Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG039448 | XP_039684024.1 | 83.826 | 575 | 44 | 6 | 1 | 530 | 1 | 571 | 0.0 | 922 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG039448 | sp|Q9M219|MTEFH_ARATH | 25.451 | 554 | 337 | 18 | 26 | 520 | 10 | 546 | 1.48e-40 | 157 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG039448 | tr|G7KVB8|G7KVB8_MEDTR | 83.826 | 575 | 44 | 6 | 1 | 530 | 1 | 571 | 0.0 | 922 |
Gene ID | Type | Classification |
---|---|---|
MsaG039448 | TR | mTERF |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000083 | MsaG039448 | 0.801828 | 1.256170e-48 | 1.770154e-46 |
MsaG000140 | MsaG039448 | 0.801470 | 1.486763e-48 | 2.078039e-46 |
MsaG000643 | MsaG039448 | 0.807575 | 8.035959e-50 | 1.294421e-47 |
MsaG000712 | MsaG039448 | 0.810412 | 1.997612e-50 | 3.445924e-48 |
MsaG001192 | MsaG039448 | 0.822396 | 4.267882e-53 | 1.000344e-50 |
MsaG001514 | MsaG039448 | 0.816268 | 1.047615e-51 | 2.091338e-49 |
MsaG001826 | MsaG039448 | 0.806717 | 1.218254e-49 | 1.922922e-47 |
MsaG001827 | MsaG039448 | 0.825403 | 8.484811e-54 | 2.158089e-51 |
MsaG002121 | MsaG039448 | 0.808307 | 5.622901e-50 | 9.218242e-48 |
MsaG002414 | MsaG039448 | 0.813479 | 4.321583e-51 | 8.040725e-49 |
MsaG002681 | MsaG039448 | 0.829811 | 7.500957e-55 | 2.159110e-52 |
MsaG002691 | MsaG039448 | 0.802580 | 8.812124e-49 | 1.263282e-46 |
MsaG002878 | MsaG039448 | 0.827877 | 2.193574e-54 | 5.977897e-52 |
MsaG002906 | MsaG039448 | 0.827405 | 2.843212e-54 | 7.646455e-52 |
MsaG002929 | MsaG039448 | 0.817266 | 6.269414e-52 | 1.284128e-49 |
MsaG003105 | MsaG039448 | 0.817982 | 4.331623e-52 | 9.037067e-50 |
MsaG003684 | MsaG039448 | 0.822660 | 3.708281e-53 | 8.753706e-51 |
MsaG003721 | MsaG039448 | 0.812572 | 6.814825e-51 | 1.239620e-48 |
MsaG003792 | MsaG039448 | 0.809942 | 2.519655e-50 | 4.296789e-48 |
MsaG003810 | MsaG039448 | 0.817804 | 4.748857e-52 | 9.862149e-50 |
MsaG003882 | MsaG039448 | 0.806834 | 1.151344e-49 | 1.822240e-47 |
MsaG003915 | MsaG039448 | 0.800724 | 2.108238e-48 | 2.897551e-46 |
MsaG004157 | MsaG039448 | 0.810209 | 2.208996e-50 | 3.791503e-48 |
MsaG004277 | MsaG039448 | 0.814364 | 2.763189e-51 | 5.256766e-49 |
MsaG004428 | MsaG039448 | 0.801184 | 1.699895e-48 | 2.360600e-46 |
MsaG005035 | MsaG039448 | 0.817159 | 6.627393e-52 | 1.353675e-49 |
MsaG005138 | MsaG039448 | 0.817612 | 5.244206e-52 | 1.083671e-49 |
MsaG005235 | MsaG039448 | 0.820706 | 1.044598e-52 | 2.340608e-50 |
MsaG005246 | MsaG039448 | 0.807467 | 8.469440e-50 | 1.360739e-47 |
MsaG005368 | MsaG039448 | 0.801746 | 1.305889e-48 | 1.836741e-46 |
MsaG005560 | MsaG039448 | 0.809560 | 3.042250e-50 | 5.140530e-48 |
MsaG005564 | MsaG039448 | 0.823893 | 1.916996e-53 | 4.678797e-51 |
MsaG005626 | MsaG039448 | 0.815083 | 1.917664e-51 | 3.714751e-49 |
MsaG005775 | MsaG039448 | 0.814999 | 2.002275e-51 | 3.870479e-49 |
MsaG005866 | MsaG039448 | 0.802530 | 9.022290e-49 | 1.291937e-46 |
MsaG006145 | MsaG039448 | 0.817924 | 4.462853e-52 | 9.296973e-50 |
MsaG006178 | MsaG039448 | 0.818809 | 2.819040e-52 | 6.008718e-50 |
MsaG006517 | MsaG039448 | 0.815945 | 1.235868e-51 | 2.446960e-49 |
MsaG006576 | MsaG039448 | 0.810815 | 1.636433e-50 | 2.850641e-48 |
MsaG006548 | MsaG039448 | 0.803575 | 5.499650e-49 | 8.066760e-47 |
MsaG006633 | MsaG039448 | 0.824982 | 1.065537e-53 | 2.679109e-51 |
MsaG006710 | MsaG039448 | 0.804931 | 2.879115e-49 | 4.357963e-47 |
MsaG006759 | MsaG039448 | 0.809096 | 3.820513e-50 | 6.383755e-48 |
MsaG006788 | MsaG039448 | 0.829800 | 7.549375e-55 | 2.172357e-52 |
MsaG007033 | MsaG039448 | 0.800141 | 2.767618e-48 | 3.753886e-46 |
MsaG007291 | MsaG039448 | 0.807579 | 8.017422e-50 | 1.291571e-47 |
MsaG008033 | MsaG039448 | 0.802639 | 8.570304e-49 | 1.230275e-46 |
MsaG008442 | MsaG039448 | 0.809651 | 2.909137e-50 | 4.926270e-48 |
MsaG008430 | MsaG039448 | 0.806993 | 1.065666e-49 | 1.693021e-47 |
MsaG008682 | MsaG039448 | 0.820507 | 1.159763e-52 | 2.585161e-50 |
MsaG008712 | MsaG039448 | 0.800454 | 2.391611e-48 | 3.266994e-46 |
MsaG008815 | MsaG039448 | 0.838620 | 4.750152e-57 | 1.776052e-54 |
MsaG008888 | MsaG039448 | 0.818530 | 3.259915e-52 | 6.898046e-50 |
MsaG008877 | MsaG039448 | 0.817848 | 4.643411e-52 | 9.653864e-50 |
MsaG009057 | MsaG039448 | 0.822697 | 3.636277e-53 | 8.592370e-51 |
MsaG009178 | MsaG039448 | 0.851070 | 2.151905e-60 | 1.210134e-57 |
MsaG009193 | MsaG039448 | 0.818004 | 4.281709e-52 | 8.938228e-50 |
MsaG009532 | MsaG039448 | 0.811216 | 1.341042e-50 | 2.359128e-48 |
MsaG009749 | MsaG039448 | 0.809218 | 3.598498e-50 | 6.030079e-48 |
MsaG009765 | MsaG039448 | 0.814735 | 2.289343e-51 | 4.395947e-49 |
MsaG009852 | MsaG039448 | 0.804776 | 3.100472e-49 | 4.676116e-47 |
MsaG009911 | MsaG039448 | 0.800391 | 2.463009e-48 | 3.359739e-46 |
MsaG009926 | MsaG039448 | 0.802123 | 1.093273e-48 | 1.550907e-46 |
MsaG010075 | MsaG039448 | 0.803583 | 5.478592e-49 | 8.037374e-47 |
MsaG010274 | MsaG039448 | 0.811103 | 1.418674e-50 | 2.488798e-48 |
MsaG010331 | MsaG039448 | 0.816566 | 8.991218e-52 | 1.808605e-49 |
MsaG010594 | MsaG039448 | 0.802700 | 8.326572e-49 | 1.196917e-46 |
MsaG010887 | MsaG039448 | 0.802450 | 9.368639e-49 | 1.339087e-46 |
MsaG011213 | MsaG039448 | 0.804385 | 3.738442e-49 | 5.587492e-47 |
MsaG011257 | MsaG039448 | 0.812966 | 5.594364e-51 | 1.027618e-48 |
MsaG011335 | MsaG039448 | 0.800138 | 2.772349e-48 | 3.759980e-46 |
MsaG011341 | MsaG039448 | 0.806187 | 1.574018e-49 | 2.453566e-47 |
MsaG011467 | MsaG039448 | 0.801901 | 1.213863e-48 | 1.713383e-46 |
MsaG011559 | MsaG039448 | 0.835213 | 3.486939e-56 | 1.175417e-53 |
MsaG011764 | MsaG039448 | 0.818801 | 2.832006e-52 | 6.035015e-50 |
MsaG011825 | MsaG039448 | 0.814194 | 3.012143e-51 | 5.705768e-49 |
MsaG011796 | MsaG039448 | 0.811902 | 9.526189e-51 | 1.704315e-48 |
MsaG011996 | MsaG039448 | 0.809219 | 3.596624e-50 | 6.027090e-48 |
MsaG012130 | MsaG039448 | 0.820480 | 1.176462e-52 | 2.620549e-50 |
MsaG012188 | MsaG039448 | 0.803082 | 6.949410e-49 | 1.007790e-46 |
MsaG012354 | MsaG039448 | 0.821568 | 6.626281e-53 | 1.519075e-50 |
MsaG012492 | MsaG039448 | 0.808853 | 4.304362e-50 | 7.150252e-48 |
MsaG012754 | MsaG039448 | 0.810617 | 1.805435e-50 | 3.129893e-48 |
MsaG013155 | MsaG039448 | 0.843872 | 2.003584e-58 | 8.847053e-56 |
MsaG013156 | MsaG039448 | 0.867971 | 1.863639e-65 | 1.985379e-62 |
MsaG013182 | MsaG039448 | 0.814403 | 2.709507e-51 | 5.159595e-49 |
MsaG013327 | MsaG039448 | 0.802502 | 9.143965e-49 | 1.308503e-46 |
MsaG013901 | MsaG039448 | 0.815065 | 1.935370e-51 | 3.747414e-49 |
MsaG013970 | MsaG039448 | 0.820682 | 1.057370e-52 | 2.367806e-50 |
MsaG014062 | MsaG039448 | 0.838109 | 6.423721e-57 | 2.363885e-54 |
MsaG014149 | MsaG039448 | 0.811993 | 9.104585e-51 | 1.632499e-48 |
MsaG014369 | MsaG039448 | 0.800079 | 2.849722e-48 | 3.859865e-46 |
MsaG014494 | MsaG039448 | 0.804100 | 4.282913e-49 | 6.359347e-47 |
MsaG014508 | MsaG039448 | 0.837374 | 9.899372e-57 | 3.561651e-54 |
MsaG014534 | MsaG039448 | 0.824978 | 1.067877e-53 | 2.684657e-51 |
MsaG015166 | MsaG039448 | 0.808261 | 5.752122e-50 | 9.419770e-48 |
MsaG015441 | MsaG039448 | 0.803747 | 5.066933e-49 | 7.461972e-47 |
MsaG015564 | MsaG039448 | 0.806341 | 1.461383e-49 | 2.286322e-47 |
MsaG015846 | MsaG039448 | 0.812190 | 8.252096e-51 | 1.486817e-48 |
MsaG015930 | MsaG039448 | 0.803152 | 6.722096e-49 | 9.763962e-47 |
MsaG016121 | MsaG039448 | 0.809774 | 2.737346e-50 | 4.649232e-48 |
MsaG016250 | MsaG039448 | 0.814258 | 2.915259e-51 | 5.531245e-49 |
MsaG016366 | MsaG039448 | 0.809794 | 2.711108e-50 | 4.606922e-48 |
MsaG016584 | MsaG039448 | 0.800400 | 2.453033e-48 | 3.346817e-46 |
MsaG016721 | MsaG039448 | 0.801410 | 1.529012e-48 | 2.134221e-46 |
MsaG017063 | MsaG039448 | 0.800221 | 2.666934e-48 | 3.623786e-46 |
MsaG017271 | MsaG039448 | 0.802248 | 1.030978e-48 | 1.466721e-46 |
MsaG017281 | MsaG039448 | 0.814604 | 2.446253e-51 | 4.681722e-49 |
MsaG018069 | MsaG039448 | 0.801782 | 1.283995e-48 | 1.807380e-46 |
MsaG018150 | MsaG039448 | 0.802239 | 1.035274e-48 | 1.472529e-46 |
MsaG018256 | MsaG039448 | 0.807462 | 8.489010e-50 | 1.363747e-47 |
MsaG018355 | MsaG039448 | 0.846033 | 5.263820e-59 | 2.495781e-56 |
MsaG018406 | MsaG039448 | 0.808600 | 4.872393e-50 | 8.044360e-48 |
MsaG018431 | MsaG039448 | 0.839523 | 2.778426e-57 | 1.068468e-54 |
MsaG018488 | MsaG039448 | 0.828676 | 1.410172e-54 | 3.930085e-52 |
MsaG018502 | MsaG039448 | 0.819515 | 1.951435e-52 | 4.237119e-50 |
MsaG018613 | MsaG039448 | 0.803275 | 6.341647e-49 | 9.237641e-47 |
MsaG018780 | MsaG039448 | 0.814812 | 2.201964e-51 | 4.236455e-49 |
MsaG018876 | MsaG039448 | 0.800797 | 2.037888e-48 | 2.805441e-46 |
MsaG019473 | MsaG039448 | 0.806538 | 1.328340e-49 | 2.087910e-47 |
MsaG019479 | MsaG039448 | 0.804182 | 4.118836e-49 | 6.127099e-47 |
MsaG019540 | MsaG039448 | 0.801006 | 1.848074e-48 | 2.556059e-46 |
MsaG019596 | MsaG039448 | 0.802881 | 7.643041e-49 | 1.103243e-46 |
MsaG019716 | MsaG039448 | 0.800447 | 2.400187e-48 | 3.278155e-46 |
MsaG019772 | MsaG039448 | 0.816384 | 9.871517e-52 | 1.976444e-49 |
MsaG019783 | MsaG039448 | 0.809577 | 3.016967e-50 | 5.099953e-48 |
MsaG020289 | MsaG039448 | 0.823681 | 2.147517e-53 | 5.211759e-51 |
MsaG020449 | MsaG039448 | 0.824000 | 1.809515e-53 | 4.429463e-51 |
MsaG020650 | MsaG039448 | 0.808090 | 6.253119e-50 | 1.019818e-47 |
MsaG020697 | MsaG039448 | 0.810401 | 2.008253e-50 | 3.463353e-48 |
MsaG020775 | MsaG039448 | 0.802331 | 9.911913e-49 | 1.412888e-46 |
MsaG020862 | MsaG039448 | 0.801984 | 1.167482e-48 | 1.650964e-46 |
MsaG021032 | MsaG039448 | 0.809995 | 2.455233e-50 | 4.192342e-48 |
MsaG021085 | MsaG039448 | 0.806740 | 1.204724e-49 | 1.902624e-47 |
MsaG021273 | MsaG039448 | 0.802724 | 8.233134e-49 | 1.184127e-46 |
MsaG021293 | MsaG039448 | 0.800266 | 2.611907e-48 | 3.552614e-46 |
MsaG021379 | MsaG039448 | 0.828429 | 1.616659e-54 | 4.474743e-52 |
MsaG021484 | MsaG039448 | 0.817862 | 4.609498e-52 | 9.586856e-50 |
MsaG021781 | MsaG039448 | 0.825128 | 9.847066e-54 | 2.485749e-51 |
MsaG021783 | MsaG039448 | 0.844628 | 1.258404e-58 | 5.696477e-56 |
MsaG021836 | MsaG039448 | 0.837683 | 8.254383e-57 | 2.997979e-54 |
MsaG022048 | MsaG039448 | 0.811517 | 1.154470e-50 | 2.045937e-48 |
MsaG022095 | MsaG039448 | 0.823703 | 2.122645e-53 | 5.154471e-51 |
MsaG022548 | MsaG039448 | 0.815081 | 1.919650e-51 | 3.718410e-49 |
MsaG022609 | MsaG039448 | 0.845173 | 8.983902e-59 | 4.139788e-56 |
MsaG022706 | MsaG039448 | 0.811050 | 1.456439e-50 | 2.551739e-48 |
MsaG022981 | MsaG039448 | 0.829873 | 7.249315e-55 | 2.090455e-52 |
MsaG023246 | MsaG039448 | 0.808053 | 6.364486e-50 | 1.037071e-47 |
MsaG023225 | MsaG039448 | 0.801693 | 1.338416e-48 | 1.880234e-46 |
MsaG023230 | MsaG039448 | 0.835936 | 2.291874e-56 | 7.895431e-54 |
MsaG023590 | MsaG039448 | 0.810025 | 2.418860e-50 | 4.133183e-48 |
MsaG023849 | MsaG039448 | 0.801024 | 1.832212e-48 | 2.535157e-46 |
MsaG023896 | MsaG039448 | 0.802483 | 9.223949e-49 | 1.319386e-46 |
MsaG024313 | MsaG039448 | 0.812056 | 8.821554e-51 | 1.584158e-48 |
MsaG024417 | MsaG039448 | 0.803861 | 4.800383e-49 | 7.087884e-47 |
MsaG024454 | MsaG039448 | 0.820910 | 9.380602e-53 | 2.113422e-50 |
MsaG024535 | MsaG039448 | 0.805294 | 2.419313e-49 | 3.692906e-47 |
MsaG024752 | MsaG039448 | 0.816658 | 8.572821e-52 | 1.728504e-49 |
MsaG025276 | MsaG039448 | 0.828867 | 1.268349e-54 | 3.553871e-52 |
MsaG025330 | MsaG039448 | 0.815220 | 1.788779e-51 | 3.477223e-49 |
MsaG025331 | MsaG039448 | 0.820729 | 1.031871e-52 | 2.313547e-50 |
MsaG025489 | MsaG039448 | 0.825357 | 8.696217e-54 | 2.209150e-51 |
MsaG025500 | MsaG039448 | 0.803059 | 7.026244e-49 | 1.018378e-46 |
MsaG025584 | MsaG039448 | 0.822360 | 4.351994e-53 | 1.019082e-50 |
MsaG025776 | MsaG039448 | 0.814316 | 2.831135e-51 | 5.379388e-49 |
MsaG025908 | MsaG039448 | 0.808303 | 5.633575e-50 | 9.234909e-48 |
MsaG026292 | MsaG039448 | 0.802756 | 8.110249e-49 | 1.167312e-46 |
MsaG026465 | MsaG039448 | 0.835062 | 3.804831e-56 | 1.276866e-53 |
MsaG026614 | MsaG039448 | 0.818508 | 3.297130e-52 | 6.972862e-50 |
MsaG026937 | MsaG039448 | 0.821018 | 8.861924e-53 | 2.002344e-50 |
MsaG026897 | MsaG039448 | 0.820097 | 1.438317e-52 | 3.171641e-50 |
MsaG026901 | MsaG039448 | 0.807923 | 6.783584e-50 | 1.101927e-47 |
MsaG027323 | MsaG039448 | 0.804611 | 3.355767e-49 | 5.041713e-47 |
MsaG027588 | MsaG039448 | 0.800207 | 2.683743e-48 | 3.645494e-46 |
MsaG027690 | MsaG039448 | 0.828489 | 1.564154e-54 | 4.336672e-52 |
MsaG027991 | MsaG039448 | 0.819093 | 2.432013e-52 | 5.222646e-50 |
MsaG028072 | MsaG039448 | 0.800798 | 2.037242e-48 | 2.804607e-46 |
MsaG028204 | MsaG039448 | 0.801885 | 1.222808e-48 | 1.725391e-46 |
MsaG028303 | MsaG039448 | 0.825931 | 6.367505e-54 | 1.643606e-51 |
MsaG028306 | MsaG039448 | 0.826026 | 6.046929e-54 | 1.564934e-51 |
MsaG028308 | MsaG039448 | 0.838143 | 6.295397e-57 | 2.319117e-54 |
MsaG028370 | MsaG039448 | 0.828102 | 1.936679e-54 | 5.311391e-52 |
MsaG028328 | MsaG039448 | 0.807869 | 6.963054e-50 | 1.129607e-47 |
MsaG028345 | MsaG039448 | 0.801184 | 1.699710e-48 | 2.360371e-46 |
MsaG028417 | MsaG039448 | 0.836212 | 1.952584e-56 | 6.782595e-54 |
MsaG028423 | MsaG039448 | 0.802536 | 8.998238e-49 | 1.288672e-46 |
MsaG028603 | MsaG039448 | 0.826136 | 5.695179e-54 | 1.478443e-51 |
MsaG028604 | MsaG039448 | 0.836118 | 2.062121e-56 | 7.143112e-54 |
MsaG028742 | MsaG039448 | 0.813894 | 3.504090e-51 | 6.588136e-49 |
MsaG028760 | MsaG039448 | 0.805362 | 2.341064e-49 | 3.579182e-47 |
MsaG028821 | MsaG039448 | 0.823997 | 1.812242e-53 | 4.435796e-51 |
MsaG028999 | MsaG039448 | 0.800149 | 2.757223e-48 | 3.740499e-46 |
MsaG029083 | MsaG039448 | 0.809221 | 3.593031e-50 | 6.021396e-48 |
MsaG029311 | MsaG039448 | 0.843684 | 2.248273e-58 | 9.868781e-56 |
MsaG029341 | MsaG039448 | 0.813981 | 3.354337e-51 | 6.320231e-49 |
MsaG029613 | MsaG039448 | 0.807180 | 9.733844e-50 | 1.553267e-47 |
MsaG029781 | MsaG039448 | 0.808005 | 6.517522e-50 | 1.060778e-47 |
MsaG029894 | MsaG039448 | 0.812321 | 7.729034e-51 | 1.397095e-48 |
MsaG030194 | MsaG039448 | 0.800432 | 2.416554e-48 | 3.299421e-46 |
MsaG030265 | MsaG039448 | 0.842477 | 4.696909e-58 | 1.983468e-55 |
MsaG030237 | MsaG039448 | 0.807047 | 1.038338e-49 | 1.651689e-47 |
MsaG030578 | MsaG039448 | 0.802070 | 1.121070e-48 | 1.588457e-46 |
MsaG030605 | MsaG039448 | 0.812780 | 6.139258e-51 | 1.122490e-48 |
MsaG031017 | MsaG039448 | 0.805330 | 2.377952e-49 | 3.632827e-47 |
MsaG032196 | MsaG039448 | 0.808090 | 6.250367e-50 | 1.019389e-47 |
MsaG032298 | MsaG039448 | 0.801113 | 1.757737e-48 | 2.436986e-46 |
MsaG032726 | MsaG039448 | 0.803958 | 4.582836e-49 | 6.782064e-47 |
MsaG032764 | MsaG039448 | 0.800415 | 2.435933e-48 | 3.324592e-46 |
MsaG032860 | MsaG039448 | 0.854976 | 1.661869e-61 | 1.072628e-58 |
MsaG032914 | MsaG039448 | 0.826292 | 5.229584e-54 | 1.363420e-51 |
MsaG033165 | MsaG039448 | 0.801689 | 1.341345e-48 | 1.884145e-46 |
MsaG034005 | MsaG039448 | 0.800287 | 2.585497e-48 | 3.518398e-46 |
MsaG034107 | MsaG039448 | 0.809953 | 2.505677e-50 | 4.274176e-48 |
MsaG034145 | MsaG039448 | 0.806981 | 1.072097e-49 | 1.702735e-47 |
MsaG034839 | MsaG039448 | 0.808797 | 4.423550e-50 | 7.338246e-48 |
MsaG035173 | MsaG039448 | 0.802693 | 8.355627e-49 | 1.200902e-46 |
MsaG035165 | MsaG039448 | 0.804613 | 3.352895e-49 | 5.037604e-47 |
MsaG035219 | MsaG039448 | 0.813870 | 3.547321e-51 | 6.665410e-49 |
MsaG035456 | MsaG039448 | 0.800870 | 1.969858e-48 | 2.716132e-46 |
MsaG035731 | MsaG039448 | 0.821215 | 7.982844e-53 | 1.813121e-50 |
MsaG035940 | MsaG039448 | 0.806399 | 1.421133e-49 | 2.226368e-47 |
MsaG036421 | MsaG039448 | 0.821353 | 7.424594e-53 | 1.692421e-50 |
MsaG036428 | MsaG039448 | 0.801922 | 1.201908e-48 | 1.697281e-46 |
MsaG037736 | MsaG039448 | 0.820849 | 9.687689e-53 | 2.178961e-50 |
MsaG037868 | MsaG039448 | 0.849843 | 4.739995e-60 | 2.555223e-57 |
MsaG038166 | MsaG039448 | 0.806095 | 1.645544e-49 | 2.559445e-47 |
MsaG038466 | MsaG039448 | 0.805978 | 1.740864e-49 | 2.700155e-47 |
MsaG038499 | MsaG039448 | 0.810518 | 1.895858e-50 | 3.278751e-48 |
MsaG038828 | MsaG039448 | 0.823994 | 1.815667e-53 | 4.443721e-51 |
MsaG038991 | MsaG039448 | 0.850857 | 2.469892e-60 | 1.378768e-57 |
MsaG039106 | MsaG039448 | 0.813673 | 3.917686e-51 | 7.324918e-49 |
MsaG038999 | MsaG039448 | 0.808789 | 4.440909e-50 | 7.365653e-48 |
MsaG039175 | MsaG039448 | 0.800523 | 2.316639e-48 | 3.169429e-46 |
MsaG039397 | MsaG039448 | 0.814176 | 3.038879e-51 | 5.753907e-49 |
MsaG039448 | MsaG039760 | 0.800058 | 2.877642e-48 | 3.895907e-46 |
MsaG039448 | MsaG040019 | 0.808673 | 4.700949e-50 | 7.775430e-48 |
MsaG039448 | MsaG040162 | 0.813504 | 4.266741e-51 | 7.943652e-49 |
MsaG039448 | MsaG040249 | 0.812869 | 5.871542e-51 | 1.075938e-48 |
MsaG039448 | MsaG040266 | 0.804073 | 4.338892e-49 | 6.438395e-47 |
MsaG039448 | MsaG040310 | 0.805252 | 2.468818e-49 | 3.764811e-47 |
MsaG039448 | MsaG040354 | 0.810590 | 1.829403e-50 | 3.169341e-48 |
MsaG039448 | MsaG040545 | 0.831844 | 2.394585e-55 | 7.309328e-53 |
MsaG039448 | MsaG040572 | 0.800016 | 2.933995e-48 | 3.968499e-46 |
MsaG039448 | MsaG040673 | 0.806773 | 1.185768e-49 | 1.874130e-47 |
MsaG039448 | MsaG041010 | 0.807416 | 8.679514e-50 | 1.392824e-47 |
MsaG039448 | MsaG040950 | 0.816741 | 8.217450e-52 | 1.660429e-49 |
MsaG039448 | MsaG041066 | 0.803806 | 4.926399e-49 | 7.264783e-47 |
MsaG039448 | MsaG041135 | 0.824448 | 1.422167e-53 | 3.523952e-51 |
MsaG039448 | MsaG041437 | 0.803201 | 6.566542e-49 | 9.548993e-47 |
MsaG039448 | MsaG041434 | 0.816409 | 9.742451e-52 | 1.951859e-49 |
MsaG039448 | MsaG041495 | 0.805486 | 2.206284e-49 | 3.382749e-47 |
MsaG039448 | MsaG041793 | 0.809046 | 3.915329e-50 | 6.534318e-48 |
MsaG039448 | MsaG042050 | 0.831992 | 2.202385e-55 | 6.751451e-53 |
MsaG039448 | MsaG042575 | 0.808574 | 4.935869e-50 | 8.144147e-48 |
MsaG039448 | MsaG042732 | 0.803415 | 5.934217e-49 | 8.672006e-47 |
MsaG039448 | MsaG042799 | 0.846303 | 4.448774e-59 | 2.128329e-56 |
MsaG039448 | MsaG043390 | 0.826448 | 4.802290e-54 | 1.257561e-51 |
MsaG039448 | MsaG043499 | 0.817494 | 5.576234e-52 | 1.148811e-49 |
MsaG039448 | MsaG044119 | 0.827713 | 2.401126e-54 | 6.513480e-52 |
MsaG039448 | MsaG044189 | 0.829018 | 1.166749e-54 | 3.283109e-52 |
MsaG039448 | MsaG044305 | 0.802161 | 1.073755e-48 | 1.524561e-46 |
MsaG039448 | MsaG044311 | 0.801561 | 1.424308e-48 | 1.994837e-46 |
MsaG039448 | MsaG044313 | 0.833655 | 8.542305e-56 | 2.749121e-53 |
MsaG039448 | MsaG044532 | 0.829404 | 9.414059e-55 | 2.678293e-52 |
MsaG039448 | MsaG044566 | 0.804016 | 4.458891e-49 | 6.607558e-47 |
MsaG039448 | MsaG044946 | 0.835873 | 2.377239e-56 | 8.173866e-54 |
MsaG039448 | MsaG044960 | 0.810730 | 1.707099e-50 | 2.967542e-48 |
MsaG039448 | MsaG045212 | 0.808764 | 4.496160e-50 | 7.452848e-48 |
MsaG039448 | MsaG045303 | 0.822532 | 3.970705e-53 | 9.340850e-51 |
MsaG039448 | MsaG045314 | 0.853910 | 3.368375e-61 | 2.092993e-58 |
MsaG039448 | MsaG045958 | 0.817138 | 6.699911e-52 | 1.367756e-49 |
MsaG039448 | MsaG046084 | 0.800233 | 2.651793e-48 | 3.604235e-46 |
MsaG039448 | MsaG046281 | 0.813569 | 4.129000e-51 | 7.699959e-49 |
MsaG039448 | MsaG046289 | 0.800412 | 2.439791e-48 | 3.329622e-46 |
MsaG039448 | MsaG047166 | 0.800031 | 2.914277e-48 | 3.943031e-46 |
MsaG039448 | MsaG001943 | 0.801790 | 1.279188e-48 | 1.800958e-46 |
MsaG039448 | MsaG004516 | 0.815967 | 1.221803e-51 | 2.420476e-49 |
MsaG039448 | MsaG007532 | 0.809595 | 2.989769e-50 | 5.056022e-48 |
MsaG039448 | MsaG008820 | 0.800470 | 2.374466e-48 | 3.244668e-46 |
MsaG039448 | MsaG009083 | 0.800110 | 2.808905e-48 | 3.807181e-46 |
MsaG039448 | MsaG008314 | 0.811301 | 1.285605e-50 | 2.266349e-48 |
MsaG039448 | MsaG008728 | 0.807270 | 9.317576e-50 | 1.489983e-47 |
MsaG039448 | MsaG009150 | 0.823137 | 2.874819e-53 | 6.874308e-51 |
MsaG039448 | MsaG007436 | 0.831927 | 2.284082e-55 | 6.988930e-53 |
MsaG039448 | MsaG013410 | 0.806989 | 1.068196e-49 | 1.696869e-47 |
MsaG039448 | MsaG011818 | 0.813180 | 5.023097e-51 | 9.276385e-49 |
MsaG039448 | MsaG012254 | 0.841928 | 6.555136e-58 | 2.719876e-55 |
MsaG039448 | MsaG013067 | 0.822906 | 3.253020e-53 | 7.730118e-51 |
MsaG039448 | MsaG022818 | 0.829173 | 1.070151e-54 | 3.024443e-52 |
MsaG039448 | MsaG019389 | 0.804542 | 3.468594e-49 | 5.203033e-47 |
MsaG039448 | MsaG018949 | 0.804103 | 4.277929e-49 | 6.352323e-47 |
MsaG039448 | MsaG019154 | 0.856045 | 8.134482e-62 | 5.458129e-59 |
MsaG039448 | MsaG020214 | 0.817835 | 4.673662e-52 | 9.713760e-50 |
MsaG039448 | MsaG019742 | 0.809897 | 2.576093e-50 | 4.388347e-48 |
MsaG039448 | MsaG024064 | 0.841006 | 1.143726e-57 | 4.608207e-55 |
MsaG039448 | MsaG024920 | 0.818040 | 4.204216e-52 | 8.784194e-50 |
MsaG039448 | MsaG027496 | 0.808979 | 4.046932e-50 | 6.742929e-48 |
MsaG039448 | MsaG028769 | 0.816727 | 8.277147e-52 | 1.671867e-49 |
MsaG039448 | MsaG025429 | 0.801306 | 1.605309e-48 | 2.235432e-46 |
MsaG039448 | MsaG033142 | 0.801415 | 1.525608e-48 | 2.129713e-46 |
MsaG039448 | MsaG032519 | 0.811888 | 9.594849e-51 | 1.715991e-48 |
MsaG039448 | MsaG033056 | 0.818972 | 2.589947e-52 | 5.544223e-50 |
MsaG039448 | MsaG034192 | 0.803309 | 6.239753e-49 | 9.096268e-47 |
MsaG039448 | MsaG033413 | 0.808882 | 4.243231e-50 | 7.053720e-48 |
MsaG039448 | MsaG034578 | 0.801647 | 1.367955e-48 | 1.919723e-46 |
MsaG039448 | MsaG033779 | 0.800719 | 2.113153e-48 | 2.903981e-46 |
MsaG039448 | MsaG036708 | 0.812562 | 6.849652e-51 | 1.245635e-48 |
MsaG039448 | MsaG039944 | 0.816517 | 9.219907e-52 | 1.852255e-49 |
MsaG039448 | MsaG042682 | 0.801481 | 1.478742e-48 | 2.067358e-46 |
MsaG039448 | MsaG044505 | 0.812736 | 6.278735e-51 | 1.146718e-48 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG039448 | MtrunA17_Chr7g0258521 | 85.472 | 530 | 18 | 3 | 1 | 530 | 1 | 471 | 0.0 | 874 |
MsaG039448 | MtrunA17_Chr5g0438661 | 34.120 | 551 | 299 | 11 | 25 | 522 | 72 | 611 | 1.67e-89 | 287 |
MsaG039448 | MtrunA17_Chr8g0335121 | 35.079 | 191 | 116 | 3 | 33 | 221 | 22 | 206 | 6.19e-23 | 102 |
MsaG039448 | MtrunA17_Chr8g0335121 | 26.543 | 162 | 116 | 3 | 361 | 520 | 394 | 554 | 9.82e-15 | 77.0 |
MsaG039448 | MtrunA17_Chr7g0249711 | 30.208 | 192 | 131 | 2 | 27 | 217 | 31 | 220 | 8.04e-19 | 89.7 |
MsaG039448 | MtrunA17_Chr7g0249711 | 30.303 | 165 | 109 | 4 | 361 | 520 | 411 | 574 | 1.10e-15 | 80.1 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG039448 | AT4G19650.2 | 36.641 | 524 | 271 | 10 | 48 | 523 | 79 | 589 | 1.86e-110 | 341 |
MsaG039448 | AT5G06810.1 | 35.614 | 570 | 289 | 13 | 20 | 523 | 23 | 580 | 4.27e-110 | 340 |
MsaG039448 | AT5G06811.1 | 38.287 | 572 | 267 | 16 | 20 | 523 | 23 | 576 | 9.72e-106 | 328 |
MsaG039448 | AT4G19650.1 | 35.887 | 496 | 257 | 10 | 76 | 523 | 90 | 572 | 1.92e-99 | 312 |
MsaG039448 | AT5G45113.1 | 31.294 | 425 | 228 | 9 | 149 | 523 | 1 | 411 | 6.17e-61 | 206 |
MsaG039448 | AT3G60400.1 | 25.451 | 554 | 337 | 18 | 26 | 520 | 10 | 546 | 1.51e-41 | 157 |
Find 103 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
TGGATGAGGTTTCTTGTAAT+TGG | 0.139207 | 7:-89158326 | MsaT039448.1:CDS |
AGAAATGGATTGGGCGTTTA+AGG | 0.166970 | 7:-89157775 | MsaT039448.1:CDS |
CTTAACTCTTGGAGATTTAT+AGG | 0.169215 | 7:+89157548 | None:intergenic |
AAGGGTTCAAATTCGTTAAT+AGG | 0.178407 | 7:+89158732 | None:intergenic |
TGCAGCTTGGGCTTCTTTAA+TGG | 0.216279 | 7:+89158917 | None:intergenic |
TGCTGTAAGTCCAGGGATTC+TGG | 0.230492 | 7:-89158457 | MsaT039448.1:CDS |
ATCCGTCTGGCCTTCAAGTT+TGG | 0.231486 | 7:-89157407 | MsaT039448.1:CDS |
CAAACCCAAACTCTCGAAAA+AGG | 0.236170 | 7:+89158713 | None:intergenic |
GGATGAGGTTTCTTGTAATT+GGG | 0.245427 | 7:-89158325 | MsaT039448.1:CDS |
TGGTGTTCCTCGATCCAAAA+TGG | 0.255150 | 7:-89158595 | MsaT039448.1:CDS |
TAAATTTGAAAATGGGGTTT+TGG | 0.276379 | 7:-89158541 | MsaT039448.1:CDS |
GATTAAGGCTTATGAAGATT+TGG | 0.277999 | 7:-89158511 | MsaT039448.1:CDS |
GAAATGAAGAACTGGGTTCT+TGG | 0.309862 | 7:-89157903 | MsaT039448.1:CDS |
ATTAAGGCTTATGAAGATTT+GGG | 0.321396 | 7:-89158510 | MsaT039448.1:CDS |
AGGTAAGGGAGCTGAGCTTC+AGG | 0.325160 | 7:-89157745 | MsaT039448.1:CDS |
TTAAGCCTATGGTTGGCTTA+AGG | 0.351833 | 7:-89157872 | MsaT039448.1:CDS |
ATCCTCTTGAAATGAAGAAC+TGG | 0.352452 | 7:-89157911 | MsaT039448.1:CDS |
TTAGGTTGTCAATGTATAAC+TGG | 0.352925 | 7:-89157524 | MsaT039448.1:CDS |
TAAGCCTATGGTTGGCTTAA+GGG | 0.353016 | 7:-89157871 | MsaT039448.1:CDS |
GTTTAGAGAGGGTTTAAGAT+TGG | 0.359706 | 7:+89159010 | None:intergenic |
TCCGTCTGGCCTTCAAGTTT+GGG | 0.365084 | 7:-89157406 | MsaT039448.1:CDS |
ATTATCTGTGCATGCGATAA+TGG | 0.370221 | 7:+89157458 | None:intergenic |
AGGGTTCAAATTCGTTAATA+GGG | 0.372587 | 7:+89158733 | None:intergenic |
GCAACTCTTCCCAAACTTGA+AGG | 0.394707 | 7:+89157397 | None:intergenic |
TACCACAGTCTGTGTAACTA+TGG | 0.396798 | 7:-89158615 | MsaT039448.1:CDS |
ATATTCTAACAATGCAGCTT+GGG | 0.419910 | 7:+89158905 | None:intergenic |
ATTGAGTATCTTGTAAAGAA+AGG | 0.421238 | 7:-89157612 | MsaT039448.1:CDS |
GAGGAAAGACACTCGATGAT+TGG | 0.427453 | 7:-89158197 | MsaT039448.1:CDS |
GACCACGGGGCTGTGAATCC+CGG | 0.428840 | 7:-89157495 | MsaT039448.1:CDS |
GGTGTTCCTCGATCCAAAAT+GGG | 0.437198 | 7:-89158594 | MsaT039448.1:CDS |
TTCTTAATCAGAACACAGAT+AGG | 0.440115 | 7:-89157647 | MsaT039448.1:CDS |
TTCGCTGTGTTGTAAAATCT+AGG | 0.443690 | 7:+89158987 | None:intergenic |
TATGGTTGGCTTAAGGGATC+TGG | 0.446200 | 7:-89157865 | MsaT039448.1:CDS |
GATGAGGTTTCTTGTAATTG+GGG | 0.448648 | 7:-89158324 | MsaT039448.1:CDS |
TGTGGAAAACACGAAAGAAA+TGG | 0.448745 | 7:-89157790 | MsaT039448.1:CDS |
CTTGTTGCGCTTAGGTTATG+TGG | 0.449939 | 7:-89157808 | MsaT039448.1:CDS |
TTGTGCTTGCTTTCGAATGT+TGG | 0.450865 | 7:-89158285 | MsaT039448.1:CDS |
GTTTAAGGCGTTCAGAGGTA+AGG | 0.457273 | 7:-89157760 | MsaT039448.1:CDS |
TGTTAATGTTGAATTTGTTA+AGG | 0.462584 | 7:-89158427 | MsaT039448.1:CDS |
GTTGCTTGAATGTAGGTAAG+AGG | 0.469865 | 7:-89157959 | MsaT039448.1:intron |
TCGCTGTGTTGTAAAATCTA+GGG | 0.474371 | 7:+89158988 | None:intergenic |
CGAGAAACAAGAGGGCAATC+TGG | 0.474907 | 7:+89158144 | None:intergenic |
TATGTAAAACGCCATCCGTC+TGG | 0.479613 | 7:-89157420 | MsaT039448.1:CDS |
GACAACCTAAGCTTAACTCT+TGG | 0.480332 | 7:+89157537 | None:intergenic |
AATCTCCAAGAGTTAAGCTT+AGG | 0.484339 | 7:-89157542 | MsaT039448.1:CDS |
GTAAAATCTAGGGTTTAGAG+AGG | 0.484384 | 7:+89158998 | None:intergenic |
AAAACACGAAAGAAATGGAT+TGG | 0.486098 | 7:-89157785 | MsaT039448.1:CDS |
GATATTCTAACAATGCAGCT+TGG | 0.491273 | 7:+89158904 | None:intergenic |
ACAGAGTTCTTGTTGCGCTT+AGG | 0.497883 | 7:-89157816 | MsaT039448.1:CDS |
TTGATAGTGGTTGGATTCAG+TGG | 0.501005 | 7:-89158356 | MsaT039448.1:CDS |
ACCACGGGGCTGTGAATCCC+GGG | 0.505110 | 7:-89157494 | MsaT039448.1:CDS |
TGGAATAAGAGTTAAGCCTA+TGG | 0.513478 | 7:-89157883 | MsaT039448.1:CDS |
ACCCAGTTCTTCATTTCAAG+AGG | 0.514113 | 7:+89157909 | None:intergenic |
TTGAAGAATATTGTTGCAAA+GGG | 0.516097 | 7:-89158393 | MsaT039448.1:CDS |
GATTTATAGGAAAGATATGA+TGG | 0.516794 | 7:+89157561 | None:intergenic |
TGGTAATTCGCCATCAAAAG+AGG | 0.520777 | 7:+89158633 | None:intergenic |
AATGGTGCTCAAAGCAAGCC+CGG | 0.524340 | 7:+89157476 | None:intergenic |
ATTGTTGCAAAGGGTGGTGA+TGG | 0.524388 | 7:-89158384 | MsaT039448.1:CDS |
AGAAATCGATTAACACGAAA+CGG | 0.527963 | 7:-89158782 | MsaT039448.1:CDS |
TGGCTTAAGGGATCTGGAAG+AGG | 0.530600 | 7:-89157859 | MsaT039448.1:CDS |
AAACACGAAAGAAATGGATT+GGG | 0.533185 | 7:-89157784 | MsaT039448.1:CDS |
GAAGAGGAGAAATCGAGGGT+GGG | 0.535364 | 7:-89157843 | MsaT039448.1:CDS |
ACATCACCAACCAGAATCCC+TGG | 0.536336 | 7:+89158447 | None:intergenic |
ACTGCAAGCTTCTTGTGGAA+TGG | 0.539414 | 7:+89158880 | None:intergenic |
CGAGTTTCCACAGATTTCGA+TGG | 0.543091 | 7:-89158123 | MsaT039448.1:CDS |
CAGTTGGCTGAGATTATTCG+TGG | 0.547737 | 7:-89158249 | MsaT039448.1:CDS |
ATAAGAGTTAAGCCTATGGT+TGG | 0.547914 | 7:-89157879 | MsaT039448.1:CDS |
AGCAAAGATTCATATTCAGA+AGG | 0.550210 | 7:+89158687 | None:intergenic |
AGATCCCTTAAGCCAACCAT+AGG | 0.552682 | 7:+89157867 | None:intergenic |
AAGAATATTGTTGCAAAGGG+TGG | 0.552691 | 7:-89158390 | MsaT039448.1:CDS |
GCGTCTATGTAGCATACTGC+AGG | 0.554692 | 7:-89157937 | MsaT039448.1:CDS |
AAGAGGAGAAATCGAGGGTG+GGG | 0.556838 | 7:-89157842 | MsaT039448.1:CDS |
CGTTAATAGGGTTGTAACGA+AGG | 0.566099 | 7:+89158745 | None:intergenic |
GTTGAAGAATATTGTTGCAA+AGG | 0.570077 | 7:-89158394 | MsaT039448.1:CDS |
AATGCTGTTGCTGTAAGTCC+AGG | 0.570515 | 7:-89158465 | MsaT039448.1:CDS |
TTTAAGGCGTTCAGAGGTAA+GGG | 0.573608 | 7:-89157759 | MsaT039448.1:CDS |
GGAAGAGGAGAAATCGAGGG+TGG | 0.579631 | 7:-89157844 | MsaT039448.1:CDS |
ATAACTGGCTCGTAGACCAC+GGG | 0.581712 | 7:-89157509 | MsaT039448.1:CDS |
TCCCAAACTTGAAGGCCAGA+CGG | 0.582508 | 7:+89157405 | None:intergenic |
CTGAAGACACACCCTCAAGT+TGG | 0.586419 | 7:+89158088 | None:intergenic |
ATCTGGAAGAGGAGAAATCG+AGG | 0.593033 | 7:-89157848 | MsaT039448.1:CDS |
TCCTCTTGAAATGAAGAACT+GGG | 0.593818 | 7:-89157910 | MsaT039448.1:CDS |
TGGGCGTTTAAGGCGTTCAG+AGG | 0.599598 | 7:-89157765 | MsaT039448.1:CDS |
AAACTTGAAGGCCAGACGGA+TGG | 0.607382 | 7:+89157409 | None:intergenic |
TCTTAATCAGAACACAGATA+GGG | 0.611252 | 7:-89157646 | MsaT039448.1:CDS |
TAAAATCTAGGGTTTAGAGA+GGG | 0.617900 | 7:+89158999 | None:intergenic |
TATAACTGGCTCGTAGACCA+CGG | 0.623871 | 7:-89157510 | MsaT039448.1:CDS |
GTAAGTCCAGGGATTCTGGT+TGG | 0.632171 | 7:-89158453 | MsaT039448.1:CDS |
ATGGTGCTCAAAGCAAGCCC+GGG | 0.635036 | 7:+89157477 | None:intergenic |
GTGTTCTGATTAAGAATCTG+AGG | 0.641643 | 7:+89157654 | None:intergenic |
GTGGAAACTCGAGAAACAAG+AGG | 0.644988 | 7:+89158135 | None:intergenic |
TGGTTTCAGTGAGAAACAGT+TGG | 0.649810 | 7:-89158265 | MsaT039448.1:CDS |
TGGAAACTCGAGAAACAAGA+GGG | 0.652528 | 7:+89158136 | None:intergenic |
TAATAGGGTTGTAACGAAGG+TGG | 0.654329 | 7:+89158748 | None:intergenic |
GTGTTCCTCGATCCAAAATG+GGG | 0.658605 | 7:-89158593 | MsaT039448.1:CDS |
CACCATAGTTACACAGACTG+TGG | 0.658934 | 7:+89158613 | None:intergenic |
TCAAAAGAGGATCATCGTTG+AGG | 0.659008 | 7:+89158646 | None:intergenic |
TTGAGGAAAATCAAATCACG+TGG | 0.663073 | 7:+89158663 | None:intergenic |
GCCCGGGATTCACAGCCCCG+TGG | 0.676521 | 7:+89157493 | None:intergenic |
ATGCTGTTGCTGTAAGTCCA+GGG | 0.682252 | 7:-89158464 | MsaT039448.1:CDS |
AACTTGACCATCGAAATCTG+TGG | 0.684694 | 7:+89158116 | None:intergenic |
TCTGGAAGAGGAGAAATCGA+GGG | 0.689277 | 7:-89157847 | MsaT039448.1:CDS |
TAACTGGCTCGTAGACCACG+GGG | 0.784650 | 7:-89157508 | MsaT039448.1:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr7 | gene | 89157368 | 89159093 | 89157368 | ID=MsaG039448 |
Chr7 | mRNA | 89157368 | 89159093 | 89157368 | ID=MsaT039448.1;Parent=MsaG039448 |
Chr7 | exon | 89157368 | 89157966 | 89157368 | ID=MsaT039448.1.exon2;Parent=MsaT039448.1 |
Chr7 | CDS | 89157368 | 89157966 | 89157368 | ID=cds.MsaT039448.1;Parent=MsaT039448.1 |
Chr7 | exon | 89158100 | 89159093 | 89158100 | ID=MsaT039448.1.exon1;Parent=MsaT039448.1 |
Chr7 | CDS | 89158100 | 89159093 | 89158100 | ID=cds.MsaT039448.1;Parent=MsaT039448.1 |
Gene Sequence |
Protein sequence |