Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG040187 | XP_013450172.1 | 97.561 | 287 | 6 | 1 | 1 | 286 | 1 | 287 | 0.0 | 558 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG040187 | sp|Q9FMC8|OPF13_ARATH | 40.079 | 252 | 111 | 13 | 1 | 222 | 1 | 242 | 2.32e-39 | 141 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG040187 | tr|G7ZUW4|G7ZUW4_MEDTR | 97.561 | 287 | 6 | 1 | 1 | 286 | 1 | 287 | 0.0 | 558 |
Gene ID | Type | Classification |
---|---|---|
MsaG040187 | TF | OFP |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000193 | MsaG040187 | 0.844440 | 1.412742e-58 | 6.355255e-56 |
MsaG000281 | MsaG040187 | 0.824293 | 1.545643e-53 | 3.813825e-51 |
MsaG000382 | MsaG040187 | 0.812014 | 9.008512e-51 | 1.616105e-48 |
MsaG000431 | MsaG040187 | 0.816171 | 1.100588e-51 | 2.191689e-49 |
MsaG000832 | MsaG040187 | 0.808762 | 4.501185e-50 | 7.460734e-48 |
MsaG000855 | MsaG040187 | 0.803726 | 5.118592e-49 | 7.534312e-47 |
MsaG001086 | MsaG040187 | 0.805891 | 1.815268e-49 | 2.809862e-47 |
MsaG001237 | MsaG040187 | 0.859214 | 9.460274e-63 | 7.139235e-60 |
MsaG001531 | MsaG040187 | 0.824577 | 1.326155e-53 | 3.297612e-51 |
MsaG001672 | MsaG040187 | 0.818667 | 3.036403e-52 | 6.447964e-50 |
MsaG001859 | MsaG040187 | 0.802579 | 8.816077e-49 | 1.263820e-46 |
MsaG002013 | MsaG040187 | 0.815549 | 1.512378e-51 | 2.964499e-49 |
MsaG002866 | MsaG040187 | 0.854632 | 2.087905e-61 | 1.331209e-58 |
MsaG002973 | MsaG040187 | 0.821477 | 6.950656e-53 | 1.589632e-50 |
MsaG003210 | MsaG040187 | 0.820353 | 1.257328e-52 | 2.791402e-50 |
MsaG003187 | MsaG040187 | 0.830262 | 5.830156e-55 | 1.699999e-52 |
MsaG003200 | MsaG040187 | 0.824453 | 1.418030e-53 | 3.514216e-51 |
MsaG003201 | MsaG040187 | 0.828102 | 1.937207e-54 | 5.312786e-52 |
MsaG003202 | MsaG040187 | 0.823947 | 1.862314e-53 | 4.551981e-51 |
MsaG003203 | MsaG040187 | 0.815669 | 1.422951e-51 | 2.797705e-49 |
MsaG003389 | MsaG040187 | 0.808645 | 4.766446e-50 | 7.878189e-48 |
MsaG003394 | MsaG040187 | 0.817218 | 6.428849e-52 | 1.315137e-49 |
MsaG003683 | MsaG040187 | 0.830208 | 6.008754e-55 | 1.749392e-52 |
MsaG004150 | MsaG040187 | 0.837736 | 8.000770e-57 | 2.910590e-54 |
MsaG004204 | MsaG040187 | 0.856696 | 5.249643e-62 | 3.607373e-59 |
MsaG004301 | MsaG040187 | 0.819011 | 2.538589e-52 | 5.439663e-50 |
MsaG004504 | MsaG040187 | 0.803870 | 4.780076e-49 | 7.059351e-47 |
MsaG005000 | MsaG040187 | 0.818147 | 3.977383e-52 | 8.333318e-50 |
MsaG005442 | MsaG040187 | 0.819949 | 1.554110e-52 | 3.413513e-50 |
MsaG005443 | MsaG040187 | 0.816021 | 1.188871e-51 | 2.358385e-49 |
MsaG005444 | MsaG040187 | 0.817202 | 6.482196e-52 | 1.325487e-49 |
MsaG005506 | MsaG040187 | 0.800654 | 2.179047e-48 | 2.990104e-46 |
MsaG005582 | MsaG040187 | 0.811309 | 1.280301e-50 | 2.257458e-48 |
MsaG005864 | MsaG040187 | 0.829566 | 8.603005e-55 | 2.459019e-52 |
MsaG006044 | MsaG040187 | 0.803267 | 6.363633e-49 | 9.267953e-47 |
MsaG006175 | MsaG040187 | 0.805714 | 1.977311e-49 | 3.047946e-47 |
MsaG006529 | MsaG040187 | 0.805853 | 1.848820e-49 | 2.859195e-47 |
MsaG006902 | MsaG040187 | 0.836175 | 1.995261e-56 | 6.923057e-54 |
MsaG006926 | MsaG040187 | 0.811463 | 1.186115e-50 | 2.099246e-48 |
MsaG007145 | MsaG040187 | 0.807142 | 9.917422e-50 | 1.581110e-47 |
MsaG007168 | MsaG040187 | 0.807778 | 7.277265e-50 | 1.178003e-47 |
MsaG007287 | MsaG040187 | 0.809641 | 2.922822e-50 | 4.948252e-48 |
MsaG007353 | MsaG040187 | 0.824713 | 1.232130e-53 | 3.075174e-51 |
MsaG007387 | MsaG040187 | 0.849350 | 6.497997e-60 | 3.444704e-57 |
MsaG007729 | MsaG040187 | 0.814955 | 2.046658e-51 | 3.951955e-49 |
MsaG008218 | MsaG040187 | 0.808246 | 5.794200e-50 | 9.485353e-48 |
MsaG009138 | MsaG040187 | 0.800680 | 2.152042e-48 | 2.954848e-46 |
MsaG009390 | MsaG040187 | 0.808744 | 4.540365e-50 | 7.522710e-48 |
MsaG009501 | MsaG040187 | 0.856710 | 5.201107e-62 | 3.575915e-59 |
MsaG009504 | MsaG040187 | 0.803081 | 6.951369e-49 | 1.008055e-46 |
MsaG010066 | MsaG040187 | 0.828651 | 1.429885e-54 | 3.982299e-52 |
MsaG010508 | MsaG040187 | 0.807995 | 6.549235e-50 | 1.065681e-47 |
MsaG010517 | MsaG040187 | 0.820611 | 1.097816e-52 | 2.453789e-50 |
MsaG011314 | MsaG040187 | 0.821650 | 6.342853e-53 | 1.457325e-50 |
MsaG011275 | MsaG040187 | 0.835215 | 3.481913e-56 | 1.173801e-53 |
MsaG011357 | MsaG040187 | 0.805934 | 1.778272e-49 | 2.755356e-47 |
MsaG011806 | MsaG040187 | 0.857232 | 3.655114e-62 | 2.561393e-59 |
MsaG012380 | MsaG040187 | 0.824844 | 1.148195e-53 | 2.875978e-51 |
MsaG012944 | MsaG040187 | 0.805873 | 1.831106e-49 | 2.833167e-47 |
MsaG013325 | MsaG040187 | 0.843690 | 2.240279e-58 | 9.835590e-56 |
MsaG013621 | MsaG040187 | 0.828697 | 1.393871e-54 | 3.886953e-52 |
MsaG013644 | MsaG040187 | 0.809988 | 2.463388e-50 | 4.205537e-48 |
MsaG013993 | MsaG040187 | 0.820693 | 1.051668e-52 | 2.355655e-50 |
MsaG014184 | MsaG040187 | 0.811763 | 1.021053e-50 | 1.820468e-48 |
MsaG014439 | MsaG040187 | 0.832282 | 1.868798e-55 | 5.776954e-53 |
MsaG014810 | MsaG040187 | 0.810069 | 2.366333e-50 | 4.047870e-48 |
MsaG014953 | MsaG040187 | 0.813805 | 3.666365e-51 | 6.877893e-49 |
MsaG015176 | MsaG040187 | 0.810002 | 2.446674e-50 | 4.178436e-48 |
MsaG015216 | MsaG040187 | 0.828501 | 1.553648e-54 | 4.308981e-52 |
MsaG015202 | MsaG040187 | 0.800546 | 2.291941e-48 | 3.137290e-46 |
MsaG015269 | MsaG040187 | 0.814542 | 2.525081e-51 | 4.825047e-49 |
MsaG016006 | MsaG040187 | 0.847786 | 1.753482e-59 | 8.816807e-57 |
MsaG016708 | MsaG040187 | 0.804935 | 2.874212e-49 | 4.350842e-47 |
MsaG016821 | MsaG040187 | 0.804406 | 3.700953e-49 | 5.534163e-47 |
MsaG017013 | MsaG040187 | 0.836725 | 1.447655e-56 | 5.106765e-54 |
MsaG017058 | MsaG040187 | 0.803085 | 6.937369e-49 | 1.006134e-46 |
MsaG017209 | MsaG040187 | 0.820151 | 1.398507e-52 | 3.088225e-50 |
MsaG017691 | MsaG040187 | 0.811709 | 1.049168e-50 | 1.868101e-48 |
MsaG018134 | MsaG040187 | 0.828509 | 1.547338e-54 | 4.292392e-52 |
MsaG018372 | MsaG040187 | 0.822047 | 5.139237e-53 | 1.193325e-50 |
MsaG018813 | MsaG040187 | 0.816984 | 7.251822e-52 | 1.474533e-49 |
MsaG018901 | MsaG040187 | 0.803934 | 4.635674e-49 | 6.856382e-47 |
MsaG019361 | MsaG040187 | 0.802627 | 8.616613e-49 | 1.236590e-46 |
MsaG019639 | MsaG040187 | 0.822951 | 3.175217e-53 | 7.554595e-51 |
MsaG019731 | MsaG040187 | 0.803833 | 4.864952e-49 | 7.178533e-47 |
MsaG020450 | MsaG040187 | 0.806339 | 1.462627e-49 | 2.288186e-47 |
MsaG020568 | MsaG040187 | 0.814342 | 2.794128e-51 | 5.312581e-49 |
MsaG020874 | MsaG040187 | 0.845196 | 8.856295e-59 | 4.084146e-56 |
MsaG020875 | MsaG040187 | 0.825054 | 1.024651e-53 | 2.581390e-51 |
MsaG021015 | MsaG040187 | 0.817337 | 6.046051e-52 | 1.240586e-49 |
MsaG021553 | MsaG040187 | 0.841751 | 7.296529e-58 | 3.010125e-55 |
MsaG022100 | MsaG040187 | 0.800858 | 1.980676e-48 | 2.730357e-46 |
MsaG022243 | MsaG040187 | 0.822539 | 3.955201e-53 | 9.306260e-51 |
MsaG022387 | MsaG040187 | 0.813175 | 5.036126e-51 | 9.299259e-49 |
MsaG022628 | MsaG040187 | 0.805522 | 2.167807e-49 | 3.326576e-47 |
MsaG023271 | MsaG040187 | 0.804514 | 3.514534e-49 | 5.268511e-47 |
MsaG023578 | MsaG040187 | 0.815813 | 1.322039e-51 | 2.608791e-49 |
MsaG023872 | MsaG040187 | 0.819904 | 1.591968e-52 | 3.492322e-50 |
MsaG024304 | MsaG040187 | 0.817718 | 4.964741e-52 | 1.028726e-49 |
MsaG025148 | MsaG040187 | 0.804895 | 2.929049e-49 | 4.429833e-47 |
MsaG025574 | MsaG040187 | 0.802095 | 1.108084e-48 | 1.570905e-46 |
MsaG025691 | MsaG040187 | 0.813578 | 4.110870e-51 | 7.667715e-49 |
MsaG026261 | MsaG040187 | 0.802185 | 1.061713e-48 | 1.508295e-46 |
MsaG026721 | MsaG040187 | 0.823015 | 3.069040e-53 | 7.314542e-51 |
MsaG026714 | MsaG040187 | 0.815464 | 1.579390e-51 | 3.089199e-49 |
MsaG026740 | MsaG040187 | 0.805317 | 2.392474e-49 | 3.653979e-47 |
MsaG026863 | MsaG040187 | 0.807065 | 1.029232e-49 | 1.637907e-47 |
MsaG026985 | MsaG040187 | 0.827886 | 2.182038e-54 | 5.948129e-52 |
MsaG027039 | MsaG040187 | 0.861519 | 1.912944e-63 | 1.575926e-60 |
MsaG027568 | MsaG040187 | 0.828925 | 1.228667e-54 | 3.448202e-52 |
MsaG027780 | MsaG040187 | 0.831606 | 2.739667e-55 | 8.304303e-53 |
MsaG028457 | MsaG040187 | 0.822542 | 3.950077e-53 | 9.294829e-51 |
MsaG028485 | MsaG040187 | 0.804903 | 2.918606e-49 | 4.414799e-47 |
MsaG028716 | MsaG040187 | 0.808885 | 4.237920e-50 | 7.045326e-48 |
MsaG029335 | MsaG040187 | 0.805202 | 2.528459e-49 | 3.851357e-47 |
MsaG029567 | MsaG040187 | 0.825310 | 8.923466e-54 | 2.263904e-51 |
MsaG029593 | MsaG040187 | 0.827067 | 3.422884e-54 | 9.118379e-52 |
MsaG029863 | MsaG040187 | 0.836614 | 1.544546e-56 | 5.430326e-54 |
MsaG029907 | MsaG040187 | 0.808840 | 4.333028e-50 | 7.195522e-48 |
MsaG029899 | MsaG040187 | 0.809806 | 2.694892e-50 | 4.580710e-48 |
MsaG029948 | MsaG040187 | 0.829654 | 8.190110e-55 | 2.346953e-52 |
MsaG030084 | MsaG040187 | 0.820570 | 1.122107e-52 | 2.505350e-50 |
MsaG030507 | MsaG040187 | 0.829186 | 1.062730e-54 | 3.004537e-52 |
MsaG030801 | MsaG040187 | 0.851013 | 2.232638e-60 | 1.253051e-57 |
MsaG031427 | MsaG040187 | 0.836895 | 1.310379e-56 | 4.646397e-54 |
MsaG032062 | MsaG040187 | 0.838356 | 5.551125e-57 | 2.058393e-54 |
MsaG032068 | MsaG040187 | 0.807751 | 7.373438e-50 | 1.192775e-47 |
MsaG032147 | MsaG040187 | 0.802432 | 9.450323e-49 | 1.350173e-46 |
MsaG032431 | MsaG040187 | 0.829559 | 8.636322e-55 | 2.468088e-52 |
MsaG033831 | MsaG040187 | 0.814525 | 2.547157e-51 | 4.865173e-49 |
MsaG033983 | MsaG040187 | 0.814001 | 3.319450e-51 | 6.257635e-49 |
MsaG034079 | MsaG040187 | 0.820323 | 1.277626e-52 | 2.834232e-50 |
MsaG034148 | MsaG040187 | 0.800124 | 2.789749e-48 | 3.782440e-46 |
MsaG034975 | MsaG040187 | 0.805579 | 2.109501e-49 | 3.241415e-47 |
MsaG040187 | MsaG040669 | 0.809213 | 3.607300e-50 | 6.044176e-48 |
MsaG040187 | MsaG042382 | 0.807567 | 8.066960e-50 | 1.299167e-47 |
MsaG040187 | MsaG042579 | 0.807962 | 6.654534e-50 | 1.081943e-47 |
MsaG040187 | MsaG044384 | 0.828616 | 1.457935e-54 | 4.056482e-52 |
MsaG040187 | MsaG044387 | 0.807223 | 9.531870e-50 | 1.522554e-47 |
MsaG040187 | MsaG044752 | 0.813957 | 3.395129e-51 | 6.393327e-49 |
MsaG040187 | MsaG044919 | 0.804612 | 3.353941e-49 | 5.039123e-47 |
MsaG040187 | MsaG045021 | 0.800197 | 2.696979e-48 | 3.662624e-46 |
MsaG040187 | MsaG045072 | 0.861021 | 2.709163e-63 | 2.189760e-60 |
MsaG040187 | MsaG045078 | 0.837011 | 1.224297e-56 | 4.356295e-54 |
MsaG040187 | MsaG045222 | 0.816018 | 1.190606e-51 | 2.361637e-49 |
MsaG040187 | MsaG045339 | 0.807424 | 8.645189e-50 | 1.387580e-47 |
MsaG040187 | MsaG045371 | 0.804566 | 3.428890e-49 | 5.146348e-47 |
MsaG040187 | MsaG045373 | 0.809306 | 3.447321e-50 | 5.788916e-48 |
MsaG040187 | MsaG045376 | 0.826161 | 5.617809e-54 | 1.459344e-51 |
MsaG040187 | MsaG045403 | 0.847282 | 2.408866e-59 | 1.190789e-56 |
MsaG040187 | MsaG045404 | 0.818094 | 4.087186e-52 | 8.551696e-50 |
MsaG040187 | MsaG045611 | 0.833279 | 1.059328e-55 | 3.371579e-53 |
MsaG040187 | MsaG046053 | 0.855574 | 1.115008e-61 | 7.354932e-59 |
MsaG040187 | MsaG046226 | 0.847209 | 2.522093e-59 | 1.243742e-56 |
MsaG040187 | MsaG046472 | 0.805988 | 1.732821e-49 | 2.688240e-47 |
MsaG040187 | MsaG046847 | 0.800920 | 1.923407e-48 | 2.655098e-46 |
MsaG040187 | MsaG046816 | 0.820039 | 1.482850e-52 | 3.264739e-50 |
MsaG040187 | MsaG047054 | 0.828586 | 1.482314e-54 | 4.120897e-52 |
MsaG040187 | MsaG000067 | 0.855375 | 1.273231e-61 | 8.337716e-59 |
MsaG040187 | MsaG002583 | 0.847789 | 1.750302e-59 | 8.801853e-57 |
MsaG040187 | MsaG007590 | 0.818928 | 2.650769e-52 | 5.667743e-50 |
MsaG040187 | MsaG008796 | 0.804698 | 3.219120e-49 | 4.846205e-47 |
MsaG040187 | MsaG009037 | 0.839659 | 2.562353e-57 | 9.896028e-55 |
MsaG040187 | MsaG008313 | 0.813458 | 4.365847e-51 | 8.119010e-49 |
MsaG040187 | MsaG013401 | 0.850595 | 2.924906e-60 | 1.618160e-57 |
MsaG040187 | MsaG014449 | 0.822378 | 4.308685e-53 | 1.009434e-50 |
MsaG040187 | MsaG013066 | 0.828576 | 1.490665e-54 | 4.142945e-52 |
MsaG040187 | MsaG014180 | 0.833479 | 9.447864e-56 | 3.024820e-53 |
MsaG040187 | MsaG015534 | 0.853126 | 5.642615e-61 | 3.410053e-58 |
MsaG040187 | MsaG014275 | 0.802095 | 1.107870e-48 | 1.570608e-46 |
MsaG040187 | MsaG013405 | 0.813205 | 4.960931e-51 | 9.167221e-49 |
MsaG040187 | MsaG013014 | 0.827540 | 2.640939e-54 | 7.129332e-52 |
MsaG040187 | MsaG025590 | 0.814201 | 3.000281e-51 | 5.684492e-49 |
MsaG040187 | MsaG032410 | 0.819082 | 2.445929e-52 | 5.251015e-50 |
MsaG040187 | MsaG030439 | 0.802902 | 7.566543e-49 | 1.092723e-46 |
MsaG040187 | MsaG032845 | 0.840913 | 1.209234e-57 | 4.857873e-55 |
MsaG040187 | MsaG033325 | 0.841891 | 6.704924e-58 | 2.778703e-55 |
MsaG040187 | MsaG034264 | 0.821984 | 5.314103e-53 | 1.231857e-50 |
MsaG040187 | MsaG040848 | 0.802156 | 1.076565e-48 | 1.528354e-46 |
MsaG040187 | MsaG037271 | 0.833630 | 8.669645e-56 | 2.787950e-53 |
MsaG040187 | MsaG037384 | 0.841777 | 7.181259e-58 | 2.965157e-55 |
MsaG040187 | MsaG037156 | 0.803322 | 6.201008e-49 | 9.042504e-47 |
MsaG040187 | MsaG037161 | 0.800499 | 2.342621e-48 | 3.203216e-46 |
MsaG040187 | MsaG037786 | 0.813408 | 4.479013e-51 | 8.318843e-49 |
MsaG040187 | MsaG036542 | 0.822941 | 3.191377e-53 | 7.591080e-51 |
MsaG040187 | MsaG039736 | 0.819865 | 1.624324e-52 | 3.559650e-50 |
MsaG040187 | MsaG036984 | 0.841230 | 9.990204e-58 | 4.054093e-55 |
MsaG040187 | MsaG043458 | 0.813233 | 4.890218e-51 | 9.043022e-49 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG040187 | MtrunA17_Chr7g0267101 | 97.561 | 287 | 6 | 1 | 1 | 286 | 1 | 287 | 0.0 | 558 |
MsaG040187 | MtrunA17_Chr1g0210351 | 49.282 | 209 | 83 | 7 | 1 | 196 | 1 | 199 | 5.08e-56 | 181 |
MsaG040187 | MtrunA17_Chr1g0177911 | 42.387 | 243 | 112 | 8 | 5 | 239 | 3 | 225 | 1.76e-40 | 140 |
MsaG040187 | MtrunA17_Chr7g0259991 | 33.766 | 154 | 78 | 5 | 65 | 198 | 51 | 200 | 3.81e-17 | 78.2 |
MsaG040187 | MtrunA17_Chr1g0185481 | 38.168 | 131 | 49 | 5 | 96 | 198 | 140 | 266 | 6.06e-16 | 75.9 |
MsaG040187 | MtrunA17_Chr1g0205341 | 38.261 | 115 | 50 | 6 | 97 | 198 | 73 | 179 | 4.51e-12 | 64.3 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG040187 | AT5G04820.1 | 40.079 | 252 | 111 | 13 | 1 | 222 | 1 | 242 | 2.36e-40 | 141 |
MsaG040187 | AT2G36050.1 | 40.805 | 174 | 72 | 7 | 31 | 200 | 29 | 175 | 6.20e-25 | 100 |
MsaG040187 | AT3G52540.1 | 40.306 | 196 | 100 | 8 | 86 | 270 | 91 | 280 | 1.13e-21 | 92.4 |
MsaG040187 | AT1G05420.2 | 37.963 | 108 | 61 | 3 | 97 | 198 | 127 | 234 | 2.14e-11 | 63.2 |
MsaG040187 | AT1G05420.1 | 37.963 | 108 | 61 | 3 | 97 | 198 | 111 | 218 | 2.14e-11 | 62.8 |
Find 35 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
TTCCAAGTAAACTGAGTTAA+TGG | 0.182052 | 7:-97577500 | None:intergenic |
CTTTGTTGTTAGAACAAGTT+AGG | 0.274105 | 7:+97578106 | MsaT040187.1:CDS |
TTCGATGGAATCAACTTGTT+TGG | 0.312302 | 7:-97577596 | None:intergenic |
AATAATAAAGCTGCTGCAAT+AGG | 0.359001 | 7:+97577691 | MsaT040187.1:CDS |
CACTCGTTGTGTTTCTTGTT+CGG | 0.365942 | 7:+97578047 | MsaT040187.1:CDS |
GACTTTCGAAAATCGATATA+AGG | 0.369168 | 7:-97577778 | None:intergenic |
TGAGACCAACTCCATCTTAG+AGG | 0.373515 | 7:+97577666 | MsaT040187.1:CDS |
AACCATTAACTCAGTTTACT+TGG | 0.384415 | 7:+97577498 | MsaT040187.1:CDS |
AAGATGGAGTTGGTCTCATC+TGG | 0.396490 | 7:-97577661 | None:intergenic |
ATCAATCATGGCTATATTGT+TGG | 0.406010 | 7:+97577889 | MsaT040187.1:CDS |
GAAAAGCTAGAATCACAGTT+TGG | 0.407128 | 7:-97577550 | None:intergenic |
GAAGAACTATAAAACGATAA+AGG | 0.409329 | 7:-97578006 | None:intergenic |
AAGCTCATGATGTTAAAGAT+TGG | 0.417820 | 7:+97577818 | MsaT040187.1:CDS |
TTTATTATTAACCTCTAAGA+TGG | 0.418526 | 7:-97577677 | None:intergenic |
AGCTCATGATGTTAAAGATT+GGG | 0.430684 | 7:+97577819 | MsaT040187.1:CDS |
TTCGGAAATTCGCGAGGATG+AGG | 0.438055 | 7:+97578065 | MsaT040187.1:CDS |
AATATTCATCTTCTTCATCA+TGG | 0.472237 | 7:+97577401 | MsaT040187.1:CDS |
TTTGTTGTTAGAACAAGTTA+GGG | 0.507023 | 7:+97578107 | MsaT040187.1:CDS |
TCCATCGAAACTGTGATTCG+AGG | 0.507125 | 7:+97577610 | MsaT040187.1:CDS |
TAAAACGATAAAGGAGAAGA+AGG | 0.515224 | 7:-97577997 | None:intergenic |
GTCAATGAGAAAATCAATCA+TGG | 0.520445 | 7:+97577877 | MsaT040187.1:CDS |
AACACAACGAGTGCTATAAG+AGG | 0.520738 | 7:-97578037 | None:intergenic |
TTCGAGGATTATCTTCTGAT+CGG | 0.524502 | 7:+97577626 | MsaT040187.1:CDS |
TCCTCGAATCACAGTTTCGA+TGG | 0.529971 | 7:-97577611 | None:intergenic |
ATTAACCTCTAAGATGGAGT+TGG | 0.540469 | 7:-97577671 | None:intergenic |
AATAAAGCTGCTGCAATAGG+AGG | 0.582511 | 7:+97577694 | MsaT040187.1:CDS |
GGTTGGTGACAATATGGCCA+TGG | 0.583924 | 7:-97577424 | None:intergenic |
CATCTTCTTCATCATGGCCA+TGG | 0.594079 | 7:+97577407 | MsaT040187.1:CDS |
AAAGCTGCTGCAATAGGAGG+TGG | 0.598773 | 7:+97577697 | MsaT040187.1:CDS |
TCTAACAACAAAGAAGAACT+AGG | 0.600863 | 7:-97578096 | None:intergenic |
GTTGTTAGAACAAGTTAGGG+AGG | 0.604085 | 7:+97578110 | MsaT040187.1:CDS |
AAAACTACACTGTCTTTGAA+CGG | 0.622124 | 7:-97577736 | None:intergenic |
ATCACAGTTTGGAGAAACAG+TGG | 0.633886 | 7:-97577539 | None:intergenic |
CATGATGTTAAAGATTGGGA+AGG | 0.635146 | 7:+97577823 | MsaT040187.1:CDS |
TTCTTGTTCGGAAATTCGCG+AGG | 0.660121 | 7:+97578059 | MsaT040187.1:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr7 | gene | 97577346 | 97578206 | 97577346 | ID=MsaG040187 |
Chr7 | mRNA | 97577346 | 97578206 | 97577346 | ID=MsaT040187.1;Parent=MsaG040187 |
Chr7 | exon | 97577346 | 97578206 | 97577346 | ID=MsaT040187.1.exon1;Parent=MsaT040187.1 |
Chr7 | CDS | 97577346 | 97578206 | 97577346 | ID=cds.MsaT040187.1;Parent=MsaT040187.1 |
Gene Sequence |
Protein sequence |