Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG038190 | XP_024637264.1 | 89.623 | 106 | 11 | 0 | 1 | 106 | 60 | 165 | 2.70e-65 | 204 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG038190 | tr|G7JQ00|G7JQ00_MEDTR | 89.623 | 106 | 11 | 0 | 1 | 106 | 120 | 225 | 6.04e-65 | 205 |
| Gene ID | Type | Classification |
|---|---|---|
| MsaG038190 | TF | B3 |
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| MsaG021944 | MsaG038190 | 0.804759 | 3.127091e-49 | 4.714366e-47 |
| MsaG035586 | MsaG038190 | 0.943803 | 1.884484e-102 | 2.491308e-97 |
| MsaG038185 | MsaG038190 | 0.898459 | 1.186198e-76 | 5.547719e-73 |
| MsaG038190 | MsaG038199 | 0.836916 | 1.294367e-56 | 4.592543e-54 |
| MsaG038190 | MsaG038258 | 0.884980 | 2.596453e-71 | 5.940904e-68 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsaG038190 | MtrunA17_Chr5g0393501 | 34.343 | 99 | 62 | 1 | 10 | 105 | 143 | 241 | 2.04e-12 | 60.8 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Find 22 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| GAAGTTCCTATCGTTGGATA+TGG | 0.258835 | 7:+72601554 | MsaT038190.1:CDS |
| CCAAATGTGATGTTCGAAAA+AGG | 0.275905 | 7:+72601797 | MsaT038190.1:CDS |
| AATCGTGATGTTTCACTCTA+AGG | 0.341127 | 7:-72601706 | None:intergenic |
| AGGAATTTGCCAAAAGTATC+AGG | 0.344083 | 7:-72601686 | None:intergenic |
| TAGGAACTACCTGATACTTT+TGG | 0.356273 | 7:+72601677 | MsaT038190.1:intron |
| CGAACATCACATTTGGTATG+AGG | 0.421525 | 7:-72601790 | None:intergenic |
| ACCTTTGAAGTTCCTATCGT+TGG | 0.439777 | 7:+72601548 | MsaT038190.1:CDS |
| TTGTGCTGCCAACGGTATTG+AGG | 0.440186 | 7:+72601832 | MsaT038190.1:CDS |
| TGTGCTGCCAACGGTATTGA+GGG | 0.457164 | 7:+72601833 | MsaT038190.1:CDS |
| GTCATGTGTTTATCAACGCT+TGG | 0.483566 | 7:-72601915 | None:intergenic |
| ACATGATGCTGCCGCACTCA+TGG | 0.492689 | 7:-72601519 | None:intergenic |
| ACAGGAATTATATTGTCATA+AGG | 0.502590 | 7:-72601746 | None:intergenic |
| TCTGTATATTTGAGCCTCAC+AGG | 0.521025 | 7:-72601764 | None:intergenic |
| TTTCAAGTGCAAGTGCGTCA+TGG | 0.567746 | 7:+72601871 | MsaT038190.1:CDS |
| CACGATTACGTCATGTTGTG+CGG | 0.590860 | 7:+72601722 | MsaT038190.1:CDS |
| GTCTCCGCCCTCAATACCGT+TGG | 0.604486 | 7:-72601840 | None:intergenic |
| TCCAACGATAGGAACTTCAA+AGG | 0.611311 | 7:-72601549 | None:intergenic |
| GTCGATCCATATCCAACGAT+AGG | 0.629633 | 7:-72601560 | None:intergenic |
| ACCCTATCATTCCATGAGTG+CGG | 0.640367 | 7:+72601508 | None:intergenic |
| GCTGCCAACGGTATTGAGGG+CGG | 0.688184 | 7:+72601836 | MsaT038190.1:CDS |
| TGGATCGACGAAATCACCGA+AGG | 0.700849 | 7:+72601574 | MsaT038190.1:CDS |
| ATGACAATATAATTCCTGTG+AGG | 0.716297 | 7:+72601750 | MsaT038190.1:CDS |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| Chr7 | gene | 72601521 | 72601925 | 72601521 | ID=MsaG038190 |
| Chr7 | mRNA | 72601521 | 72601925 | 72601521 | ID=MsaT038190.1;Parent=MsaG038190 |
| Chr7 | exon | 72601521 | 72601595 | 72601521 | ID=MsaT038190.1.exon1;Parent=MsaT038190.1 |
| Chr7 | CDS | 72601521 | 72601595 | 72601521 | ID=cds.MsaT038190.1;Parent=MsaT038190.1 |
| Chr7 | exon | 72601680 | 72601925 | 72601680 | ID=MsaT038190.1.exon2;Parent=MsaT038190.1 |
| Chr7 | CDS | 72601680 | 72601925 | 72601680 | ID=cds.MsaT038190.1;Parent=MsaT038190.1 |
| Gene Sequence |
| Protein sequence |
