Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG040441 | XP_003626001.1 | 99.307 | 433 | 3 | 0 | 1 | 433 | 1 | 433 | 0.0 | 893 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG040441 | sp|Q8VZL6|SWC4_ARATH | 69.841 | 441 | 120 | 6 | 2 | 433 | 5 | 441 | 0.0 | 607 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG040441 | tr|G7KTN9|G7KTN9_MEDTR | 99.307 | 433 | 3 | 0 | 1 | 433 | 1 | 433 | 0.0 | 893 |
Gene ID | Type | Classification |
---|---|---|
MsaG040441 | TF | MYB-related |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000314 | MsaG040441 | 0.800269 | 2.608090e-48 | 3.547708e-46 |
MsaG000336 | MsaG040441 | 0.813285 | 4.763711e-51 | 8.820270e-49 |
MsaG000372 | MsaG040441 | 0.837751 | 7.930707e-57 | 2.886473e-54 |
MsaG000403 | MsaG040441 | 0.849387 | 6.345130e-60 | 3.368116e-57 |
MsaG000455 | MsaG040441 | 0.854733 | 1.952794e-61 | 1.249558e-58 |
MsaG000620 | MsaG040441 | 0.815692 | 1.406595e-51 | 2.767128e-49 |
MsaG000730 | MsaG040441 | 0.831204 | 3.436383e-55 | 1.029387e-52 |
MsaG000791 | MsaG040441 | 0.832578 | 1.579056e-55 | 4.923489e-53 |
MsaG000858 | MsaG040441 | 0.812289 | 7.851273e-51 | 1.418070e-48 |
MsaG000932 | MsaG040441 | 0.812281 | 7.886282e-51 | 1.424087e-48 |
MsaG000952 | MsaG040441 | 0.839565 | 2.709188e-57 | 1.043256e-54 |
MsaG001132 | MsaG040441 | 0.814949 | 2.053674e-51 | 3.964767e-49 |
MsaG001181 | MsaG040441 | 0.821320 | 7.555154e-53 | 1.720692e-50 |
MsaG001192 | MsaG040441 | 0.809887 | 2.588938e-50 | 4.409156e-48 |
MsaG001196 | MsaG040441 | 0.809547 | 3.061349e-50 | 5.171163e-48 |
MsaG001233 | MsaG040441 | 0.806443 | 1.391214e-49 | 2.181848e-47 |
MsaG001287 | MsaG040441 | 0.824900 | 1.114085e-53 | 2.794870e-51 |
MsaG001323 | MsaG040441 | 0.811679 | 1.065114e-50 | 1.895096e-48 |
MsaG001441 | MsaG040441 | 0.812514 | 7.014866e-51 | 1.274181e-48 |
MsaG001705 | MsaG040441 | 0.804700 | 3.215780e-49 | 4.841433e-47 |
MsaG001855 | MsaG040441 | 0.802644 | 8.548605e-49 | 1.227293e-46 |
MsaG001973 | MsaG040441 | 0.848614 | 1.037859e-59 | 5.365450e-57 |
MsaG002121 | MsaG040441 | 0.814340 | 2.796656e-51 | 5.317180e-49 |
MsaG002141 | MsaG040441 | 0.801410 | 1.528675e-48 | 2.133791e-46 |
MsaG002479 | MsaG040441 | 0.805188 | 2.545104e-49 | 3.875519e-47 |
MsaG002527 | MsaG040441 | 0.800158 | 2.746572e-48 | 3.726718e-46 |
MsaG002560 | MsaG040441 | 0.864696 | 2.015216e-64 | 1.881015e-61 |
MsaG002563 | MsaG040441 | 0.816704 | 8.373669e-52 | 1.690382e-49 |
MsaG003067 | MsaG040441 | 0.858756 | 1.295328e-62 | 9.608103e-60 |
MsaG003098 | MsaG040441 | 0.826780 | 4.007093e-54 | 1.058942e-51 |
MsaG003100 | MsaG040441 | 0.802047 | 1.133143e-48 | 1.604710e-46 |
MsaG003284 | MsaG040441 | 0.823832 | 1.980880e-53 | 4.826822e-51 |
MsaG003565 | MsaG040441 | 0.814772 | 2.246272e-51 | 4.317429e-49 |
MsaG003631 | MsaG040441 | 0.825270 | 9.116513e-54 | 2.310343e-51 |
MsaG003828 | MsaG040441 | 0.821171 | 8.171066e-53 | 1.853738e-50 |
MsaG003859 | MsaG040441 | 0.802278 | 1.016191e-48 | 1.446721e-46 |
MsaG003870 | MsaG040441 | 0.848235 | 1.320083e-59 | 6.737655e-57 |
MsaG003915 | MsaG040441 | 0.838947 | 3.913780e-57 | 1.478365e-54 |
MsaG003982 | MsaG040441 | 0.830563 | 4.927257e-55 | 1.449052e-52 |
MsaG004147 | MsaG040441 | 0.831598 | 2.752058e-55 | 8.339873e-53 |
MsaG004340 | MsaG040441 | 0.808905 | 4.196009e-50 | 6.978915e-48 |
MsaG004391 | MsaG040441 | 0.807099 | 1.012669e-49 | 1.612820e-47 |
MsaG004486 | MsaG040441 | 0.842188 | 5.600676e-58 | 2.342971e-55 |
MsaG004748 | MsaG040441 | 0.810560 | 1.857075e-50 | 3.214918e-48 |
MsaG004923 | MsaG040441 | 0.821269 | 7.759144e-53 | 1.764849e-50 |
MsaG005063 | MsaG040441 | 0.824342 | 1.505487e-53 | 3.719803e-51 |
MsaG005246 | MsaG040441 | 0.823877 | 1.933718e-53 | 4.717586e-51 |
MsaG005408 | MsaG040441 | 0.829866 | 7.274164e-55 | 2.097232e-52 |
MsaG005457 | MsaG040441 | 0.808572 | 4.938723e-50 | 8.148620e-48 |
MsaG005560 | MsaG040441 | 0.820519 | 1.152243e-52 | 2.569291e-50 |
MsaG005564 | MsaG040441 | 0.838386 | 5.452807e-57 | 2.023816e-54 |
MsaG005589 | MsaG040441 | 0.802056 | 1.128297e-48 | 1.598191e-46 |
MsaG005761 | MsaG040441 | 0.815042 | 1.958487e-51 | 3.789867e-49 |
MsaG006160 | MsaG040441 | 0.818008 | 4.273209e-52 | 8.921398e-50 |
MsaG006049 | MsaG040441 | 0.808349 | 5.508924e-50 | 9.040455e-48 |
MsaG006233 | MsaG040441 | 0.828317 | 1.720351e-54 | 4.746587e-52 |
MsaG006250 | MsaG040441 | 0.839416 | 2.961629e-57 | 1.135113e-54 |
MsaG006254 | MsaG040441 | 0.813379 | 4.544688e-51 | 8.434660e-49 |
MsaG006256 | MsaG040441 | 0.846301 | 4.455148e-59 | 2.131232e-56 |
MsaG006481 | MsaG040441 | 0.860550 | 3.760173e-63 | 2.985806e-60 |
MsaG006482 | MsaG040441 | 0.825738 | 7.071565e-54 | 1.815497e-51 |
MsaG006679 | MsaG040441 | 0.811798 | 1.003339e-50 | 1.790456e-48 |
MsaG006752 | MsaG040441 | 0.827340 | 2.946783e-54 | 7.910446e-52 |
MsaG006841 | MsaG040441 | 0.819700 | 1.771306e-52 | 3.864707e-50 |
MsaG006862 | MsaG040441 | 0.842222 | 5.486413e-58 | 2.297602e-55 |
MsaG006893 | MsaG040441 | 0.857820 | 2.453069e-62 | 1.757104e-59 |
MsaG006934 | MsaG040441 | 0.816583 | 8.912681e-52 | 1.793582e-49 |
MsaG006980 | MsaG040441 | 0.822805 | 3.432040e-53 | 8.133687e-51 |
MsaG006986 | MsaG040441 | 0.834867 | 4.258097e-56 | 1.420644e-53 |
MsaG006981 | MsaG040441 | 0.810521 | 1.892675e-50 | 3.273509e-48 |
MsaG007038 | MsaG040441 | 0.829725 | 7.873671e-55 | 2.260817e-52 |
MsaG007110 | MsaG040441 | 0.834134 | 6.491751e-56 | 2.118828e-53 |
MsaG007112 | MsaG040441 | 0.818177 | 3.915379e-52 | 8.209739e-50 |
MsaG007196 | MsaG040441 | 0.811383 | 1.234090e-50 | 2.179898e-48 |
MsaG007483 | MsaG040441 | 0.861643 | 1.754529e-63 | 1.452167e-60 |
MsaG007553 | MsaG040441 | 0.802822 | 7.859394e-49 | 1.132913e-46 |
MsaG007700 | MsaG040441 | 0.804168 | 4.146879e-49 | 6.166850e-47 |
MsaG007713 | MsaG040441 | 0.824435 | 1.432028e-53 | 3.547123e-51 |
MsaG008357 | MsaG040441 | 0.825605 | 7.601422e-54 | 1.944220e-51 |
MsaG008428 | MsaG040441 | 0.814519 | 2.554162e-51 | 4.877864e-49 |
MsaG008631 | MsaG040441 | 0.844779 | 1.146186e-58 | 5.214333e-56 |
MsaG008704 | MsaG040441 | 0.812397 | 7.439005e-51 | 1.347260e-48 |
MsaG009439 | MsaG040441 | 0.808780 | 4.461758e-50 | 7.398601e-48 |
MsaG009848 | MsaG040441 | 0.803303 | 6.258228e-49 | 9.121879e-47 |
MsaG010051 | MsaG040441 | 0.841233 | 9.977442e-58 | 4.049158e-55 |
MsaG010660 | MsaG040441 | 0.817152 | 6.648999e-52 | 1.357855e-49 |
MsaG010898 | MsaG040441 | 0.816090 | 1.147190e-51 | 2.279717e-49 |
MsaG011083 | MsaG040441 | 0.809703 | 2.834530e-50 | 4.805998e-48 |
MsaG011256 | MsaG040441 | 0.805947 | 1.767493e-49 | 2.739477e-47 |
MsaG011557 | MsaG040441 | 0.840137 | 1.926152e-57 | 7.551588e-55 |
MsaG011670 | MsaG040441 | 0.848829 | 9.052428e-60 | 4.713966e-57 |
MsaG011819 | MsaG040441 | 0.816434 | 9.619883e-52 | 1.928491e-49 |
MsaG011884 | MsaG040441 | 0.824619 | 1.296398e-53 | 3.227276e-51 |
MsaG011946 | MsaG040441 | 0.840459 | 1.587958e-57 | 6.288991e-55 |
MsaG012213 | MsaG040441 | 0.804795 | 3.073436e-49 | 4.637351e-47 |
MsaG012339 | MsaG040441 | 0.803951 | 4.598424e-49 | 6.803997e-47 |
MsaG012297 | MsaG040441 | 0.802618 | 8.654708e-49 | 1.241793e-46 |
MsaG012468 | MsaG040441 | 0.805258 | 2.461977e-49 | 3.754862e-47 |
MsaG012548 | MsaG040441 | 0.814439 | 2.660595e-51 | 5.071050e-49 |
MsaG012576 | MsaG040441 | 0.848336 | 1.238272e-59 | 6.341155e-57 |
MsaG012670 | MsaG040441 | 0.822322 | 4.439733e-53 | 1.038559e-50 |
MsaG013310 | MsaG040441 | 0.824867 | 1.133724e-53 | 2.841581e-51 |
MsaG013878 | MsaG040441 | 0.828475 | 1.575950e-54 | 4.367728e-52 |
MsaG014036 | MsaG040441 | 0.802394 | 9.621214e-49 | 1.373428e-46 |
MsaG014042 | MsaG040441 | 0.814734 | 2.290446e-51 | 4.397943e-49 |
MsaG014314 | MsaG040441 | 0.819563 | 1.902719e-52 | 4.136505e-50 |
MsaG014308 | MsaG040441 | 0.823540 | 2.316200e-53 | 5.599457e-51 |
MsaG014366 | MsaG040441 | 0.817626 | 5.206414e-52 | 1.076246e-49 |
MsaG014670 | MsaG040441 | 0.810383 | 2.026508e-50 | 3.493260e-48 |
MsaG014960 | MsaG040441 | 0.813728 | 3.810685e-51 | 7.134652e-49 |
MsaG015305 | MsaG040441 | 0.824694 | 1.245403e-53 | 3.106627e-51 |
MsaG015318 | MsaG040441 | 0.811880 | 9.632036e-51 | 1.722309e-48 |
MsaG015372 | MsaG040441 | 0.835497 | 2.957463e-56 | 1.005521e-53 |
MsaG015925 | MsaG040441 | 0.810029 | 2.414023e-50 | 4.125306e-48 |
MsaG015976 | MsaG040441 | 0.801101 | 1.767615e-48 | 2.450007e-46 |
MsaG016026 | MsaG040441 | 0.818167 | 3.936196e-52 | 8.251282e-50 |
MsaG016325 | MsaG040441 | 0.809213 | 3.607173e-50 | 6.043966e-48 |
MsaG016429 | MsaG040441 | 0.835216 | 3.480497e-56 | 1.173343e-53 |
MsaG016552 | MsaG040441 | 0.810490 | 1.922203e-50 | 3.322075e-48 |
MsaG016655 | MsaG040441 | 0.872650 | 5.547679e-67 | 7.198475e-64 |
MsaG016767 | MsaG040441 | 0.850164 | 3.857557e-60 | 2.102320e-57 |
MsaG016796 | MsaG040441 | 0.822437 | 4.176011e-53 | 9.798725e-51 |
MsaG017082 | MsaG040441 | 0.826241 | 5.378942e-54 | 1.400353e-51 |
MsaG017114 | MsaG040441 | 0.819518 | 1.947669e-52 | 4.229321e-50 |
MsaG017293 | MsaG040441 | 0.801786 | 1.281153e-48 | 1.803584e-46 |
MsaG017446 | MsaG040441 | 0.820164 | 1.388845e-52 | 3.067973e-50 |
MsaG017459 | MsaG040441 | 0.806448 | 1.387780e-49 | 2.176727e-47 |
MsaG017486 | MsaG040441 | 0.812497 | 7.078043e-51 | 1.285075e-48 |
MsaG017492 | MsaG040441 | 0.839933 | 2.175718e-57 | 8.475850e-55 |
MsaG017682 | MsaG040441 | 0.841158 | 1.043773e-57 | 4.225904e-55 |
MsaG017931 | MsaG040441 | 0.801451 | 1.499593e-48 | 2.095139e-46 |
MsaG018254 | MsaG040441 | 0.800087 | 2.838419e-48 | 3.845260e-46 |
MsaG018483 | MsaG040441 | 0.832105 | 2.065266e-55 | 6.352180e-53 |
MsaG018524 | MsaG040441 | 0.824850 | 1.144748e-53 | 2.867832e-51 |
MsaG018689 | MsaG040441 | 0.817411 | 5.818464e-52 | 1.196195e-49 |
MsaG018843 | MsaG040441 | 0.831428 | 3.028994e-55 | 9.133523e-53 |
MsaG019017 | MsaG040441 | 0.813110 | 5.202012e-51 | 9.589858e-49 |
MsaG019225 | MsaG040441 | 0.822864 | 3.325986e-53 | 7.894905e-51 |
MsaG019278 | MsaG040441 | 0.801772 | 1.289657e-48 | 1.814974e-46 |
MsaG019352 | MsaG040441 | 0.813202 | 4.968266e-51 | 9.180061e-49 |
MsaG019403 | MsaG040441 | 0.801956 | 1.182613e-48 | 1.671318e-46 |
MsaG019430 | MsaG040441 | 0.807947 | 6.704536e-50 | 1.089687e-47 |
MsaG019556 | MsaG040441 | 0.846221 | 4.681163e-59 | 2.233439e-56 |
MsaG019624 | MsaG040441 | 0.801396 | 1.538800e-48 | 2.147227e-46 |
MsaG019776 | MsaG040441 | 0.805667 | 2.022580e-49 | 3.114244e-47 |
MsaG019783 | MsaG040441 | 0.819675 | 1.793968e-52 | 3.911587e-50 |
MsaG020004 | MsaG040441 | 0.811051 | 1.455317e-50 | 2.549860e-48 |
MsaG020345 | MsaG040441 | 0.800875 | 1.964998e-48 | 2.709768e-46 |
MsaG020392 | MsaG040441 | 0.809367 | 3.345214e-50 | 5.625847e-48 |
MsaG020424 | MsaG040441 | 0.805894 | 1.812700e-49 | 2.806094e-47 |
MsaG020532 | MsaG040441 | 0.810797 | 1.650662e-50 | 2.874224e-48 |
MsaG020589 | MsaG040441 | 0.840242 | 1.808843e-57 | 7.115086e-55 |
MsaG020653 | MsaG040441 | 0.848262 | 1.297483e-59 | 6.628387e-57 |
MsaG020657 | MsaG040441 | 0.803684 | 5.222077e-49 | 7.679057e-47 |
MsaG020695 | MsaG040441 | 0.846839 | 3.181305e-59 | 1.549451e-56 |
MsaG020862 | MsaG040441 | 0.836043 | 2.154133e-56 | 7.444504e-54 |
MsaG020933 | MsaG040441 | 0.826361 | 5.037563e-54 | 1.315885e-51 |
MsaG020934 | MsaG040441 | 0.808516 | 5.078093e-50 | 8.367010e-48 |
MsaG020952 | MsaG040441 | 0.804001 | 4.490480e-49 | 6.651940e-47 |
MsaG020946 | MsaG040441 | 0.825819 | 6.768523e-54 | 1.741626e-51 |
MsaG021301 | MsaG040441 | 0.801584 | 1.408798e-48 | 1.974185e-46 |
MsaG021314 | MsaG040441 | 0.860068 | 5.250360e-63 | 4.092951e-60 |
MsaG021403 | MsaG040441 | 0.825609 | 7.586439e-54 | 1.940601e-51 |
MsaG021410 | MsaG040441 | 0.806664 | 1.249896e-49 | 1.970402e-47 |
MsaG021640 | MsaG040441 | 0.838420 | 5.344350e-57 | 1.985736e-54 |
MsaG021836 | MsaG040441 | 0.801615 | 1.388629e-48 | 1.947311e-46 |
MsaG022095 | MsaG040441 | 0.811786 | 1.009758e-50 | 1.801324e-48 |
MsaG022096 | MsaG040441 | 0.812650 | 6.554358e-51 | 1.194495e-48 |
MsaG022193 | MsaG040441 | 0.805773 | 1.921271e-49 | 2.965682e-47 |
MsaG022263 | MsaG040441 | 0.834046 | 6.828979e-56 | 2.223060e-53 |
MsaG022737 | MsaG040441 | 0.818083 | 4.110627e-52 | 8.598171e-50 |
MsaG022805 | MsaG040441 | 0.840362 | 1.683355e-57 | 6.646724e-55 |
MsaG023134 | MsaG040441 | 0.867079 | 3.585027e-65 | 3.683596e-62 |
MsaG023333 | MsaG040441 | 0.824712 | 1.232839e-53 | 3.076857e-51 |
MsaG023614 | MsaG040441 | 0.870323 | 3.240273e-66 | 3.806113e-63 |
MsaG023664 | MsaG040441 | 0.822821 | 3.403697e-53 | 8.069981e-51 |
MsaG023688 | MsaG040441 | 0.823079 | 2.965284e-53 | 7.079734e-51 |
MsaG023691 | MsaG040441 | 0.822404 | 4.250801e-53 | 9.965445e-51 |
MsaG023830 | MsaG040441 | 0.804046 | 4.395740e-49 | 6.518645e-47 |
MsaG023939 | MsaG040441 | 0.826013 | 6.090754e-54 | 1.575684e-51 |
MsaG024052 | MsaG040441 | 0.839971 | 2.127337e-57 | 8.297060e-55 |
MsaG024263 | MsaG040441 | 0.830776 | 4.370450e-55 | 1.293242e-52 |
MsaG024283 | MsaG040441 | 0.854201 | 2.778678e-61 | 1.744774e-58 |
MsaG024548 | MsaG040441 | 0.827239 | 3.115109e-54 | 8.338554e-52 |
MsaG024573 | MsaG040441 | 0.816646 | 8.629511e-52 | 1.739353e-49 |
MsaG024640 | MsaG040441 | 0.800826 | 2.010182e-48 | 2.769034e-46 |
MsaG024694 | MsaG040441 | 0.810051 | 2.388338e-50 | 4.083589e-48 |
MsaG024909 | MsaG040441 | 0.808262 | 5.747971e-50 | 9.413276e-48 |
MsaG025566 | MsaG040441 | 0.826311 | 5.175310e-54 | 1.349989e-51 |
MsaG025714 | MsaG040441 | 0.848795 | 9.253317e-60 | 4.812945e-57 |
MsaG026584 | MsaG040441 | 0.859347 | 8.636534e-63 | 6.550302e-60 |
MsaG026637 | MsaG040441 | 0.806462 | 1.378405e-49 | 2.162737e-47 |
MsaG027080 | MsaG040441 | 0.811385 | 1.232521e-50 | 2.177260e-48 |
MsaG027250 | MsaG040441 | 0.824072 | 1.740806e-53 | 4.269558e-51 |
MsaG027573 | MsaG040441 | 0.809041 | 3.926155e-50 | 6.551481e-48 |
MsaG027580 | MsaG040441 | 0.810696 | 1.735765e-50 | 3.014847e-48 |
MsaG027742 | MsaG040441 | 0.805109 | 2.643526e-49 | 4.017904e-47 |
MsaG027989 | MsaG040441 | 0.816674 | 8.504483e-52 | 1.715417e-49 |
MsaG028266 | MsaG040441 | 0.819163 | 2.344697e-52 | 5.044543e-50 |
MsaG028308 | MsaG040441 | 0.827272 | 3.059701e-54 | 8.198014e-52 |
MsaG028461 | MsaG040441 | 0.833266 | 1.067171e-55 | 3.395354e-53 |
MsaG028821 | MsaG040441 | 0.809446 | 3.217325e-50 | 5.421486e-48 |
MsaG029041 | MsaG040441 | 0.817855 | 4.626447e-52 | 9.620305e-50 |
MsaG029058 | MsaG040441 | 0.805040 | 2.732492e-49 | 4.146611e-47 |
MsaG029105 | MsaG040441 | 0.812022 | 8.973210e-51 | 1.610079e-48 |
MsaG029512 | MsaG040441 | 0.829644 | 8.235389e-55 | 2.359284e-52 |
MsaG029673 | MsaG040441 | 0.821822 | 5.789726e-53 | 1.336299e-50 |
MsaG029894 | MsaG040441 | 0.800511 | 2.328901e-48 | 3.185390e-46 |
MsaG030474 | MsaG040441 | 0.804557 | 3.443396e-49 | 5.167047e-47 |
MsaG030879 | MsaG040441 | 0.804949 | 2.853980e-49 | 4.321733e-47 |
MsaG030981 | MsaG040441 | 0.800986 | 1.865603e-48 | 2.579139e-46 |
MsaG031021 | MsaG040441 | 0.801698 | 1.335427e-48 | 1.876237e-46 |
MsaG031531 | MsaG040441 | 0.809677 | 2.870966e-50 | 4.864761e-48 |
MsaG031686 | MsaG040441 | 0.803759 | 5.037979e-49 | 7.421267e-47 |
MsaG031693 | MsaG040441 | 0.802568 | 8.864362e-49 | 1.270412e-46 |
MsaG031981 | MsaG040441 | 0.838306 | 5.718134e-57 | 2.117076e-54 |
MsaG032206 | MsaG040441 | 0.818121 | 4.030677e-52 | 8.439387e-50 |
MsaG032426 | MsaG040441 | 0.805496 | 2.195940e-49 | 3.367634e-47 |
MsaG032509 | MsaG040441 | 0.845530 | 7.201149e-59 | 3.357596e-56 |
MsaG032775 | MsaG040441 | 0.804547 | 3.460571e-49 | 5.191582e-47 |
MsaG033020 | MsaG040441 | 0.813656 | 3.952673e-51 | 7.386948e-49 |
MsaG033695 | MsaG040441 | 0.823035 | 3.035257e-53 | 7.238210e-51 |
MsaG033774 | MsaG040441 | 0.830849 | 4.195218e-55 | 1.243997e-52 |
MsaG034340 | MsaG040441 | 0.831329 | 3.201991e-55 | 9.627086e-53 |
MsaG034380 | MsaG040441 | 0.816759 | 8.140409e-52 | 1.645662e-49 |
MsaG034644 | MsaG040441 | 0.806313 | 1.480840e-49 | 2.315282e-47 |
MsaG034676 | MsaG040441 | 0.813458 | 4.366818e-51 | 8.120691e-49 |
MsaG034798 | MsaG040441 | 0.834413 | 5.530810e-56 | 1.820455e-53 |
MsaG035104 | MsaG040441 | 0.804942 | 2.864488e-49 | 4.336860e-47 |
MsaG035131 | MsaG040441 | 0.823486 | 2.385354e-53 | 5.758010e-51 |
MsaG035253 | MsaG040441 | 0.854361 | 2.499352e-61 | 1.578435e-58 |
MsaG035296 | MsaG040441 | 0.872049 | 8.779739e-67 | 1.110131e-63 |
MsaG035409 | MsaG040441 | 0.819788 | 1.691363e-52 | 3.698913e-50 |
MsaG035496 | MsaG040441 | 0.822468 | 4.108569e-53 | 9.648427e-51 |
MsaG035634 | MsaG040441 | 0.831376 | 3.117882e-55 | 9.387137e-53 |
MsaG036044 | MsaG040441 | 0.821321 | 7.550049e-53 | 1.719593e-50 |
MsaG036215 | MsaG040441 | 0.807247 | 9.423543e-50 | 1.506076e-47 |
MsaG036690 | MsaG040441 | 0.821574 | 6.603199e-53 | 1.514052e-50 |
MsaG037247 | MsaG040441 | 0.800177 | 2.721915e-48 | 3.694821e-46 |
MsaG037360 | MsaG040441 | 0.833557 | 9.039425e-56 | 2.900623e-53 |
MsaG037602 | MsaG040441 | 0.806317 | 1.478325e-49 | 2.311517e-47 |
MsaG038059 | MsaG040441 | 0.811232 | 1.329992e-50 | 2.340618e-48 |
MsaG038354 | MsaG040441 | 0.830875 | 4.134140e-55 | 1.226824e-52 |
MsaG039255 | MsaG040441 | 0.813049 | 5.365035e-51 | 9.875486e-49 |
MsaG039578 | MsaG040441 | 0.805532 | 2.157460e-49 | 3.311470e-47 |
MsaG039692 | MsaG040441 | 0.839309 | 3.155095e-57 | 1.205206e-54 |
MsaG039918 | MsaG040441 | 0.813865 | 3.556722e-51 | 6.682188e-49 |
MsaG039843 | MsaG040441 | 0.806826 | 1.155589e-49 | 1.828641e-47 |
MsaG040264 | MsaG040441 | 0.816532 | 9.147702e-52 | 1.838485e-49 |
MsaG040441 | MsaG040506 | 0.827019 | 3.513806e-54 | 9.348063e-52 |
MsaG040441 | MsaG040567 | 0.818851 | 2.758512e-52 | 5.886193e-50 |
MsaG040441 | MsaG040895 | 0.806661 | 1.251640e-49 | 1.973021e-47 |
MsaG040441 | MsaG041066 | 0.807423 | 8.652319e-50 | 1.388673e-47 |
MsaG040441 | MsaG041370 | 0.824634 | 1.286471e-53 | 3.203831e-51 |
MsaG040441 | MsaG041672 | 0.815457 | 1.585359e-51 | 3.100295e-49 |
MsaG040441 | MsaG041790 | 0.802809 | 7.907089e-49 | 1.139473e-46 |
MsaG040441 | MsaG041791 | 0.836814 | 1.374250e-56 | 4.860966e-54 |
MsaG040441 | MsaG041930 | 0.818034 | 4.215990e-52 | 8.807570e-50 |
MsaG040441 | MsaG042064 | 0.816667 | 8.534700e-52 | 1.721184e-49 |
MsaG040441 | MsaG042072 | 0.810962 | 1.521434e-50 | 2.659826e-48 |
MsaG040441 | MsaG042381 | 0.824475 | 1.401643e-53 | 3.475605e-51 |
MsaG040441 | MsaG042532 | 0.838527 | 5.019133e-57 | 1.871177e-54 |
MsaG040441 | MsaG042767 | 0.806638 | 1.265655e-49 | 1.994060e-47 |
MsaG040441 | MsaG043735 | 0.800763 | 2.070953e-48 | 2.848725e-46 |
MsaG040441 | MsaG043809 | 0.810952 | 1.528729e-50 | 2.671946e-48 |
MsaG040441 | MsaG043810 | 0.826376 | 4.995554e-54 | 1.305476e-51 |
MsaG040441 | MsaG044360 | 0.807260 | 9.365223e-50 | 1.497214e-47 |
MsaG040441 | MsaG044372 | 0.812447 | 7.257016e-51 | 1.315917e-48 |
MsaG040441 | MsaG044374 | 0.819858 | 1.630226e-52 | 3.571847e-50 |
MsaG040441 | MsaG044633 | 0.806314 | 1.480609e-49 | 2.314934e-47 |
MsaG040441 | MsaG044725 | 0.807239 | 9.458707e-50 | 1.511427e-47 |
MsaG040441 | MsaG045263 | 0.868857 | 9.674734e-66 | 1.068946e-62 |
MsaG040441 | MsaG045415 | 0.815177 | 1.828480e-51 | 3.550422e-49 |
MsaG040441 | MsaG045870 | 0.807280 | 9.272509e-50 | 1.483134e-47 |
MsaG040441 | MsaG045886 | 0.803122 | 6.816871e-49 | 9.895042e-47 |
MsaG040441 | MsaG046264 | 0.827809 | 2.276436e-54 | 6.192179e-52 |
MsaG040441 | MsaG046321 | 0.807288 | 9.238171e-50 | 1.477904e-47 |
MsaG040441 | MsaG046441 | 0.884443 | 4.102716e-71 | 9.144708e-68 |
MsaG040441 | MsaG046700 | 0.817239 | 6.360177e-52 | 1.301783e-49 |
MsaG040441 | MsaG046753 | 0.819781 | 1.697747e-52 | 3.712191e-50 |
MsaG040441 | MsaG046908 | 0.816915 | 7.512984e-52 | 1.524959e-49 |
MsaG040441 | MsaG046909 | 0.818795 | 2.840818e-52 | 6.052841e-50 |
MsaG040441 | MsaG047016 | 0.847253 | 2.453181e-59 | 1.211535e-56 |
MsaG040441 | MsaG047018 | 0.847652 | 1.908031e-59 | 9.549733e-57 |
MsaG040441 | MsaG004542 | 0.800960 | 1.887763e-48 | 2.608253e-46 |
MsaG040441 | MsaG001526 | 0.812348 | 7.623604e-51 | 1.379011e-48 |
MsaG040441 | MsaG000003 | 0.828123 | 1.914974e-54 | 5.254993e-52 |
MsaG040441 | MsaG006154 | 0.834313 | 5.857290e-56 | 1.922131e-53 |
MsaG040441 | MsaG008960 | 0.825783 | 6.900767e-54 | 1.773868e-51 |
MsaG040441 | MsaG006149 | 0.827837 | 2.242308e-54 | 6.104059e-52 |
MsaG040441 | MsaG010133 | 0.808622 | 4.820585e-50 | 7.963084e-48 |
MsaG040441 | MsaG008905 | 0.836034 | 2.165375e-56 | 7.481333e-54 |
MsaG040441 | MsaG008205 | 0.812626 | 6.634376e-51 | 1.208359e-48 |
MsaG040441 | MsaG007163 | 0.803732 | 5.102782e-49 | 7.512212e-47 |
MsaG040441 | MsaG014188 | 0.837022 | 1.216673e-56 | 4.330675e-54 |
MsaG040441 | MsaG011682 | 0.818310 | 3.654991e-52 | 7.689759e-50 |
MsaG040441 | MsaG012734 | 0.847019 | 2.841158e-59 | 1.392173e-56 |
MsaG040441 | MsaG011836 | 0.849500 | 5.905624e-60 | 3.146902e-57 |
MsaG040441 | MsaG014196 | 0.841192 | 1.022645e-57 | 4.144786e-55 |
MsaG040441 | MsaG011916 | 0.834790 | 4.450869e-56 | 1.481576e-53 |
MsaG040441 | MsaG019843 | 0.849460 | 6.055952e-60 | 3.222691e-57 |
MsaG040441 | MsaG018328 | 0.804221 | 4.043201e-49 | 6.020141e-47 |
MsaG040441 | MsaG021117 | 0.857413 | 3.232745e-62 | 2.280795e-59 |
MsaG040441 | MsaG020214 | 0.807609 | 7.901403e-50 | 1.273808e-47 |
MsaG040441 | MsaG025375 | 0.805406 | 2.293043e-49 | 3.509255e-47 |
MsaG040441 | MsaG027355 | 0.811626 | 1.093514e-50 | 1.943093e-48 |
MsaG040441 | MsaG027009 | 0.804075 | 4.334560e-49 | 6.432285e-47 |
MsaG040441 | MsaG029778 | 0.804689 | 3.233063e-49 | 4.866162e-47 |
MsaG040441 | MsaG026809 | 0.827995 | 2.054765e-54 | 5.618283e-52 |
MsaG040441 | MsaG031743 | 0.846518 | 3.889194e-59 | 1.873947e-56 |
MsaG040441 | MsaG032678 | 0.806890 | 1.120617e-49 | 1.775967e-47 |
MsaG040441 | MsaG033142 | 0.812031 | 8.933188e-51 | 1.603255e-48 |
MsaG040441 | MsaG030637 | 0.849799 | 4.877283e-60 | 2.625228e-57 |
MsaG040441 | MsaG033838 | 0.814816 | 2.197225e-51 | 4.227748e-49 |
MsaG040441 | MsaG032967 | 0.838059 | 6.614775e-57 | 2.430509e-54 |
MsaG040441 | MsaG031473 | 0.812845 | 5.944314e-51 | 1.088597e-48 |
MsaG040441 | MsaG033074 | 0.824521 | 1.366997e-53 | 3.394052e-51 |
MsaG040441 | MsaG030582 | 0.800367 | 2.491018e-48 | 3.396074e-46 |
MsaG040441 | MsaG030783 | 0.810975 | 1.511134e-50 | 2.642717e-48 |
MsaG040441 | MsaG030823 | 0.837452 | 9.455468e-57 | 3.410272e-54 |
MsaG040441 | MsaG030727 | 0.825035 | 1.035530e-53 | 2.607426e-51 |
MsaG040441 | MsaG032827 | 0.803373 | 6.052797e-49 | 8.836892e-47 |
MsaG040441 | MsaG032852 | 0.831568 | 2.798132e-55 | 8.472134e-53 |
MsaG040441 | MsaG035350 | 0.823796 | 2.019330e-53 | 4.915887e-51 |
MsaG040441 | MsaG036648 | 0.829051 | 1.145609e-54 | 3.226659e-52 |
MsaG040441 | MsaG035492 | 0.816325 | 1.017011e-51 | 2.033218e-49 |
MsaG040441 | MsaG039594 | 0.839221 | 3.325875e-57 | 1.266972e-54 |
MsaG040441 | MsaG034934 | 0.801679 | 1.347523e-48 | 1.892411e-46 |
MsaG040441 | MsaG043460 | 0.824784 | 1.185908e-53 | 2.965613e-51 |
MsaG040441 | MsaG042294 | 0.808288 | 5.675502e-50 | 9.300333e-48 |
MsaG040441 | MsaG043095 | 0.825082 | 1.009351e-53 | 2.544773e-51 |
MsaG040441 | MsaG044966 | 0.804317 | 3.861949e-49 | 5.763005e-47 |
MsaG040441 | MsaG041543 | 0.810025 | 2.418597e-50 | 4.132747e-48 |
MsaG040441 | MsaG043341 | 0.814886 | 2.120115e-51 | 4.086595e-49 |
MsaG040441 | MsaG047176 | 0.823099 | 2.933202e-53 | 7.006782e-51 |
MsaG040441 | MsaG047199 | 0.811365 | 1.245130e-50 | 2.198415e-48 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG040441 | MtrunA17_Chr7g0270251 | 99.307 | 433 | 3 | 0 | 1 | 433 | 1 | 433 | 0.0 | 893 |
MsaG040441 | MtrunA17_Chr1g0194351 | 69.340 | 424 | 102 | 4 | 1 | 412 | 1 | 408 | 0.0 | 583 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG040441 | AT2G47210.3 | 69.841 | 441 | 120 | 6 | 2 | 433 | 5 | 441 | 0.0 | 607 |
MsaG040441 | AT2G47210.1 | 69.841 | 441 | 120 | 6 | 2 | 433 | 5 | 441 | 0.0 | 607 |
MsaG040441 | AT2G47210.2 | 69.841 | 441 | 120 | 6 | 2 | 433 | 5 | 441 | 0.0 | 607 |
Find 100 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
TATACCAATATACCTGTTTC+TGG | 0.156332 | 7:+100220070 | None:intergenic |
ATTCCCGATTCGTTGAATTT+TGG | 0.213340 | 7:-100219648 | MsaT040441.1:CDS |
CTTGCCAGGGCTGCATCTTC+CGG | 0.253582 | 7:-100222211 | MsaT040441.1:CDS |
TTTCTCTTGTTGTCTTGTTT+GGG | 0.260220 | 7:+100221952 | None:intergenic |
ATTTCTTGTGAAACATTATA+TGG | 0.283878 | 7:+100222007 | None:intergenic |
TCGGACTGTAGAGGAGTTAA+AGG | 0.299488 | 7:-100222450 | MsaT040441.1:CDS |
TTTGACTTCACCTTAATGAT+AGG | 0.315672 | 7:+100222172 | None:intergenic |
TTGCCAGGGCTGCATCTTCC+GGG | 0.316334 | 7:-100222210 | MsaT040441.1:CDS |
AGGCGAAAGGGTTGGCAAAA+AGG | 0.324610 | 7:-100219521 | MsaT040441.1:CDS |
TGCAACACATCCTATCATTA+AGG | 0.347399 | 7:-100222182 | MsaT040441.1:intron |
ATGGACGCGAAGGATATTCT+TGG | 0.347443 | 7:-100223777 | MsaT040441.1:CDS |
ATCATCTTTACGAGCAGAAT+TGG | 0.368961 | 7:+100223298 | None:intergenic |
CACAAGAAATGGAGCGAAAA+CGG | 0.373448 | 7:-100221994 | MsaT040441.1:CDS |
ATATAATGTTTCACAAGAAA+TGG | 0.380297 | 7:-100222005 | MsaT040441.1:CDS |
TTTAGCTACCTTGTTGTACT+TGG | 0.384441 | 7:+100223127 | None:intergenic |
TCCCTGTCATGTAGTGTTGC+GGG | 0.387723 | 7:-100222242 | MsaT040441.1:intron |
CGAGTTACGGATGGCTTCTA+AGG | 0.391035 | 7:-100221788 | MsaT040441.1:intron |
AATTGAGAAGCATCAATTGA+TGG | 0.396902 | 7:+100223530 | None:intergenic |
ACCTCCAAAATTCAACGAAT+CGG | 0.405812 | 7:+100219644 | None:intergenic |
CTTGTTGTCTTGTTTGGGAG+AGG | 0.408483 | 7:+100221957 | None:intergenic |
TTTCCGACCTTTGGTGTGCC+TGG | 0.419064 | 7:+100219778 | None:intergenic |
TTCAGCTTCGTGTATATTTG+AGG | 0.419331 | 7:-100220503 | MsaT040441.1:intron |
TCCTCTACAGTCCGAGATGA+TGG | 0.419890 | 7:+100222458 | None:intergenic |
AGCAAACATTGCAAGATCTC+GGG | 0.423802 | 7:-100220410 | MsaT040441.1:CDS |
TGCGGGCTATATTACTTGCC+AGG | 0.427836 | 7:-100222225 | MsaT040441.1:CDS |
ATGATCTTCATCTTTACCAT+TGG | 0.430773 | 7:-100223280 | MsaT040441.1:CDS |
TGATCTTCATCTTTACCATT+GGG | 0.431644 | 7:-100223279 | MsaT040441.1:intron |
ACAAGAAATGGAGCGAAAAC+GGG | 0.436669 | 7:-100221993 | MsaT040441.1:CDS |
GGTTACTGAACAGTCTCAAT+TGG | 0.436817 | 7:-100221088 | MsaT040441.1:CDS |
GTCAATGGTGTTCTACCTAC+TGG | 0.449074 | 7:-100223164 | MsaT040441.1:CDS |
ATGGCTGAATCTCCAGAAAC+AGG | 0.450187 | 7:-100220082 | MsaT040441.1:intron |
GCAGAAGGCACAACCATTTG+TGG | 0.456839 | 7:+100220985 | None:intergenic |
TAATTCATTTGTCTCCTCCT+TGG | 0.460992 | 7:+100222535 | None:intergenic |
AACTGTTGTTTCAGGCGAAA+GGG | 0.463388 | 7:-100219533 | MsaT040441.1:intron |
CCTCCAAAATTCAACGAATC+GGG | 0.465713 | 7:+100219645 | None:intergenic |
CAAGCTTCAAACTCAACTGC+TGG | 0.466195 | 7:-100220456 | MsaT040441.1:CDS |
CTGGAGTTCGGACTATCAAA+CGG | 0.471345 | 7:-100220437 | MsaT040441.1:CDS |
GACATATGCACTCGAGCAAA+TGG | 0.476593 | 7:-100220481 | MsaT040441.1:CDS |
GAATGTGCAACTTCCACAAA+TGG | 0.479963 | 7:-100220998 | MsaT040441.1:CDS |
GAGCAAACATTGCAAGATCT+CGG | 0.481522 | 7:-100220411 | MsaT040441.1:CDS |
GCATCAATTGATGGCATAAG+AGG | 0.485257 | 7:+100223539 | None:intergenic |
TAAAAGACCTAGAAAACAAA+AGG | 0.485836 | 7:-100219335 | MsaT040441.1:CDS |
GCGAAAACGGGCACTGTCCA+TGG | 0.488734 | 7:-100221981 | MsaT040441.1:CDS |
TTTCAGGTTCGAGTAGTCAA+TGG | 0.491064 | 7:-100223179 | MsaT040441.1:intron |
ACCTAGAAAACAAAAGGCCT+CGG | 0.494235 | 7:-100219329 | MsaT040441.1:CDS |
TACTCTAGCTTCTCTTCGCA+TGG | 0.494649 | 7:-100220950 | MsaT040441.1:intron |
GTCCCCGGAAGATGCAGCCC+TGG | 0.501841 | 7:+100222207 | None:intergenic |
AAACTGTTGTTTCAGGCGAA+AGG | 0.502998 | 7:-100219534 | MsaT040441.1:intron |
ACAAGAGAAAAGAGATGAAG+AGG | 0.510309 | 7:-100221939 | MsaT040441.1:intron |
CAAACTCAACTGCTGGAGTT+CGG | 0.511526 | 7:-100220449 | MsaT040441.1:CDS |
ATCACGGAAAGATGAACCTT+CGG | 0.512389 | 7:+100219819 | None:intergenic |
ACCTCGCGTGAAATGCCATC+AGG | 0.515608 | 7:+100223681 | None:intergenic |
GTCCCTGTCATGTAGTGTTG+CGG | 0.515697 | 7:-100222243 | MsaT040441.1:intron |
ACTTTATTTGTATAGGGGCA+TGG | 0.516874 | 7:-100219379 | MsaT040441.1:intron |
AAAGCCTCCTACTCACGAAA+AGG | 0.530448 | 7:-100223501 | MsaT040441.1:intron |
TGGAGTTCGGACTATCAAAC+GGG | 0.542516 | 7:-100220436 | MsaT040441.1:CDS |
TCTTTCCGTGATGGATCCTA+CGG | 0.547451 | 7:-100219808 | MsaT040441.1:CDS |
TTAAAGGATCGATATTATAG+TGG | 0.547811 | 7:-100222434 | MsaT040441.1:intron |
GAAGGTTCATCTTTCCGTGA+TGG | 0.548182 | 7:-100219817 | MsaT040441.1:CDS |
CTTAGAAGCCATCCGTAACT+CGG | 0.558886 | 7:+100221789 | None:intergenic |
GTTGCAGAGAGGGCTGTCCC+TGG | 0.559311 | 7:-100221039 | MsaT040441.1:CDS |
TGTGGAAGTTGCACATTCGA+AGG | 0.559456 | 7:+100221003 | None:intergenic |
TATCAGCTATAACAACAAAA+CGG | 0.560637 | 7:+100222486 | None:intergenic |
GTTGTTTCAGGCGAAAGGGT+TGG | 0.562497 | 7:-100219529 | MsaT040441.1:intron |
TTTCTCTGAGATTCTTTGGG+AGG | 0.563303 | 7:+100223705 | None:intergenic |
TAGGTTTATGCACTTACTGG+TGG | 0.564499 | 7:-100223569 | MsaT040441.1:CDS |
TGCCAGGGCTGCATCTTCCG+GGG | 0.572929 | 7:-100222209 | MsaT040441.1:CDS |
GTAGAAGCATTATCTGCAGA+AGG | 0.577553 | 7:+100220970 | None:intergenic |
TCCAGGTAAATTTGAAACCG+AGG | 0.579026 | 7:-100220161 | MsaT040441.1:intron |
CCAGGTAAATTTGAAACCGA+GGG | 0.579215 | 7:-100220160 | MsaT040441.1:intron |
CTGATAGGTTCCCATCATCT+CGG | 0.582805 | 7:-100222469 | MsaT040441.1:CDS |
TCTTGTTTGGGAGAGGACCA+TGG | 0.585148 | 7:+100221964 | None:intergenic |
TTACGAGCAGAATTGGTGAA+AGG | 0.585208 | 7:+100223305 | None:intergenic |
ACCTGATGGCATTTCACGCG+AGG | 0.587818 | 7:-100223682 | MsaT040441.1:intron |
GCGGGCTATATTACTTGCCA+GGG | 0.590495 | 7:-100222224 | MsaT040441.1:CDS |
CCTCTACAGTCCGAGATGAT+GGG | 0.592270 | 7:+100222459 | None:intergenic |
TGTGCCTGGTGTTTCACCGT+AGG | 0.598536 | 7:+100219792 | None:intergenic |
GGATCCTACGGTGAAACACC+AGG | 0.600080 | 7:-100219796 | MsaT040441.1:CDS |
GTGGCAGGTGCAATATAAAG+AGG | 0.604781 | 7:-100219842 | MsaT040441.1:intron |
GAAACCCTAAATGGACGCGA+AGG | 0.605606 | 7:-100223787 | None:intergenic |
CCCATCATCTCGGACTGTAG+AGG | 0.606561 | 7:-100222459 | MsaT040441.1:CDS |
TGATGCAGAAGTTGCAGAGA+GGG | 0.607610 | 7:-100221049 | MsaT040441.1:CDS |
GAAGGAGATACAGTTTCACC+AGG | 0.611694 | 7:+100221021 | None:intergenic |
AAGAATAGCCGAGTTACGGA+TGG | 0.620429 | 7:-100221797 | MsaT040441.1:CDS |
GCAAAAGAATAGTCTCCAGT+AGG | 0.625902 | 7:+100223149 | None:intergenic |
TCAATTGATGGCATAAGAGG+TGG | 0.628674 | 7:+100223542 | None:intergenic |
AATTATTTGATTTGTGTGAG+AGG | 0.630139 | 7:-100222517 | MsaT040441.1:CDS |
GAATCTCAGAGAAAACCTGA+TGG | 0.650054 | 7:-100223696 | MsaT040441.1:CDS |
GCAAACATTGCAAGATCTCG+GGG | 0.655130 | 7:-100220409 | MsaT040441.1:intron |
AGGATGTGTTGCAATGTCCC+CGG | 0.656289 | 7:+100222192 | None:intergenic |
TGAAACACCAGGCACACCAA+AGG | 0.660161 | 7:-100219785 | MsaT040441.1:intron |
CCGGAGGAATTAAAGATCCG+AGG | 0.665879 | 7:+100219312 | None:intergenic |
GTGCAATATAAAGAGGCCGA+AGG | 0.666909 | 7:-100219835 | MsaT040441.1:CDS |
ATCTACCTAGATGTGGACCA+AGG | 0.676327 | 7:-100222552 | MsaT040441.1:intron |
CATCATCAAATACACAGACG+AGG | 0.685360 | 7:-100223012 | MsaT040441.1:CDS |
TAAGAAGAGAAATACTAACA+TGG | 0.691447 | 7:-100220101 | MsaT040441.1:CDS |
CTGATGCAGAAGTTGCAGAG+AGG | 0.692246 | 7:-100221050 | MsaT040441.1:CDS |
TTTCACCGTAGGATCCATCA+CGG | 0.706383 | 7:+100219803 | None:intergenic |
AAGGAGATACAGTTTCACCA+GGG | 0.739390 | 7:+100221022 | None:intergenic |
TACCTAGATGTGGACCAAGG+AGG | 0.740553 | 7:-100222549 | MsaT040441.1:intron |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr7 | gene | 100219321 | 100223799 | 100219321 | ID=MsaG040441 |
Chr7 | mRNA | 100219321 | 100223799 | 100219321 | ID=MsaT040441.1;Parent=MsaG040441 |
Chr7 | exon | 100219321 | 100219386 | 100219321 | ID=MsaT040441.1.exon16;Parent=MsaT040441.1 |
Chr7 | CDS | 100219321 | 100219386 | 100219321 | ID=cds.MsaT040441.1;Parent=MsaT040441.1 |
Chr7 | exon | 100219507 | 100219541 | 100219507 | ID=MsaT040441.1.exon15;Parent=MsaT040441.1 |
Chr7 | CDS | 100219507 | 100219541 | 100219507 | ID=cds.MsaT040441.1;Parent=MsaT040441.1 |
Chr7 | exon | 100219646 | 100219682 | 100219646 | ID=MsaT040441.1.exon14;Parent=MsaT040441.1 |
Chr7 | CDS | 100219646 | 100219682 | 100219646 | ID=cds.MsaT040441.1;Parent=MsaT040441.1 |
Chr7 | exon | 100219786 | 100219857 | 100219786 | ID=MsaT040441.1.exon13;Parent=MsaT040441.1 |
Chr7 | CDS | 100219786 | 100219857 | 100219786 | ID=cds.MsaT040441.1;Parent=MsaT040441.1 |
Chr7 | exon | 100220083 | 100220178 | 100220083 | ID=MsaT040441.1.exon12;Parent=MsaT040441.1 |
Chr7 | CDS | 100220083 | 100220178 | 100220083 | ID=cds.MsaT040441.1;Parent=MsaT040441.1 |
Chr7 | exon | 100220410 | 100220520 | 100220410 | ID=MsaT040441.1.exon11;Parent=MsaT040441.1 |
Chr7 | CDS | 100220410 | 100220520 | 100220410 | ID=cds.MsaT040441.1;Parent=MsaT040441.1 |
Chr7 | exon | 100220951 | 100221109 | 100220951 | ID=MsaT040441.1.exon10;Parent=MsaT040441.1 |
Chr7 | CDS | 100220951 | 100221109 | 100220951 | ID=cds.MsaT040441.1;Parent=MsaT040441.1 |
Chr7 | exon | 100221789 | 100221836 | 100221789 | ID=MsaT040441.1.exon9;Parent=MsaT040441.1 |
Chr7 | CDS | 100221789 | 100221836 | 100221789 | ID=cds.MsaT040441.1;Parent=MsaT040441.1 |
Chr7 | exon | 100221940 | 100222032 | 100221940 | ID=MsaT040441.1.exon8;Parent=MsaT040441.1 |
Chr7 | CDS | 100221940 | 100222032 | 100221940 | ID=cds.MsaT040441.1;Parent=MsaT040441.1 |
Chr7 | exon | 100222183 | 100222250 | 100222183 | ID=MsaT040441.1.exon7;Parent=MsaT040441.1 |
Chr7 | CDS | 100222183 | 100222250 | 100222183 | ID=cds.MsaT040441.1;Parent=MsaT040441.1 |
Chr7 | exon | 100222435 | 100222564 | 100222435 | ID=MsaT040441.1.exon6;Parent=MsaT040441.1 |
Chr7 | CDS | 100222435 | 100222564 | 100222435 | ID=cds.MsaT040441.1;Parent=MsaT040441.1 |
Chr7 | exon | 100222986 | 100223042 | 100222986 | ID=MsaT040441.1.exon5;Parent=MsaT040441.1 |
Chr7 | CDS | 100222986 | 100223042 | 100222986 | ID=cds.MsaT040441.1;Parent=MsaT040441.1 |
Chr7 | exon | 100223136 | 100223195 | 100223136 | ID=MsaT040441.1.exon4;Parent=MsaT040441.1 |
Chr7 | CDS | 100223136 | 100223195 | 100223136 | ID=cds.MsaT040441.1;Parent=MsaT040441.1 |
Chr7 | exon | 100223280 | 100223345 | 100223280 | ID=MsaT040441.1.exon3;Parent=MsaT040441.1 |
Chr7 | CDS | 100223280 | 100223345 | 100223280 | ID=cds.MsaT040441.1;Parent=MsaT040441.1 |
Chr7 | exon | 100223502 | 100223588 | 100223502 | ID=MsaT040441.1.exon2;Parent=MsaT040441.1 |
Chr7 | CDS | 100223502 | 100223588 | 100223502 | ID=cds.MsaT040441.1;Parent=MsaT040441.1 |
Chr7 | exon | 100223683 | 100223799 | 100223683 | ID=MsaT040441.1.exon1;Parent=MsaT040441.1 |
Chr7 | CDS | 100223683 | 100223799 | 100223683 | ID=cds.MsaT040441.1;Parent=MsaT040441.1 |
Gene Sequence |
Protein sequence |