Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG039902 | AES79326.2 | 98.802 | 167 | 0 | 1 | 1 | 165 | 1 | 167 | 1.77e-117 | 339 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG039902 | sp|Q8VYK4|NFYB8_ARATH | 74.850 | 167 | 27 | 7 | 1 | 158 | 1 | 161 | 5.75e-78 | 232 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG039902 | tr|G7L4J2|G7L4J2_MEDTR | 98.802 | 167 | 0 | 1 | 1 | 165 | 1 | 167 | 8.43e-118 | 339 |
Gene ID | Type | Classification |
---|---|---|
MsaG039902 | TF | NF-YB |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000412 | MsaG039902 | 0.806552 | 1.319557e-49 | 2.074742e-47 |
MsaG000535 | MsaG039902 | 0.840907 | 1.213713e-57 | 4.874936e-55 |
MsaG000605 | MsaG039902 | 0.837276 | 1.048119e-56 | 3.759615e-54 |
MsaG000707 | MsaG039902 | 0.821622 | 6.436589e-53 | 1.477756e-50 |
MsaG000847 | MsaG039902 | 0.808233 | 5.829381e-50 | 9.539897e-48 |
MsaG000977 | MsaG039902 | 0.807138 | 9.932855e-50 | 1.583428e-47 |
MsaG001939 | MsaG039902 | 0.852216 | 1.022990e-60 | 5.987614e-58 |
MsaG002379 | MsaG039902 | 0.883505 | 9.068313e-71 | 1.932260e-67 |
MsaG002489 | MsaG039902 | 0.826780 | 4.005452e-54 | 1.058528e-51 |
MsaG002603 | MsaG039902 | 0.803479 | 5.755867e-49 | 8.423881e-47 |
MsaG002775 | MsaG039902 | 0.801946 | 1.188622e-48 | 1.679417e-46 |
MsaG002835 | MsaG039902 | 0.833617 | 8.734574e-56 | 2.807780e-53 |
MsaG003384 | MsaG039902 | 0.803811 | 4.915906e-49 | 7.250022e-47 |
MsaG003861 | MsaG039902 | 0.825554 | 7.813875e-54 | 1.995815e-51 |
MsaG004107 | MsaG039902 | 0.807855 | 7.012277e-50 | 1.137194e-47 |
MsaG004441 | MsaG039902 | 0.807239 | 9.458026e-50 | 1.511322e-47 |
MsaG004452 | MsaG039902 | 0.813392 | 4.515161e-51 | 8.382638e-49 |
MsaG004514 | MsaG039902 | 0.867329 | 2.986868e-65 | 3.099797e-62 |
MsaG004568 | MsaG039902 | 0.813148 | 5.104939e-51 | 9.419765e-49 |
MsaG004811 | MsaG039902 | 0.829180 | 1.066337e-54 | 3.014208e-52 |
MsaG004918 | MsaG039902 | 0.800073 | 2.857520e-48 | 3.869909e-46 |
MsaG005214 | MsaG039902 | 0.821109 | 8.444958e-53 | 1.912633e-50 |
MsaG005248 | MsaG039902 | 0.805703 | 1.987910e-49 | 3.063491e-47 |
MsaG005410 | MsaG039902 | 0.826520 | 4.617615e-54 | 1.211544e-51 |
MsaG005540 | MsaG039902 | 0.810538 | 1.877181e-50 | 3.248038e-48 |
MsaG005869 | MsaG039902 | 0.818150 | 3.969821e-52 | 8.318291e-50 |
MsaG006122 | MsaG039902 | 0.821762 | 5.978761e-53 | 1.377716e-50 |
MsaG006255 | MsaG039902 | 0.837058 | 1.191270e-56 | 4.244978e-54 |
MsaG006314 | MsaG039902 | 0.802545 | 8.960379e-49 | 1.283495e-46 |
MsaG006924 | MsaG039902 | 0.804457 | 3.611558e-49 | 5.406760e-47 |
MsaG007139 | MsaG039902 | 0.804517 | 3.509823e-49 | 5.261763e-47 |
MsaG007182 | MsaG039902 | 0.824038 | 1.773092e-53 | 4.344850e-51 |
MsaG008029 | MsaG039902 | 0.814096 | 3.165184e-51 | 5.980970e-49 |
MsaG008619 | MsaG039902 | 0.824297 | 1.542046e-53 | 3.805472e-51 |
MsaG009726 | MsaG039902 | 0.801944 | 1.189367e-48 | 1.680409e-46 |
MsaG011472 | MsaG039902 | 0.811856 | 9.748652e-51 | 1.742120e-48 |
MsaG012163 | MsaG039902 | 0.822729 | 3.574322e-53 | 8.453464e-51 |
MsaG012308 | MsaG039902 | 0.823876 | 1.934655e-53 | 4.719755e-51 |
MsaG012723 | MsaG039902 | 0.812928 | 5.702124e-51 | 1.046413e-48 |
MsaG014815 | MsaG039902 | 0.805433 | 2.262737e-49 | 3.465107e-47 |
MsaG015371 | MsaG039902 | 0.804997 | 2.789056e-49 | 4.228157e-47 |
MsaG015871 | MsaG039902 | 0.822860 | 3.332720e-53 | 7.910033e-51 |
MsaG016209 | MsaG039902 | 0.815263 | 1.750305e-51 | 3.406130e-49 |
MsaG016327 | MsaG039902 | 0.847288 | 2.399264e-59 | 1.186318e-56 |
MsaG016471 | MsaG039902 | 0.822901 | 3.260404e-53 | 7.746904e-51 |
MsaG016772 | MsaG039902 | 0.834283 | 5.958611e-56 | 1.953583e-53 |
MsaG017009 | MsaG039902 | 0.864070 | 3.154443e-64 | 2.871614e-61 |
MsaG016980 | MsaG039902 | 0.806008 | 1.716076e-49 | 2.663507e-47 |
MsaG017051 | MsaG039902 | 0.807070 | 1.026830e-49 | 1.634270e-47 |
MsaG017109 | MsaG039902 | 0.823141 | 2.868058e-53 | 6.858894e-51 |
MsaG017431 | MsaG039902 | 0.836883 | 1.319871e-56 | 4.678257e-54 |
MsaG017644 | MsaG039902 | 0.838135 | 6.325995e-57 | 2.329767e-54 |
MsaG017699 | MsaG039902 | 0.816692 | 8.426965e-52 | 1.700579e-49 |
MsaG017719 | MsaG039902 | 0.806398 | 1.421902e-49 | 2.227536e-47 |
MsaG017828 | MsaG039902 | 0.820170 | 1.384189e-52 | 3.058226e-50 |
MsaG017954 | MsaG039902 | 0.822644 | 3.740202e-53 | 8.825238e-51 |
MsaG017983 | MsaG039902 | 0.820380 | 1.239546e-52 | 2.753838e-50 |
MsaG018025 | MsaG039902 | 0.843997 | 1.855512e-58 | 8.225816e-56 |
MsaG018078 | MsaG039902 | 0.803728 | 5.114024e-49 | 7.527884e-47 |
MsaG018116 | MsaG039902 | 0.815505 | 1.547403e-51 | 3.029618e-49 |
MsaG018223 | MsaG039902 | 0.801737 | 1.311419e-48 | 1.844135e-46 |
MsaG018269 | MsaG039902 | 0.829285 | 1.006005e-54 | 2.852255e-52 |
MsaG019120 | MsaG039902 | 0.829270 | 1.014188e-54 | 2.874208e-52 |
MsaG019171 | MsaG039902 | 0.800141 | 2.768529e-48 | 3.755077e-46 |
MsaG019526 | MsaG039902 | 0.832918 | 1.301682e-55 | 4.099340e-53 |
MsaG019649 | MsaG039902 | 0.888794 | 9.411566e-73 | 2.605280e-69 |
MsaG019770 | MsaG039902 | 0.802225 | 1.041838e-48 | 1.481419e-46 |
MsaG019910 | MsaG039902 | 0.810603 | 1.817590e-50 | 3.149859e-48 |
MsaG019907 | MsaG039902 | 0.803512 | 5.667082e-49 | 8.300232e-47 |
MsaG020371 | MsaG039902 | 0.819699 | 1.772401e-52 | 3.866972e-50 |
MsaG020430 | MsaG039902 | 0.806281 | 1.504041e-49 | 2.349758e-47 |
MsaG020550 | MsaG039902 | 0.863507 | 4.711070e-64 | 4.194605e-61 |
MsaG020733 | MsaG039902 | 0.819263 | 2.224884e-52 | 4.799387e-50 |
MsaG021683 | MsaG039902 | 0.834893 | 4.194880e-56 | 1.400641e-53 |
MsaG021693 | MsaG039902 | 0.850494 | 3.120148e-60 | 1.720062e-57 |
MsaG023188 | MsaG039902 | 0.803859 | 4.805112e-49 | 7.094473e-47 |
MsaG023563 | MsaG039902 | 0.819743 | 1.731896e-52 | 3.782932e-50 |
MsaG023626 | MsaG039902 | 0.828636 | 1.442201e-54 | 4.014900e-52 |
MsaG023649 | MsaG039902 | 0.812659 | 6.524975e-51 | 1.189404e-48 |
MsaG023861 | MsaG039902 | 0.801954 | 1.184220e-48 | 1.673490e-46 |
MsaG026607 | MsaG039902 | 0.823113 | 2.912305e-53 | 6.959352e-51 |
MsaG026686 | MsaG039902 | 0.849018 | 8.027986e-60 | 4.207881e-57 |
MsaG026786 | MsaG039902 | 0.852630 | 7.805472e-61 | 4.635351e-58 |
MsaG027198 | MsaG039902 | 0.822922 | 3.224091e-53 | 7.664920e-51 |
MsaG027210 | MsaG039902 | 0.803137 | 6.768393e-49 | 9.827998e-47 |
MsaG027376 | MsaG039902 | 0.826877 | 3.798206e-54 | 1.006515e-51 |
MsaG027483 | MsaG039902 | 0.806423 | 1.404477e-49 | 2.201594e-47 |
MsaG027885 | MsaG039902 | 0.825994 | 6.153063e-54 | 1.590991e-51 |
MsaG028277 | MsaG039902 | 0.856969 | 4.368230e-62 | 3.031312e-59 |
MsaG028450 | MsaG039902 | 0.851108 | 2.100787e-60 | 1.182905e-57 |
MsaG028531 | MsaG039902 | 0.843509 | 2.503133e-58 | 1.092567e-55 |
MsaG028658 | MsaG039902 | 0.852426 | 8.920641e-61 | 5.260192e-58 |
MsaG029546 | MsaG039902 | 0.807720 | 7.487772e-50 | 1.210379e-47 |
MsaG029953 | MsaG039902 | 0.825021 | 1.043248e-53 | 2.625885e-51 |
MsaG031248 | MsaG039902 | 0.837869 | 7.398236e-57 | 2.702396e-54 |
MsaG032616 | MsaG039902 | 0.800033 | 2.911612e-48 | 3.939602e-46 |
MsaG032901 | MsaG039902 | 0.843809 | 2.082259e-58 | 9.175853e-56 |
MsaG033309 | MsaG039902 | 0.838879 | 4.074742e-57 | 1.535924e-54 |
MsaG033991 | MsaG039902 | 0.806865 | 1.134066e-49 | 1.796227e-47 |
MsaG034047 | MsaG039902 | 0.864748 | 1.940808e-64 | 1.815205e-61 |
MsaG034217 | MsaG039902 | 0.806462 | 1.378597e-49 | 2.163025e-47 |
MsaG039468 | MsaG039902 | 0.806192 | 1.570381e-49 | 2.448166e-47 |
MsaG039902 | MsaG039981 | 0.813567 | 4.133872e-51 | 7.708675e-49 |
MsaG039902 | MsaG040013 | 0.800644 | 2.189117e-48 | 3.003230e-46 |
MsaG039902 | MsaG040134 | 0.815176 | 1.829180e-51 | 3.551686e-49 |
MsaG039902 | MsaG040270 | 0.819769 | 1.708177e-52 | 3.733764e-50 |
MsaG039902 | MsaG040504 | 0.809372 | 3.336025e-50 | 5.611193e-48 |
MsaG039902 | MsaG040569 | 0.837836 | 7.544341e-57 | 2.752971e-54 |
MsaG039902 | MsaG040713 | 0.804834 | 3.016062e-49 | 4.555036e-47 |
MsaG039902 | MsaG041237 | 0.828600 | 1.471054e-54 | 4.091158e-52 |
MsaG039902 | MsaG041721 | 0.853747 | 3.749391e-61 | 2.316334e-58 |
MsaG039902 | MsaG041800 | 0.841589 | 8.045950e-58 | 3.302358e-55 |
MsaG039902 | MsaG043371 | 0.821998 | 5.274600e-53 | 1.223139e-50 |
MsaG039902 | MsaG043817 | 0.816055 | 1.168128e-51 | 2.319245e-49 |
MsaG039902 | MsaG044200 | 0.861694 | 1.692680e-63 | 1.403778e-60 |
MsaG039902 | MsaG044661 | 0.820126 | 1.416324e-52 | 3.125532e-50 |
MsaG039902 | MsaG044808 | 0.817839 | 4.665551e-52 | 9.697603e-50 |
MsaG039902 | MsaG045276 | 0.829558 | 8.639414e-55 | 2.468935e-52 |
MsaG039902 | MsaG045284 | 0.810341 | 2.068717e-50 | 3.562445e-48 |
MsaG039902 | MsaG045832 | 0.804745 | 3.148190e-49 | 4.744627e-47 |
MsaG039902 | MsaG046155 | 0.826368 | 5.017310e-54 | 1.310845e-51 |
MsaG039902 | MsaG046173 | 0.826529 | 4.594575e-54 | 1.205792e-51 |
MsaG039902 | MsaG046266 | 0.878928 | 3.966390e-69 | 6.813823e-66 |
MsaG039902 | MsaG046306 | 0.852007 | 1.172239e-60 | 6.811835e-58 |
MsaG039902 | MsaG046364 | 0.834561 | 5.080186e-56 | 1.679452e-53 |
MsaG039902 | MsaG046436 | 0.812764 | 6.188521e-51 | 1.131042e-48 |
MsaG039902 | MsaG046501 | 0.813621 | 4.022996e-51 | 7.511904e-49 |
MsaG039902 | MsaG046503 | 0.838353 | 5.559966e-57 | 2.061497e-54 |
MsaG039902 | MsaG046603 | 0.854827 | 1.834619e-61 | 1.177865e-58 |
MsaG039902 | MsaG047097 | 0.831761 | 2.509176e-55 | 7.640754e-53 |
MsaG039902 | MsaG002309 | 0.826127 | 5.721725e-54 | 1.484981e-51 |
MsaG039902 | MsaG001949 | 0.816792 | 8.002749e-52 | 1.619182e-49 |
MsaG039902 | MsaG003540 | 0.810125 | 2.302035e-50 | 3.943151e-48 |
MsaG039902 | MsaG005167 | 0.802518 | 9.072584e-49 | 1.298787e-46 |
MsaG039902 | MsaG002617 | 0.805205 | 2.524984e-49 | 3.846320e-47 |
MsaG039902 | MsaG007986 | 0.804558 | 3.441914e-49 | 5.164896e-47 |
MsaG039902 | MsaG012344 | 0.832796 | 1.394809e-55 | 4.376827e-53 |
MsaG039902 | MsaG012729 | 0.813021 | 5.439997e-51 | 1.000663e-48 |
MsaG039902 | MsaG014052 | 0.855018 | 1.615671e-61 | 1.044414e-58 |
MsaG039902 | MsaG023179 | 0.802750 | 8.130136e-49 | 1.170023e-46 |
MsaG039902 | MsaG020399 | 0.811180 | 1.364864e-50 | 2.398916e-48 |
MsaG039902 | MsaG020128 | 0.801886 | 1.222437e-48 | 1.724902e-46 |
MsaG039902 | MsaG022828 | 0.825411 | 8.444285e-54 | 2.148287e-51 |
MsaG039902 | MsaG027639 | 0.806095 | 1.645683e-49 | 2.559625e-47 |
MsaG039902 | MsaG026803 | 0.803199 | 6.574475e-49 | 9.560018e-47 |
MsaG039902 | MsaG033602 | 0.816212 | 1.077721e-51 | 2.148391e-49 |
MsaG039902 | MsaG033146 | 0.819303 | 2.180032e-52 | 4.707393e-50 |
MsaG039902 | MsaG031662 | 0.839794 | 2.363453e-57 | 9.166977e-55 |
MsaG039902 | MsaG031186 | 0.812827 | 5.995952e-51 | 1.097580e-48 |
MsaG039902 | MsaG033082 | 0.810432 | 1.977897e-50 | 3.413596e-48 |
MsaG039902 | MsaG032525 | 0.821702 | 6.172086e-53 | 1.420029e-50 |
MsaG039902 | MsaG032799 | 0.842973 | 3.473641e-58 | 1.490283e-55 |
MsaG039902 | MsaG032718 | 0.826785 | 3.995944e-54 | 1.056133e-51 |
MsaG039902 | MsaG032252 | 0.802408 | 9.557929e-49 | 1.364815e-46 |
MsaG039902 | MsaG031847 | 0.821865 | 5.659527e-53 | 1.307761e-50 |
MsaG039902 | MsaG033259 | 0.821269 | 7.761749e-53 | 1.765418e-50 |
MsaG039902 | MsaG030744 | 0.804382 | 3.744364e-49 | 5.595864e-47 |
MsaG039902 | MsaG036760 | 0.819371 | 2.102899e-52 | 4.549086e-50 |
MsaG039902 | MsaG038885 | 0.836378 | 1.772618e-56 | 6.188552e-54 |
MsaG039902 | MsaG036286 | 0.815880 | 1.277230e-51 | 2.524662e-49 |
MsaG039902 | MsaG035600 | 0.812095 | 8.651872e-51 | 1.555156e-48 |
MsaG039902 | MsaG037155 | 0.876870 | 2.063583e-68 | 3.226048e-65 |
MsaG039902 | MsaG037531 | 0.828472 | 1.579375e-54 | 4.376792e-52 |
MsaG039902 | MsaG036685 | 0.807234 | 9.482442e-50 | 1.515025e-47 |
MsaG039902 | MsaG039797 | 0.813338 | 4.639200e-51 | 8.601145e-49 |
MsaG039902 | MsaG035545 | 0.878183 | 7.234368e-69 | 1.200812e-65 |
MsaG039902 | MsaG036758 | 0.813570 | 4.128058e-51 | 7.698325e-49 |
MsaG039902 | MsaG043366 | 0.821184 | 8.115426e-53 | 1.841730e-50 |
MsaG039902 | MsaG041727 | 0.816362 | 9.982248e-52 | 1.997505e-49 |
MsaG039902 | MsaG041442 | 0.833238 | 1.084408e-55 | 3.447472e-53 |
MsaG039902 | MsaG044977 | 0.808337 | 5.541050e-50 | 9.090568e-48 |
MsaG039902 | MsaG044531 | 0.802393 | 9.627351e-49 | 1.374248e-46 |
MsaG039902 | MsaG042876 | 0.858514 | 1.528146e-62 | 1.123377e-59 |
MsaG039902 | MsaG043822 | 0.851634 | 1.493857e-60 | 8.565975e-58 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG039902 | MtrunA17_Chr7g0263601 | 98.742 | 159 | 0 | 1 | 1 | 157 | 1 | 159 | 3.81e-115 | 323 |
MsaG039902 | MtrunA17_Chr1g0185911 | 74.675 | 154 | 28 | 4 | 12 | 158 | 11 | 160 | 4.06e-76 | 224 |
MsaG039902 | MtrunA17_Chr3g0102351 | 72.308 | 130 | 27 | 3 | 9 | 137 | 13 | 134 | 2.48e-59 | 182 |
MsaG039902 | MtrunA17_Chr2g0290491 | 71.311 | 122 | 26 | 1 | 1 | 122 | 1 | 113 | 2.75e-59 | 182 |
MsaG039902 | MtrunA17_Chr5g0446491 | 72.951 | 122 | 27 | 2 | 10 | 129 | 9 | 126 | 4.37e-58 | 179 |
MsaG039902 | MtrunA17_Chr8g0382931 | 78.095 | 105 | 23 | 0 | 11 | 115 | 13 | 117 | 3.08e-56 | 175 |
MsaG039902 | MtrunA17_Chr8g0384451 | 79.121 | 91 | 19 | 0 | 25 | 115 | 39 | 129 | 7.18e-53 | 167 |
MsaG039902 | MtrunA17_Chr4g0076321 | 70.588 | 102 | 30 | 0 | 14 | 115 | 7 | 108 | 1.15e-48 | 154 |
MsaG039902 | MtrunA17_Chr1g0195851 | 69.792 | 96 | 29 | 0 | 24 | 119 | 34 | 129 | 1.77e-48 | 155 |
MsaG039902 | MtrunA17_Chr2g0296321 | 55.372 | 121 | 49 | 1 | 24 | 144 | 64 | 179 | 2.90e-47 | 154 |
MsaG039902 | MtrunA17_Chr4g0076381 | 50.704 | 142 | 68 | 1 | 24 | 163 | 56 | 197 | 6.92e-47 | 152 |
MsaG039902 | MtrunA17_Chr4g0067091 | 62.617 | 107 | 38 | 1 | 9 | 115 | 7 | 111 | 7.15e-46 | 149 |
MsaG039902 | MtrunA17_Chr1g0165041 | 64.894 | 94 | 33 | 0 | 24 | 117 | 4 | 97 | 1.23e-45 | 148 |
MsaG039902 | MtrunA17_Chr1g0191981 | 46.667 | 120 | 62 | 1 | 26 | 143 | 4 | 123 | 4.01e-37 | 124 |
MsaG039902 | MtrunA17_Chr1g0159271 | 50.000 | 82 | 41 | 0 | 40 | 121 | 1 | 82 | 9.11e-25 | 92.4 |
MsaG039902 | MtrunA17_Chr5g0446601 | 40.741 | 108 | 63 | 1 | 14 | 120 | 11 | 118 | 2.63e-21 | 85.9 |
MsaG039902 | MtrunA17_Chr1g0158951 | 44.565 | 92 | 38 | 1 | 56 | 134 | 19 | 110 | 8.35e-20 | 79.7 |
MsaG039902 | MtrunA17_Chr2g0307551 | 32.110 | 109 | 74 | 0 | 27 | 135 | 12 | 120 | 1.18e-18 | 78.2 |
MsaG039902 | MtrunA17_Chr1g0159291 | 40.789 | 76 | 45 | 0 | 31 | 106 | 7 | 82 | 1.63e-18 | 75.9 |
MsaG039902 | MtrunA17_Chr4g0062271 | 32.039 | 103 | 70 | 0 | 27 | 129 | 12 | 114 | 4.29e-16 | 71.2 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG039902 | AT2G37060.2 | 74.850 | 167 | 27 | 7 | 1 | 158 | 1 | 161 | 5.85e-79 | 232 |
MsaG039902 | AT2G37060.3 | 74.850 | 167 | 27 | 7 | 1 | 158 | 1 | 161 | 5.85e-79 | 232 |
MsaG039902 | AT2G37060.1 | 74.850 | 167 | 27 | 7 | 1 | 158 | 1 | 161 | 5.85e-79 | 232 |
MsaG039902 | AT3G53340.5 | 77.551 | 147 | 26 | 4 | 17 | 157 | 19 | 164 | 5.99e-76 | 224 |
MsaG039902 | AT3G53340.1 | 77.551 | 147 | 26 | 4 | 17 | 157 | 19 | 164 | 5.99e-76 | 224 |
MsaG039902 | AT2G38880.7 | 76.923 | 130 | 25 | 1 | 1 | 130 | 1 | 125 | 1.01e-70 | 210 |
MsaG039902 | AT2G38880.3 | 75.758 | 132 | 25 | 2 | 1 | 130 | 1 | 127 | 8.04e-69 | 205 |
MsaG039902 | AT2G38880.2 | 75.758 | 132 | 25 | 2 | 1 | 130 | 1 | 127 | 1.07e-68 | 205 |
MsaG039902 | AT2G38880.1 | 75.758 | 132 | 25 | 2 | 1 | 130 | 1 | 127 | 1.07e-68 | 205 |
MsaG039902 | AT2G38880.5 | 75.758 | 132 | 25 | 2 | 1 | 130 | 1 | 127 | 1.07e-68 | 205 |
MsaG039902 | AT3G53340.3 | 85.849 | 106 | 14 | 1 | 17 | 121 | 19 | 124 | 2.67e-65 | 197 |
MsaG039902 | AT3G53340.2 | 85.849 | 106 | 14 | 1 | 17 | 121 | 19 | 124 | 2.67e-65 | 197 |
MsaG039902 | AT2G38880.11 | 64.516 | 155 | 25 | 2 | 1 | 130 | 1 | 150 | 9.89e-65 | 196 |
MsaG039902 | AT2G38880.8 | 64.516 | 155 | 25 | 2 | 1 | 130 | 1 | 150 | 9.89e-65 | 196 |
MsaG039902 | AT2G38880.4 | 79.130 | 115 | 19 | 1 | 1 | 115 | 1 | 110 | 1.54e-64 | 193 |
MsaG039902 | AT2G38880.9 | 79.130 | 115 | 19 | 1 | 1 | 115 | 1 | 110 | 4.50e-64 | 194 |
MsaG039902 | AT2G38880.10 | 79.130 | 115 | 19 | 1 | 1 | 115 | 1 | 110 | 4.50e-64 | 194 |
MsaG039902 | AT2G38880.6 | 79.130 | 115 | 19 | 1 | 1 | 115 | 1 | 110 | 4.50e-64 | 194 |
MsaG039902 | AT3G53340.4 | 89.000 | 100 | 10 | 1 | 17 | 115 | 19 | 118 | 5.68e-64 | 192 |
MsaG039902 | AT4G14540.1 | 80.952 | 105 | 18 | 1 | 13 | 115 | 6 | 110 | 1.68e-59 | 182 |
MsaG039902 | AT5G47640.1 | 85.714 | 91 | 13 | 0 | 25 | 115 | 26 | 116 | 1.69e-56 | 176 |
MsaG039902 | AT2G13570.1 | 79.167 | 96 | 18 | 1 | 25 | 120 | 35 | 128 | 3.46e-54 | 171 |
MsaG039902 | AT2G47810.1 | 65.741 | 108 | 34 | 2 | 24 | 128 | 49 | 156 | 2.65e-47 | 151 |
MsaG039902 | AT5G47670.2 | 61.682 | 107 | 39 | 1 | 24 | 128 | 27 | 133 | 1.54e-46 | 151 |
MsaG039902 | AT5G47670.1 | 61.682 | 107 | 39 | 1 | 24 | 128 | 56 | 162 | 3.85e-46 | 151 |
MsaG039902 | AT5G47670.3 | 61.682 | 107 | 39 | 1 | 24 | 128 | 56 | 162 | 3.85e-46 | 151 |
MsaG039902 | AT1G21970.1 | 51.538 | 130 | 59 | 2 | 1 | 126 | 31 | 160 | 2.84e-45 | 149 |
MsaG039902 | AT1G09030.1 | 50.000 | 134 | 56 | 3 | 26 | 148 | 3 | 136 | 6.11e-43 | 140 |
MsaG039902 | AT5G23090.4 | 35.644 | 101 | 59 | 2 | 27 | 123 | 12 | 110 | 1.93e-17 | 75.1 |
MsaG039902 | AT5G08190.2 | 34.653 | 101 | 60 | 2 | 27 | 123 | 12 | 110 | 7.29e-17 | 73.9 |
MsaG039902 | AT5G08190.1 | 37.500 | 80 | 50 | 0 | 27 | 106 | 12 | 91 | 9.92e-17 | 73.6 |
MsaG039902 | AT5G23090.5 | 38.462 | 78 | 48 | 0 | 27 | 104 | 12 | 89 | 1.68e-16 | 72.8 |
MsaG039902 | AT5G23090.2 | 38.462 | 78 | 48 | 0 | 27 | 104 | 12 | 89 | 1.68e-16 | 72.8 |
MsaG039902 | AT5G23090.1 | 38.462 | 78 | 48 | 0 | 27 | 104 | 12 | 89 | 1.68e-16 | 72.8 |
MsaG039902 | AT5G23090.3 | 38.710 | 62 | 38 | 0 | 43 | 104 | 15 | 76 | 7.01e-12 | 60.5 |
Find 45 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
CTTTGGGCGATGGCTACTTT+AGG | 0.202896 | 7:+94308087 | MsaT039902.1:CDS |
AACGGTTTCCTTAGCATCTT+TGG | 0.251977 | 7:-94307888 | None:intergenic |
TTTGGGCGATGGCTACTTTA+GGG | 0.280322 | 7:+94308088 | MsaT039902.1:CDS |
CTTTCGTGGCTGCCGCCGCC+AGG | 0.317211 | 7:-94307758 | None:intergenic |
GCCAGGACTCGCCGGAGTTT+CGG | 0.338910 | 7:-94307741 | None:intergenic |
TAACGGTGATGATTTGCTTT+GGG | 0.394165 | 7:+94308071 | MsaT039902.1:CDS |
GCCAGATGTGTCTCCACCCT+TGG | 0.406781 | 7:-94308709 | None:intergenic |
TCCGAAACTCCGGCGAGTCC+TGG | 0.416968 | 7:+94307740 | MsaT039902.1:CDS |
TTAACGGTGATGATTTGCTT+TGG | 0.430649 | 7:+94308070 | MsaT039902.1:CDS |
GGTGTTTCAGGGTGATACTA+AGG | 0.432945 | 7:+94308680 | MsaT039902.1:intron |
AGATGCTAAGGAAACCGTTC+AGG | 0.443640 | 7:+94307892 | MsaT039902.1:CDS |
GAGAAGAGGAAGACGATTAA+CGG | 0.446276 | 7:+94308054 | MsaT039902.1:CDS |
GACTGTGTTCGCCGCTTTCG+TGG | 0.449949 | 7:-94307772 | None:intergenic |
GATGGCTACTTTAGGGTTTG+AGG | 0.453692 | 7:+94308095 | MsaT039902.1:CDS |
GCCAAGGGTGGAGACACATC+TGG | 0.461100 | 7:+94308708 | MsaT039902.1:CDS |
ACGGTCTTGTTCACGGATGT+TGG | 0.478749 | 7:-94307801 | None:intergenic |
TAACCTCTCTGTATCTTGTA+AGG | 0.479347 | 7:-94308143 | None:intergenic |
TGATGATTTGCTTTGGGCGA+TGG | 0.479911 | 7:+94308077 | MsaT039902.1:CDS |
CATCAAGGTTCTTTCTCACA+AGG | 0.487515 | 7:+94308886 | MsaT039902.1:CDS |
CTGCCGCCGCCAGGACTCGC+CGG | 0.499622 | 7:-94307749 | None:intergenic |
TGTTTCCTACACAAATTCTC+AGG | 0.502672 | 7:+94308909 | MsaT039902.1:CDS |
AAATTGCAGCTTGTTCATCA+AGG | 0.514442 | 7:+94308871 | MsaT039902.1:intron |
TGATACTAAGGGCTCTGCCA+AGG | 0.527179 | 7:+94308692 | MsaT039902.1:CDS |
CACTACTCTCTAAAATGCTA+AGG | 0.528875 | 7:+94308935 | MsaT039902.1:CDS |
TCAACAAGGTTCTAATCCTC+AGG | 0.530968 | 7:+94308743 | MsaT039902.1:CDS |
GAAGGAAACGGTCTTGTTCA+CGG | 0.533282 | 7:-94307808 | None:intergenic |
GGCGGCGGCAGCCACGAAAG+CGG | 0.544156 | 7:+94307761 | MsaT039902.1:CDS |
GATACTAAGGGCTCTGCCAA+GGG | 0.547138 | 7:+94308693 | MsaT039902.1:CDS |
CGACGATATGTCCGAAACTC+CGG | 0.548200 | 7:+94307730 | None:intergenic |
CTTGTAAGGTAAATCTTAAG+AGG | 0.551310 | 7:-94308129 | None:intergenic |
GTGTTTCAGGGTGATACTAA+GGG | 0.557727 | 7:+94308681 | MsaT039902.1:intron |
ACTCCGGCGAGTCCTGGCGG+CGG | 0.562769 | 7:+94307746 | MsaT039902.1:CDS |
TGTTAGCGATAGGAAGGAAA+CGG | 0.567517 | 7:-94307820 | None:intergenic |
TAAAATCGCCAAAGATGCTA+AGG | 0.569776 | 7:+94307880 | MsaT039902.1:CDS |
ATAAGTGTCAGAGAGAGAAG+AGG | 0.595900 | 7:+94308040 | MsaT039902.1:CDS |
GGTGATGAAGCTGATGAACT+CGG | 0.601461 | 7:-94307924 | None:intergenic |
GGCTGATGTTAGCGATAGGA+AGG | 0.601546 | 7:-94307826 | None:intergenic |
CTCTCTCTGACACTTATCAG+AGG | 0.607674 | 7:-94308034 | None:intergenic |
CTCGGAGACACATTCCTGAA+CGG | 0.614495 | 7:-94307906 | None:intergenic |
ACTAAGGGCTCTGCCAAGGG+TGG | 0.614551 | 7:+94308696 | MsaT039902.1:CDS |
ATGCGGCTGATGTTAGCGAT+AGG | 0.621968 | 7:-94307830 | None:intergenic |
GAAACTCCGGCGAGTCCTGG+CGG | 0.650343 | 7:+94307743 | MsaT039902.1:CDS |
TGTTACCTGAGAATTTGTGT+AGG | 0.662155 | 7:-94308914 | None:intergenic |
TGTTCACGGATGTTGGAACG+AGG | 0.689840 | 7:-94307794 | None:intergenic |
TTACCTTACAAGATACAGAG+AGG | 0.715766 | 7:+94308140 | MsaT039902.1:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr7 | gene | 94307737 | 94308969 | 94307737 | ID=MsaG039902 |
Chr7 | mRNA | 94307737 | 94308969 | 94307737 | ID=MsaT039902.1;Parent=MsaG039902 |
Chr7 | exon | 94307737 | 94307951 | 94307737 | ID=MsaT039902.1.exon1;Parent=MsaT039902.1 |
Chr7 | CDS | 94307737 | 94307951 | 94307737 | ID=cds.MsaT039902.1;Parent=MsaT039902.1 |
Chr7 | exon | 94308032 | 94308161 | 94308032 | ID=MsaT039902.1.exon2;Parent=MsaT039902.1 |
Chr7 | CDS | 94308032 | 94308161 | 94308032 | ID=cds.MsaT039902.1;Parent=MsaT039902.1 |
Chr7 | exon | 94308690 | 94308764 | 94308690 | ID=MsaT039902.1.exon3;Parent=MsaT039902.1 |
Chr7 | CDS | 94308690 | 94308764 | 94308690 | ID=cds.MsaT039902.1;Parent=MsaT039902.1 |
Chr7 | exon | 94308880 | 94308969 | 94308880 | ID=MsaT039902.1.exon4;Parent=MsaT039902.1 |
Chr7 | CDS | 94308880 | 94308969 | 94308880 | ID=cds.MsaT039902.1;Parent=MsaT039902.1 |
Gene Sequence |
Protein sequence |