Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG038137 | XP_003613438.2 | 72.727 | 44 | 12 | 0 | 5 | 48 | 137 | 180 | 1.67e-11 | 73.6 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG038137 | tr|G7K6W4|G7K6W4_MEDTR | 72.727 | 44 | 12 | 0 | 5 | 48 | 137 | 180 | 7.98e-12 | 73.6 |
| Gene ID | Type | Classification |
|---|---|---|
| MsaG038137 | TR | Others |
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| MsaG000048 | MsaG038137 | 0.801632 | 1.377319e-48 | 1.932214e-46 |
| MsaG000202 | MsaG038137 | 0.824640 | 1.281627e-53 | 3.192335e-51 |
| MsaG000621 | MsaG038137 | 0.838840 | 4.168301e-57 | 1.569348e-54 |
| MsaG000705 | MsaG038137 | 0.843225 | 2.978048e-58 | 1.287975e-55 |
| MsaG000792 | MsaG038137 | 0.820130 | 1.414025e-52 | 3.120747e-50 |
| MsaG001147 | MsaG038137 | 0.833503 | 9.322732e-56 | 2.986840e-53 |
| MsaG001373 | MsaG038137 | 0.829132 | 1.094816e-54 | 3.090615e-52 |
| MsaG001490 | MsaG038137 | 0.838880 | 4.071967e-57 | 1.534934e-54 |
| MsaG002114 | MsaG038137 | 0.831399 | 3.078140e-55 | 9.274070e-53 |
| MsaG002636 | MsaG038137 | 0.822325 | 4.432625e-53 | 1.036986e-50 |
| MsaG003576 | MsaG038137 | 0.802853 | 7.745045e-49 | 1.117220e-46 |
| MsaG003635 | MsaG038137 | 0.833776 | 7.971128e-56 | 2.574374e-53 |
| MsaG003939 | MsaG038137 | 0.813020 | 5.442991e-51 | 1.001190e-48 |
| MsaG004086 | MsaG038137 | 0.802061 | 1.125704e-48 | 1.594697e-46 |
| MsaG004091 | MsaG038137 | 0.807113 | 1.005468e-49 | 1.601915e-47 |
| MsaG004165 | MsaG038137 | 0.836925 | 1.287987e-56 | 4.570979e-54 |
| MsaG004339 | MsaG038137 | 0.815257 | 1.755779e-51 | 3.416258e-49 |
| MsaG004348 | MsaG038137 | 0.836866 | 1.333233e-56 | 4.723200e-54 |
| MsaG004402 | MsaG038137 | 0.815582 | 1.487839e-51 | 2.918782e-49 |
| MsaG004404 | MsaG038137 | 0.805601 | 2.087952e-49 | 3.209939e-47 |
| MsaG004455 | MsaG038137 | 0.807546 | 8.150419e-50 | 1.311952e-47 |
| MsaG005338 | MsaG038137 | 0.803878 | 4.760834e-49 | 7.032245e-47 |
| MsaG005631 | MsaG038137 | 0.805890 | 1.816562e-49 | 2.811780e-47 |
| MsaG005768 | MsaG038137 | 0.828116 | 1.922650e-54 | 5.274907e-52 |
| MsaG005773 | MsaG038137 | 0.803152 | 6.723067e-49 | 9.765333e-47 |
| MsaG006186 | MsaG038137 | 0.821396 | 7.255083e-53 | 1.655699e-50 |
| MsaG006191 | MsaG038137 | 0.865606 | 1.046803e-64 | 1.013088e-61 |
| MsaG006476 | MsaG038137 | 0.815275 | 1.739842e-51 | 3.386734e-49 |
| MsaG006589 | MsaG038137 | 0.802152 | 1.078690e-48 | 1.531231e-46 |
| MsaG007212 | MsaG038137 | 0.809976 | 2.478012e-50 | 4.229228e-48 |
| MsaG007862 | MsaG038137 | 0.813686 | 3.893146e-51 | 7.281234e-49 |
| MsaG007970 | MsaG038137 | 0.822361 | 4.349739e-53 | 1.018572e-50 |
| MsaG008367 | MsaG038137 | 0.802306 | 1.002773e-48 | 1.428572e-46 |
| MsaG008409 | MsaG038137 | 0.812112 | 8.580807e-51 | 1.543031e-48 |
| MsaG008410 | MsaG038137 | 0.819024 | 2.521237e-52 | 5.404325e-50 |
| MsaG008994 | MsaG038137 | 0.807855 | 7.010387e-50 | 1.136899e-47 |
| MsaG009270 | MsaG038137 | 0.806672 | 1.245042e-49 | 1.963143e-47 |
| MsaG009871 | MsaG038137 | 0.805771 | 1.923872e-49 | 2.969511e-47 |
| MsaG010603 | MsaG038137 | 0.849570 | 5.644800e-60 | 3.015192e-57 |
| MsaG010753 | MsaG038137 | 0.836381 | 1.768960e-56 | 6.176426e-54 |
| MsaG010792 | MsaG038137 | 0.804804 | 3.060038e-49 | 4.618161e-47 |
| MsaG011119 | MsaG038137 | 0.827066 | 3.425744e-54 | 9.125617e-52 |
| MsaG011218 | MsaG038137 | 0.847061 | 2.767053e-59 | 1.357790e-56 |
| MsaG011238 | MsaG038137 | 0.819669 | 1.800078e-52 | 3.924245e-50 |
| MsaG011469 | MsaG038137 | 0.806469 | 1.373752e-49 | 2.155794e-47 |
| MsaG012048 | MsaG038137 | 0.813523 | 4.226728e-51 | 7.873084e-49 |
| MsaG012078 | MsaG038137 | 0.825060 | 1.021493e-53 | 2.573889e-51 |
| MsaG012161 | MsaG038137 | 0.807193 | 9.673259e-50 | 1.544063e-47 |
| MsaG012396 | MsaG038137 | 0.804084 | 4.314885e-49 | 6.404503e-47 |
| MsaG012488 | MsaG038137 | 0.801003 | 1.850281e-48 | 2.558947e-46 |
| MsaG041935 | MsaG038137 | 0.805328 | 2.379648e-49 | 3.635300e-47 |
| MsaG041955 | MsaG038137 | 0.816039 | 1.177444e-51 | 2.336822e-49 |
| MsaG042634 | MsaG038137 | 0.817365 | 5.957257e-52 | 1.223267e-49 |
| MsaG042790 | MsaG038137 | 0.822325 | 4.432333e-53 | 1.036922e-50 |
| MsaG042796 | MsaG038137 | 0.812506 | 7.043460e-51 | 1.279113e-48 |
| MsaG043183 | MsaG038137 | 0.820500 | 1.164087e-52 | 2.594359e-50 |
| MsaG044267 | MsaG038137 | 0.818056 | 4.168837e-52 | 8.713906e-50 |
| MsaG044325 | MsaG038137 | 0.828157 | 1.879720e-54 | 5.162956e-52 |
| MsaG044575 | MsaG038137 | 0.848200 | 1.349737e-59 | 6.881127e-57 |
| MsaG045044 | MsaG038137 | 0.820442 | 1.199714e-52 | 2.669780e-50 |
| MsaG045143 | MsaG038137 | 0.840390 | 1.654886e-57 | 6.540205e-55 |
| MsaG045187 | MsaG038137 | 0.800042 | 2.899360e-48 | 3.923778e-46 |
| MsaG045542 | MsaG038137 | 0.812606 | 6.699711e-51 | 1.219687e-48 |
| MsaG045796 | MsaG038137 | 0.809747 | 2.774394e-50 | 4.709020e-48 |
| MsaG046098 | MsaG038137 | 0.824839 | 1.151410e-53 | 2.883646e-51 |
| MsaG046755 | MsaG038137 | 0.819750 | 1.724902e-52 | 3.768452e-50 |
| MsaG046860 | MsaG038137 | 0.838716 | 4.485721e-57 | 1.682231e-54 |
| MsaG046805 | MsaG038137 | 0.805219 | 2.507591e-49 | 3.821080e-47 |
| MsaG046866 | MsaG038137 | 0.812156 | 8.394144e-51 | 1.511083e-48 |
| MsaG046973 | MsaG038137 | 0.816345 | 1.006821e-51 | 2.013862e-49 |
| MsaG047001 | MsaG038137 | 0.804800 | 3.065663e-49 | 4.626189e-47 |
| MsaG007676 | MsaG038137 | 0.801787 | 1.280668e-48 | 1.802924e-46 |
| MsaG008384 | MsaG038137 | 0.825221 | 9.360946e-54 | 2.369134e-51 |
| MsaG010542 | MsaG038137 | 0.834457 | 5.391845e-56 | 1.777034e-53 |
| MsaG007270 | MsaG038137 | 0.811083 | 1.432737e-50 | 2.512245e-48 |
| MsaG008699 | MsaG038137 | 0.807566 | 8.069234e-50 | 1.299511e-47 |
| MsaG008985 | MsaG038137 | 0.806717 | 1.218640e-49 | 1.923499e-47 |
| MsaG013164 | MsaG038137 | 0.828037 | 2.008297e-54 | 5.497640e-52 |
| MsaG013395 | MsaG038137 | 0.809455 | 3.202784e-50 | 5.398196e-48 |
| MsaG011693 | MsaG038137 | 0.808150 | 6.069794e-50 | 9.913570e-48 |
| MsaG011544 | MsaG038137 | 0.800708 | 2.124326e-48 | 2.918617e-46 |
| MsaG015535 | MsaG038137 | 0.830884 | 4.114395e-55 | 1.221245e-52 |
| MsaG018733 | MsaG038137 | 0.801319 | 1.595442e-48 | 2.222367e-46 |
| MsaG020996 | MsaG038137 | 0.805722 | 1.969422e-49 | 3.036374e-47 |
| MsaG019406 | MsaG038137 | 0.812632 | 6.613803e-51 | 1.204791e-48 |
| MsaG028057 | MsaG038137 | 0.812694 | 6.412447e-51 | 1.169923e-48 |
| MsaG026524 | MsaG038137 | 0.806263 | 1.517421e-49 | 2.369668e-47 |
| MsaG024981 | MsaG038137 | 0.803367 | 6.070757e-49 | 8.861773e-47 |
| MsaG031529 | MsaG038137 | 0.815059 | 1.942018e-51 | 3.759579e-49 |
| MsaG031416 | MsaG038137 | 0.831343 | 3.176473e-55 | 9.554207e-53 |
| MsaG033013 | MsaG038137 | 0.806901 | 1.114471e-49 | 1.766702e-47 |
| MsaG030574 | MsaG038137 | 0.816910 | 7.531852e-52 | 1.528563e-49 |
| MsaG030876 | MsaG038137 | 0.819373 | 2.100757e-52 | 4.544714e-50 |
| MsaG037651 | MsaG038137 | 0.811282 | 1.297720e-50 | 2.286626e-48 |
| MsaG037437 | MsaG038137 | 0.806001 | 1.721976e-49 | 2.672230e-47 |
| MsaG038137 | MsaG036052 | 0.847047 | 2.792648e-59 | 1.369672e-56 |
| MsaG012887 | MsaG038137 | 0.827493 | 2.709724e-54 | 7.305279e-52 |
| MsaG013968 | MsaG038137 | 0.843810 | 2.081189e-58 | 9.171486e-56 |
| MsaG014471 | MsaG038137 | 0.800457 | 2.389318e-48 | 3.264029e-46 |
| MsaG016179 | MsaG038137 | 0.804515 | 3.513648e-49 | 5.267253e-47 |
| MsaG016261 | MsaG038137 | 0.826318 | 5.155660e-54 | 1.345110e-51 |
| MsaG016472 | MsaG038137 | 0.808169 | 6.015988e-50 | 9.830142e-48 |
| MsaG016531 | MsaG038137 | 0.815676 | 1.417566e-51 | 2.787637e-49 |
| MsaG017061 | MsaG038137 | 0.809282 | 3.487101e-50 | 5.852424e-48 |
| MsaG017243 | MsaG038137 | 0.838638 | 4.699911e-57 | 1.758244e-54 |
| MsaG017461 | MsaG038137 | 0.849929 | 4.487351e-60 | 2.426136e-57 |
| MsaG017568 | MsaG038137 | 0.808643 | 4.770916e-50 | 7.885139e-48 |
| MsaG017587 | MsaG038137 | 0.815505 | 1.547372e-51 | 3.029597e-49 |
| MsaG017725 | MsaG038137 | 0.811152 | 1.384357e-50 | 2.431493e-48 |
| MsaG017919 | MsaG038137 | 0.820273 | 1.311151e-52 | 2.904755e-50 |
| MsaG017992 | MsaG038137 | 0.830545 | 4.974917e-55 | 1.462320e-52 |
| MsaG018385 | MsaG038137 | 0.808774 | 4.475381e-50 | 7.420093e-48 |
| MsaG018439 | MsaG038137 | 0.825903 | 6.466129e-54 | 1.667747e-51 |
| MsaG019209 | MsaG038137 | 0.823788 | 2.028251e-53 | 4.936528e-51 |
| MsaG019211 | MsaG038137 | 0.833462 | 9.540270e-56 | 3.052897e-53 |
| MsaG019557 | MsaG038137 | 0.813706 | 3.852821e-51 | 7.209588e-49 |
| MsaG019641 | MsaG038137 | 0.802845 | 7.775163e-49 | 1.121347e-46 |
| MsaG019669 | MsaG038137 | 0.813674 | 3.916107e-51 | 7.322115e-49 |
| MsaG020860 | MsaG038137 | 0.825693 | 7.247753e-54 | 1.858394e-51 |
| MsaG021054 | MsaG038137 | 0.820199 | 1.363324e-52 | 3.014447e-50 |
| MsaG021109 | MsaG038137 | 0.830192 | 6.065148e-55 | 1.764949e-52 |
| MsaG022226 | MsaG038137 | 0.851794 | 1.346064e-60 | 7.762775e-58 |
| MsaG022540 | MsaG038137 | 0.809212 | 3.609701e-50 | 6.047964e-48 |
| MsaG022550 | MsaG038137 | 0.800475 | 2.368563e-48 | 3.236994e-46 |
| MsaG023110 | MsaG038137 | 0.803323 | 6.198471e-49 | 9.039028e-47 |
| MsaG023554 | MsaG038137 | 0.828365 | 1.674920e-54 | 4.627718e-52 |
| MsaG023970 | MsaG038137 | 0.822859 | 3.334639e-53 | 7.914431e-51 |
| MsaG023979 | MsaG038137 | 0.816510 | 9.249295e-52 | 1.857863e-49 |
| MsaG024205 | MsaG038137 | 0.809001 | 4.002628e-50 | 6.672760e-48 |
| MsaG024405 | MsaG038137 | 0.831854 | 2.380260e-55 | 7.267750e-53 |
| MsaG024425 | MsaG038137 | 0.803777 | 4.996121e-49 | 7.362564e-47 |
| MsaG024459 | MsaG038137 | 0.808342 | 5.528284e-50 | 9.070677e-48 |
| MsaG026553 | MsaG038137 | 0.818362 | 3.557559e-52 | 7.495076e-50 |
| MsaG027021 | MsaG038137 | 0.810308 | 2.103434e-50 | 3.619129e-48 |
| MsaG027041 | MsaG038137 | 0.806643 | 1.262749e-49 | 1.989695e-47 |
| MsaG027155 | MsaG038137 | 0.803120 | 6.823088e-49 | 9.903572e-47 |
| MsaG027679 | MsaG038137 | 0.821033 | 8.789584e-53 | 1.986789e-50 |
| MsaG028232 | MsaG038137 | 0.804653 | 3.289146e-49 | 4.946484e-47 |
| MsaG028511 | MsaG038137 | 0.800942 | 1.904236e-48 | 2.629940e-46 |
| MsaG028632 | MsaG038137 | 0.822749 | 3.536758e-53 | 8.369052e-51 |
| MsaG028906 | MsaG038137 | 0.814739 | 2.284774e-51 | 4.387645e-49 |
| MsaG029064 | MsaG038137 | 0.817608 | 5.256888e-52 | 1.086182e-49 |
| MsaG029214 | MsaG038137 | 0.838969 | 3.861774e-57 | 1.459741e-54 |
| MsaG029295 | MsaG038137 | 0.828569 | 1.496334e-54 | 4.157824e-52 |
| MsaG029315 | MsaG038137 | 0.843488 | 2.534910e-58 | 1.105699e-55 |
| MsaG029621 | MsaG038137 | 0.838124 | 6.368233e-57 | 2.344551e-54 |
| MsaG029944 | MsaG038137 | 0.813417 | 4.458695e-51 | 8.283002e-49 |
| MsaG030201 | MsaG038137 | 0.805356 | 2.347896e-49 | 3.589135e-47 |
| MsaG030619 | MsaG038137 | 0.829087 | 1.122690e-54 | 3.165321e-52 |
| MsaG031093 | MsaG038137 | 0.833486 | 9.413955e-56 | 3.014503e-53 |
| MsaG031216 | MsaG038137 | 0.800514 | 2.326004e-48 | 3.181603e-46 |
| MsaG031475 | MsaG038137 | 0.832396 | 1.751093e-55 | 5.430984e-53 |
| MsaG031706 | MsaG038137 | 0.823723 | 2.100374e-53 | 5.103026e-51 |
| MsaG032227 | MsaG038137 | 0.811417 | 1.213216e-50 | 2.144825e-48 |
| MsaG032492 | MsaG038137 | 0.813275 | 4.789065e-51 | 8.864900e-49 |
| MsaG032554 | MsaG038137 | 0.802994 | 7.244688e-49 | 1.048484e-46 |
| MsaG033289 | MsaG038137 | 0.809617 | 2.957280e-50 | 5.003782e-48 |
| MsaG033936 | MsaG038137 | 0.810131 | 2.294947e-50 | 3.931601e-48 |
| MsaG033931 | MsaG038137 | 0.818361 | 3.558209e-52 | 7.496392e-50 |
| MsaG033932 | MsaG038137 | 0.844740 | 1.173992e-58 | 5.333728e-56 |
| MsaG033933 | MsaG038137 | 0.860290 | 4.503775e-63 | 3.541376e-60 |
| MsaG034370 | MsaG038137 | 0.802729 | 8.211403e-49 | 1.181157e-46 |
| MsaG034510 | MsaG038137 | 0.811129 | 1.400346e-50 | 2.458164e-48 |
| MsaG034689 | MsaG038137 | 0.802530 | 9.021778e-49 | 1.291866e-46 |
| MsaG035157 | MsaG038137 | 0.847383 | 2.260232e-59 | 1.121136e-56 |
| MsaG035271 | MsaG038137 | 0.813780 | 3.712799e-51 | 6.960593e-49 |
| MsaG036138 | MsaG038137 | 0.805308 | 2.403610e-49 | 3.670081e-47 |
| MsaG036431 | MsaG038137 | 0.806851 | 1.142091e-49 | 1.808316e-47 |
| MsaG036594 | MsaG038137 | 0.843422 | 2.640534e-58 | 1.149262e-55 |
| MsaG037261 | MsaG038137 | 0.808254 | 5.771880e-50 | 9.450479e-48 |
| MsaG037309 | MsaG038137 | 0.802672 | 8.436569e-49 | 1.211987e-46 |
| MsaG037339 | MsaG038137 | 0.844941 | 1.037140e-58 | 4.744013e-56 |
| MsaG037735 | MsaG038137 | 0.805440 | 2.254951e-49 | 3.453777e-47 |
| MsaG037924 | MsaG038137 | 0.804039 | 4.409526e-49 | 6.538112e-47 |
| MsaG037969 | MsaG038137 | 0.808355 | 5.492908e-50 | 9.015411e-48 |
| MsaG038993 | MsaG038137 | 0.818669 | 3.032558e-52 | 6.440166e-50 |
| MsaG039483 | MsaG038137 | 0.814533 | 2.536010e-51 | 4.844908e-49 |
| MsaG040540 | MsaG038137 | 0.818050 | 4.182551e-52 | 8.741149e-50 |
| MsaG040731 | MsaG038137 | 0.821541 | 6.718783e-53 | 1.539220e-50 |
| MsaG041086 | MsaG038137 | 0.802373 | 9.716739e-49 | 1.386391e-46 |
| MsaG041505 | MsaG038137 | 0.800212 | 2.677863e-48 | 3.637914e-46 |
| MsaG041680 | MsaG038137 | 0.800855 | 1.983341e-48 | 2.733851e-46 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG038137 | MtrunA17_Chr5g0415031 | 72.727 | 44 | 12 | 0 | 5 | 48 | 137 | 180 | 1.54e-15 | 73.6 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Find 42 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| TCGTTCATTGTATGCAAATA+TGG | 0.177819 | 7:+71908871 | None:intergenic |
| TTAACAATGAAGTTCCTTAT+TGG | 0.182133 | 7:-71908595 | MsaT038137.1:CDS |
| ATAAGGAACTTCATTGTTAA+TGG | 0.202647 | 7:+71908598 | None:intergenic |
| TCATGTTTACAAGTCATTTC+TGG | 0.210390 | 7:-71910357 | MsaT038137.1:CDS |
| AAGCTTCTTCTTACCGAATA+TGG | 0.221899 | 7:+71909058 | None:intergenic |
| TTCCGAGGTCATTTGGTTCC+TGG | 0.287179 | 7:-71908719 | MsaT038137.1:CDS |
| TGAAACCGAGTCTGCATAAA+AGG | 0.295350 | 7:+71910389 | None:intergenic |
| ACTTGATTTCTTTCACAAAA+AGG | 0.305474 | 7:+71908749 | None:intergenic |
| TGTAAATCATTTATCCAATA+AGG | 0.324437 | 7:+71908581 | None:intergenic |
| GGAAGATTGGCATTCATAGA+AGG | 0.377655 | 7:+71909012 | None:intergenic |
| TGTTCATTTCCGAGGTCATT+TGG | 0.399122 | 7:-71908726 | MsaT038137.1:CDS |
| ATCATCCCACACACCATATT+CGG | 0.400509 | 7:-71909071 | MsaT038137.1:CDS |
| TCCGAGGTCATTTGGTTCCT+GGG | 0.414120 | 7:-71908718 | MsaT038137.1:CDS |
| ACTCTTGCAAAGAGGAAGAT+TGG | 0.441241 | 7:+71908999 | None:intergenic |
| AATTTGAAAGGCAGTAAAAT+CGG | 0.443501 | 7:-71908910 | MsaT038137.1:CDS |
| ACAGAGTCATTACCCGTTCA+AGG | 0.453373 | 7:-71908676 | MsaT038137.1:CDS |
| CGTTCATTGTATGCAAATAT+GGG | 0.464020 | 7:+71908872 | None:intergenic |
| ATTGTATGCAAATATGGGCC+TGG | 0.465098 | 7:+71908877 | None:intergenic |
| CTAATGGTAATTAGAAATGC+TGG | 0.466828 | 7:-71908949 | MsaT038137.1:intron |
| GAACGATGGTGTCCTTGAAC+GGG | 0.488560 | 7:+71908664 | None:intergenic |
| TTTATGCAGACTCGGTTTCA+GGG | 0.488613 | 7:-71910386 | MsaT038137.1:CDS |
| CTGCCGCAATTGAATTTGAA+AGG | 0.501797 | 7:-71908922 | MsaT038137.1:CDS |
| TTGTATGCAAATATGGGCCT+GGG | 0.507064 | 7:+71908878 | None:intergenic |
| TCATAGAAGGGGCTGATGGT+TGG | 0.508105 | 7:+71909025 | None:intergenic |
| GGATATGCGACATACACAAC+AGG | 0.519767 | 7:+71908619 | None:intergenic |
| TTCTTACCGAATATGGTGTG+TGG | 0.522091 | 7:+71909065 | None:intergenic |
| AATCAAGTTGTTCATTTCCG+AGG | 0.538622 | 7:-71908734 | MsaT038137.1:CDS |
| GAAGATTGGCATTCATAGAA+GGG | 0.557607 | 7:+71909013 | None:intergenic |
| ATCACCCTGGTCTACAAAAG+AGG | 0.559172 | 7:-71910299 | MsaT038137.1:intron |
| CATATTGAATACGTACAGAA+AGG | 0.566699 | 7:-71910333 | MsaT038137.1:CDS |
| GCATTCATAGAAGGGGCTGA+TGG | 0.568861 | 7:+71909021 | None:intergenic |
| CATATCTAACTCTTGCAAAG+AGG | 0.574507 | 7:+71908991 | None:intergenic |
| ATACGTACAGAAAGGAAAGT+AGG | 0.588510 | 7:-71910325 | MsaT038137.1:CDS |
| TGAACGATGGTGTCCTTGAA+CGG | 0.596531 | 7:+71908663 | None:intergenic |
| AAAATCGGAAAGCAATTCCC+AGG | 0.598355 | 7:-71908895 | MsaT038137.1:CDS |
| CTGCCTTTCAAATTCAATTG+CGG | 0.611889 | 7:+71908919 | None:intergenic |
| TCTTACCGAATATGGTGTGT+GGG | 0.613886 | 7:+71909066 | None:intergenic |
| GGAAAGTAGGCCTATCACCC+TGG | 0.616094 | 7:-71910312 | MsaT038137.1:CDS |
| TCCCAGGAACCAAATGACCT+CGG | 0.629938 | 7:+71908717 | None:intergenic |
| AAGATTGGCATTCATAGAAG+GGG | 0.643466 | 7:+71909014 | None:intergenic |
| CACAACAGGAACTATTTCTG+CGG | 0.645147 | 7:+71908633 | None:intergenic |
| CTGCGGTGTTGAGTGAACGA+TGG | 0.681087 | 7:+71908650 | None:intergenic |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| Chr7 | gene | 71908591 | 71910417 | 71908591 | ID=MsaG038137 |
| Chr7 | mRNA | 71908591 | 71910417 | 71908591 | ID=MsaT038137.1;Parent=MsaG038137 |
| Chr7 | exon | 71908591 | 71908791 | 71908591 | ID=MsaT038137.1.exon4;Parent=MsaT038137.1 |
| Chr7 | CDS | 71908591 | 71908791 | 71908591 | ID=cds.MsaT038137.1;Parent=MsaT038137.1 |
| Chr7 | exon | 71908870 | 71908957 | 71908870 | ID=MsaT038137.1.exon3;Parent=MsaT038137.1 |
| Chr7 | CDS | 71908870 | 71908957 | 71908870 | ID=cds.MsaT038137.1;Parent=MsaT038137.1 |
| Chr7 | exon | 71909001 | 71909103 | 71909001 | ID=MsaT038137.1.exon2;Parent=MsaT038137.1 |
| Chr7 | CDS | 71909001 | 71909103 | 71909001 | ID=cds.MsaT038137.1;Parent=MsaT038137.1 |
| Chr7 | exon | 71910300 | 71910417 | 71910300 | ID=MsaT038137.1.exon1;Parent=MsaT038137.1 |
| Chr7 | CDS | 71910300 | 71910417 | 71910300 | ID=cds.MsaT038137.1;Parent=MsaT038137.1 |
| Gene Sequence |
| Protein sequence |