MsaG041172 | 0.885486 | 1.683070e-71 | 3.947197e-68 |
MsaG036699 | MsaG041230 | 0.871181 | 1.696007e-66 | 2.066130e-63 |
MsaG036699 | MsaG041392 | 0.876232 | 3.420703e-68 | 5.197586e-65 |
MsaG036699 | MsaG042225 | 0.875265 | 7.319223e-68 | 1.064902e-64 |
MsaG036699 | MsaG042323 | 0.843718 | 2.202968e-58 | 9.679767e-56 |
MsaG036699 | MsaG042543 | 0.816702 | 8.382480e-52 | 1.692075e-49 |
MsaG036699 | MsaG043113 | 0.819756 | 1.719592e-52 | 3.757421e-50 |
MsaG036699 | MsaG043344 | 0.805722 | 1.969877e-49 | 3.037029e-47 |
MsaG036699 | MsaG043828 | 0.809444 | 3.219816e-50 | 5.425439e-48 |
MsaG036699 | MsaG043967 | 0.809328 | 3.409292e-50 | 5.728135e-48 |
MsaG036699 | MsaG044277 | 0.843205 | 3.014308e-58 | 1.302861e-55 |
MsaG036699 | MsaG044324 | 0.830259 | 5.839565e-55 | 1.702590e-52 |
MsaG036699 | MsaG045254 | 0.833879 | 7.515938e-56 | 2.434532e-53 |
MsaG036699 | MsaG045283 | 0.824320 | 1.523412e-53 | 3.761838e-51 |
MsaG036699 | MsaG045550 | 0.872299 | 7.255112e-67 | 9.273248e-64 |
MsaG036699 | MsaG045551 | 0.890657 | 1.781442e-73 | 5.434235e-70 |
MsaG036699 | MsaG045589 | 0.816529 | 9.160966e-52 | 1.841009e-49 |
MsaG036699 | MsaG045753 | 0.813163 | 5.065894e-51 | 9.351412e-49 |
MsaG036699 | MsaG045766 | 0.839207 | 3.353270e-57 | 1.276850e-54 |
MsaG036699 | MsaG045806 | 0.854789 | 1.881275e-61 | 1.206188e-58 |
MsaG036699 | MsaG046056 | 0.823004 | 3.086083e-53 | 7.353149e-51 |
MsaG036699 | MsaG046276 | 0.884215 | 4.975874e-71 | 1.097108e-67 |
MsaG036699 | MsaG046380 | 0.810371 | 2.038492e-50 | 3.512875e-48 |
MsaG036699 | MsaG046526 | 0.849247 | 6.938529e-60 | 3.665317e-57 |
MsaG036699 | MsaG046480 | 0.829652 | 8.197214e-55 | 2.348855e-52 |
MsaG036699 | MsaG046609 | 0.800324 | 2.541325e-48 | 3.461216e-46 |
MsaG036699 | MsaG046766 | 0.846744 | 3.376851e-59 | 1.639534e-56 |
MsaG036699 | MsaG046804 | 0.848713 | 9.749313e-60 | 5.056863e-57 |
MsaG036699 | MsaG046955 | 0.803065 | 7.004936e-49 | 1.015443e-46 |
MsaG036699 | MsaG047079 | 0.803247 | 6.426365e-49 | 9.354913e-47 |
MsaG036699 | MsaG047132 | 0.822443 | 4.161872e-53 | 9.767118e-51 |
MsaG036699 | MsaG002505 | 0.833769 | 8.004469e-56 | 2.584626e-53 |
MsaG036699 | MsaG002246 | 0.850051 | 4.147992e-60 | 2.251931e-57 |
MsaG036699 | MsaG001256 | 0.817974 | 4.349473e-52 | 9.072363e-50 |
MsaG036699 | MsaG003316 | 0.804049 | 4.389144e-49 | 6.509340e-47 |
MsaG036699 | MsaG004869 | 0.858784 | 1.270466e-62 | 9.433339e-60 |
MsaG036699 | MsaG001683 | 0.822709 | 3.612772e-53 | 8.539654e-51 |
MsaG036699 | MsaG002306 | 0.837791 | 7.748593e-57 | 2.823641e-54 |
MsaG036699 | MsaG002115 | 0.841841 | 6.908697e-58 | 2.858534e-55 |
MsaG036699 | MsaG002551 | 0.863554 | 4.553728e-64 | 4.062350e-61 |
MsaG036699 | MsaG001536 | 0.814625 | 2.420871e-51 | 4.635608e-49 |
MsaG036699 | MsaG009684 | 0.828347 | 1.691652e-54 | 4.671522e-52 |
MsaG036699 | MsaG009932 | 0.828780 | 1.331213e-54 | 3.720779e-52 |
MsaG036699 | MsaG011523 | 0.853419 | 4.655030e-61 | 2.842582e-58 |
MsaG036699 | MsaG014171 | 0.872745 | 5.155521e-67 | 6.716647e-64 |
MsaG036699 | MsaG013507 | 0.872253 | 7.510201e-67 | 9.580619e-64 |
MsaG036699 | MsaG013383 | 0.811647 | 1.081959e-50 | 1.923551e-48 |
MsaG036699 | MsaG012862 | 0.834582 | 5.016915e-56 | 1.659674e-53 |
MsaG036699 | MsaG013255 | 0.812496 | 7.080159e-51 | 1.285437e-48 |
MsaG036699 | MsaG019459 | 0.846560 | 3.789145e-59 | 1.828221e-56 |
MsaG036699 | MsaG019026 | 0.880145 | 1.475239e-69 | 2.680069e-66 |
MsaG036699 | MsaG019513 | 0.805768 | 1.926607e-49 | 2.973514e-47 |
MsaG036699 | MsaG022732 | 0.832382 | 1.764969e-55 | 5.471867e-53 |
MsaG036699 | MsaG025840 | 0.848871 | 8.818641e-60 | 4.598935e-57 |
MsaG036699 | MsaG026810 | 0.824671 | 1.260782e-53 | 3.143082e-51 |
MsaG036699 | MsaG026617 | 0.812259 | 7.971807e-51 | 1.438748e-48 |
MsaG036699 | MsaG027196 | 0.840705 | 1.370214e-57 | 5.468696e-55 |
MsaG036699 | MsaG032143 | 0.879598 | 2.304194e-69 | 4.082760e-66 |
MsaG036699 | MsaG030927 | 0.858959 | 1.127083e-62 | 8.423602e-60 |
MsaG036699 | MsaG031458 | 0.878878 | 4.129216e-69 | 7.077493e-66 |
MsaG036699 | MsaG031111 | 0.855446 | 1.214137e-61 | 7.971620e-59 |
MsaG036699 | MsaG031373 | 0.845908 | 5.691160e-59 | 2.687217e-56 |
MsaG036699 | MsaG031339 | 0.828953 | 1.209766e-54 | 3.397770e-52 |
MsaG036699 | MsaG032719 | 0.947588 | 1.575765e-105 | 2.896529e-100 |
MsaG036699 | MsaG030868 | 0.824004 | 1.806254e-53 | 4.421944e-51 |
MsaG036699 | MsaG031245 | 0.826373 | 5.003302e-54 | 1.307391e-51 |
MsaG036699 | MsaG032934 | 0.830784 | 4.352614e-55 | 1.288227e-52 |
MsaG036699 | MsaG036456 | 0.822332 | 4.415944e-53 | 1.033286e-50 |
MsaG036699 | MsaG037375 | 0.810212 | 2.204992e-50 | 3.784970e-48 |
MsaG036699 | MsaG037635 | 0.806885 | 1.122917e-49 | 1.779419e-47 |
MsaG036699 | MsaG037255 | 0.863504 | 4.719723e-64 | 4.201801e-61 |
MsaG036699 | MsaG037000 | 0.917972 | 6.981719e-86 | 1.135826e-81 |
MsaG036699 | MsaG037256 | 0.802534 | 9.006847e-49 | 1.289841e-46 |
MsaG036699 | MsaG039370 | 0.802889 | 7.613906e-49 | 1.099244e-46 |
MsaG036699 | MsaG037437 | 0.803386 | 6.015312e-49 | 8.784870e-47 |
MsaG036699 | MsaG037837 | 0.825434 | 8.343824e-54 | 2.124039e-51 |
MsaG036699 | MsaG037532 | 0.870936 | 2.042157e-66 | 2.462231e-63 |
MsaG036699 | MsaG036656 | 0.862984 | 6.825502e-64 | 5.953461e-61 |
MsaG036699 | MsaG043579 | 0.846193 | 4.764902e-59 | 2.271247e-56 |
MsaG036699 | MsaG042289 | 0.804718 | 3.188961e-49 | 4.803004e-47 |
MsaG036699 | MsaG047167 | 0.804447 | 3.629316e-49 | 5.432090e-47 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG036699 | MtrunA17_Chr7g0224601 | 89.869 | 306 | 27 | 2 | 1 | 302 | 1 | 306 | 0.0 | 534 |
MsaG036699 | MtrunA17_Chr8g0392781 | 56.418 | 335 | 111 | 2 | 1 | 300 | 11 | 345 | 1.27e-121 | 352 |
MsaG036699 | MtrunA17_Chr3g0099561 | 62.409 | 274 | 103 | 0 | 28 | 301 | 26 | 299 | 2.42e-119 | 345 |
MsaG036699 | MtrunA17_Chr1g0177151 | 66.239 | 234 | 79 | 0 | 14 | 247 | 20 | 253 | 3.65e-111 | 322 |
MsaG036699 | MtrunA17_Chr5g0444621 | 67.157 | 204 | 67 | 0 | 68 | 271 | 60 | 263 | 5.68e-89 | 266 |
MsaG036699 | MtrunA17_Chr6g0477171 | 67.005 | 197 | 65 | 0 | 49 | 245 | 45 | 241 | 1.22e-86 | 260 |
MsaG036699 | MtrunA17_Chr3g0083811 | 57.759 | 116 | 49 | 0 | 176 | 291 | 1 | 116 | 5.92e-38 | 130 |
MsaG036699 | MtrunA17_Chr3g0083821 | 67.368 | 95 | 31 | 0 | 70 | 164 | 36 | 130 | 6.48e-38 | 130 |
MsaG036699 | MtrunA17_Chr5g0444631 | 86.792 | 53 | 7 | 0 | 102 | 154 | 4 | 56 | 1.91e-26 | 99.0 |
MsaG036699 | MtrunA17_Chr6g0477181 | 71.429 | 49 | 14 | 0 | 1 | 49 | 11 | 59 | 2.12e-14 | 67.8 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG036699 | AT3G20800.1 | 57.235 | 311 | 122 | 1 | 1 | 300 | 1 | 311 | 1.55e-115 | 336 |
MsaG036699 | AT5G12980.1 | 54.074 | 270 | 124 | 0 | 22 | 291 | 29 | 298 | 1.42e-100 | 298 |
MsaG036699 | AT2G32550.2 | 33.955 | 268 | 167 | 4 | 31 | 288 | 53 | 320 | 7.15e-39 | 139 |
MsaG036699 | AT2G32550.3 | 34.921 | 252 | 138 | 4 | 54 | 288 | 39 | 281 | 8.03e-39 | 138 |
MsaG036699 | AT2G32550.1 | 37.374 | 198 | 121 | 2 | 94 | 288 | 29 | 226 | 1.37e-36 | 131 |
Find 62 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
TAGCCCAATTTGAGCATTTA+AGG | 0.127092 | 7:-41632221 | MsaT036699.1:CDS |
CGGAACTTGCACCTTTATTA+TGG | 0.186230 | 7:-41633683 | MsaT036699.1:CDS |
CAAGCCTTAAATGCTCAAAT+TGG | 0.232859 | 7:+41632217 | None:intergenic |
TAAGAGGATTGGGTTATTTC+CGG | 0.242539 | 7:-41633703 | MsaT036699.1:intron |
ATGAAGTTGCATGAAAATAT+TGG | 0.267240 | 7:-41629075 | MsaT036699.1:CDS |
CCTTTATTATGGAATTCTTA+TGG | 0.279542 | 7:-41633672 | MsaT036699.1:CDS |
AAGGAAATCTATGCCTTCTT+TGG | 0.298112 | 7:+41631517 | None:intergenic |
AATAGAGAAACTAACAGTTT+TGG | 0.311116 | 7:+41631436 | None:intergenic |
TTTGGGCTGTGGTGCTAGAT+TGG | 0.341570 | 7:+41635293 | None:intergenic |
GTTCCATGGATGCCATGCTT+TGG | 0.343484 | 7:+41635275 | None:intergenic |
TGAAGTTGCATGAAAATATT+GGG | 0.343625 | 7:-41629074 | MsaT036699.1:CDS |
TTCCATGGATGCCATGCTTT+GGG | 0.345713 | 7:+41635276 | None:intergenic |
CATAATAAAGGTGCAAGTTC+CGG | 0.352274 | 7:+41633684 | None:intergenic |
GGGCTTGCAATGCATTAAAA+AGG | 0.353362 | 7:-41630995 | MsaT036699.1:CDS |
CAATGTTCTGGAACTACTTC+AGG | 0.355418 | 7:-41632871 | MsaT036699.1:intron |
ATTCCCTCCACCTGGTACTA+AGG | 0.362304 | 7:+41629038 | None:intergenic |
CCATAAGAATTCCATAATAA+AGG | 0.371929 | 7:+41633672 | None:intergenic |
AACTCGAGTGTGCAATGTTC+TGG | 0.374857 | 7:-41632883 | MsaT036699.1:CDS |
AACTCAACAATCCTGATCTC+AGG | 0.384176 | 7:-41635240 | MsaT036699.1:CDS |
TTGGGCTGTGGTGCTAGATT+GGG | 0.395336 | 7:+41635294 | None:intergenic |
CTTGCTAGTCTTGGAGTCAT+TGG | 0.399485 | 7:-41632198 | MsaT036699.1:CDS |
CATTTAAGGCTTGCTAGTCT+TGG | 0.414086 | 7:-41632207 | MsaT036699.1:CDS |
TGCCTACGCAACATGGAAAT+CGG | 0.417567 | 7:-41631470 | MsaT036699.1:CDS |
CTAACTCGCTTGTCGTTTGA+AGG | 0.424446 | 7:+41632241 | None:intergenic |
GGATGCCATGCTTTGGGCTG+TGG | 0.432887 | 7:+41635282 | None:intergenic |
TCGCTTGTCGTTTGAAGGAA+TGG | 0.449153 | 7:+41632246 | None:intergenic |
TTCAATAACAAGGCGTTCCA+TGG | 0.458343 | 7:+41635261 | None:intergenic |
TACTATTGAAATATTTGTAC+AGG | 0.478947 | 7:-41633649 | MsaT036699.1:intron |
AAAATTATGTCAGATGATGA+TGG | 0.481246 | 7:-41631257 | MsaT036699.1:CDS |
TGCTCTTCGTGTTCTCTCCA+AGG | 0.482455 | 7:-41635212 | MsaT036699.1:intron |
AGCCCAAAGCATGGCATCCA+TGG | 0.487495 | 7:-41635278 | MsaT036699.1:CDS |
AGATTCAACAGCGGAATAGT+AGG | 0.487502 | 7:+41632921 | None:intergenic |
AAGCCTTAAATGCTCAAATT+GGG | 0.502413 | 7:+41632218 | None:intergenic |
GATGGTTTGATTTATGTTTG+TGG | 0.502440 | 7:-41631239 | MsaT036699.1:CDS |
TGAAAATATTGGGGTGAACC+AGG | 0.503360 | 7:-41629064 | MsaT036699.1:CDS |
AAGATGAAACAACTTGGAGC+TGG | 0.506447 | 7:-41629101 | MsaT036699.1:CDS |
TCACAGGTTAACACCAAAGA+AGG | 0.528410 | 7:-41631530 | MsaT036699.1:intron |
TCTTGGAGTCATTGGTGCAT+TGG | 0.530074 | 7:-41632190 | MsaT036699.1:CDS |
CACCTGGTACTAAGGGAACC+TGG | 0.533033 | 7:+41629046 | None:intergenic |
TCCACTATGCCTACGCAACA+TGG | 0.551315 | 7:-41631477 | MsaT036699.1:CDS |
TTCAGGAAGATGAAACAACT+TGG | 0.555820 | 7:-41629107 | MsaT036699.1:intron |
AACCAGGTTCCCTTAGTACC+AGG | 0.560044 | 7:-41629048 | MsaT036699.1:CDS |
ACTCAACAATCCTGATCTCA+GGG | 0.561365 | 7:-41635239 | MsaT036699.1:CDS |
TCCATGTTGCGTAGGCATAG+TGG | 0.563175 | 7:+41631476 | None:intergenic |
GATTGGGATGAAGCAGTTCG+AGG | 0.563459 | 7:+41635310 | None:intergenic |
TCCGCTGTTGAATCTTACTC+AGG | 0.564161 | 7:-41632913 | MsaT036699.1:CDS |
GTTCCCTTAGTACCAGGTGG+AGG | 0.568228 | 7:-41629042 | MsaT036699.1:CDS |
TGCCGATTTCCATGTTGCGT+AGG | 0.569945 | 7:+41631468 | None:intergenic |
TTCCCTCCACCTGGTACTAA+GGG | 0.571710 | 7:+41629039 | None:intergenic |
AGATGAAACAACTTGGAGCT+GGG | 0.578633 | 7:-41629100 | MsaT036699.1:CDS |
TTCCCTTAGTACCAGGTGGA+GGG | 0.586677 | 7:-41629041 | MsaT036699.1:CDS |
GAATTATCTCACTTCTCAGA+AGG | 0.602747 | 7:+41631498 | None:intergenic |
AGTCATTGGTGCATTGGTGA+AGG | 0.613240 | 7:-41632184 | MsaT036699.1:intron |
TATCATTGATTCCCTCCACC+TGG | 0.621495 | 7:+41629030 | None:intergenic |
TAGCACCACAGCCCAAAGCA+TGG | 0.626075 | 7:-41635287 | MsaT036699.1:CDS |
AGTTTGATCAATTGATGTGA+AGG | 0.628164 | 7:+41631149 | None:intergenic |
AACATGGTATTGGAAAGTGT+TGG | 0.637520 | 7:-41631179 | MsaT036699.1:CDS |
GATTGTTGAGTTCAATAACA+AGG | 0.670356 | 7:+41635251 | None:intergenic |
GAAGTTGCATGAAAATATTG+GGG | 0.686036 | 7:-41629073 | MsaT036699.1:CDS |
CAGGTTCCCTTAGTACCAGG+TGG | 0.694292 | 7:-41629045 | MsaT036699.1:CDS |
TGAGACAAAAGAGAATAACA+TGG | 0.703854 | 7:+41631119 | None:intergenic |
GCCTGAGTAAGATTCAACAG+CGG | 0.773865 | 7:+41632912 | None:intergenic |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr7 | gene | 41629032 | 41635359 | 41629032 | ID=MsaG036699 |
Chr7 | mRNA | 41629032 | 41635359 | 41629032 | ID=MsaT036699.1;Parent=MsaG036699 |
Chr7 | exon | 41629032 | 41629124 | 41629032 | ID=MsaT036699.1.exon9;Parent=MsaT036699.1 |
Chr7 | CDS | 41629032 | 41629124 | 41629032 | ID=cds.MsaT036699.1;Parent=MsaT036699.1 |
Chr7 | exon | 41630947 | 41631016 | 41630947 | ID=MsaT036699.1.exon8;Parent=MsaT036699.1 |
Chr7 | CDS | 41630947 | 41631016 | 41630947 | ID=cds.MsaT036699.1;Parent=MsaT036699.1 |
Chr7 | exon | 41631110 | 41631300 | 41631110 | ID=MsaT036699.1.exon7;Parent=MsaT036699.1 |
Chr7 | CDS | 41631110 | 41631300 | 41631110 | ID=cds.MsaT036699.1;Parent=MsaT036699.1 |
Chr7 | exon | 41631451 | 41631546 | 41631451 | ID=MsaT036699.1.exon6;Parent=MsaT036699.1 |
Chr7 | CDS | 41631451 | 41631546 | 41631451 | ID=cds.MsaT036699.1;Parent=MsaT036699.1 |
Chr7 | exon | 41632185 | 41632291 | 41632185 | ID=MsaT036699.1.exon5;Parent=MsaT036699.1 |
Chr7 | CDS | 41632185 | 41632291 | 41632185 | ID=cds.MsaT036699.1;Parent=MsaT036699.1 |
Chr7 | exon | 41632639 | 41632681 | 41632639 | ID=MsaT036699.1.exon4;Parent=MsaT036699.1 |
Chr7 | CDS | 41632639 | 41632681 | 41632639 | ID=cds.MsaT036699.1;Parent=MsaT036699.1 |
Chr7 | exon | 41632872 | 41632961 | 41632872 | ID=MsaT036699.1.exon3;Parent=MsaT036699.1 |
Chr7 | CDS | 41632872 | 41632961 | 41632872 | ID=cds.MsaT036699.1;Parent=MsaT036699.1 |
Chr7 | exon | 41633650 | 41633721 | 41633650 | ID=MsaT036699.1.exon2;Parent=MsaT036699.1 |
Chr7 | CDS | 41633650 | 41633721 | 41633650 | ID=cds.MsaT036699.1;Parent=MsaT036699.1 |
Chr7 | exon | 41635213 | 41635359 | 41635213 | ID=MsaT036699.1.exon1;Parent=MsaT036699.1 |
Chr7 | CDS | 41635213 | 41635359 | 41635213 | ID=cds.MsaT036699.1;Parent=MsaT036699.1 |
Gene Sequence |
Protein sequence |