Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG040564 | XP_003626174.1 | 97.674 | 43 | 1 | 0 | 1 | 43 | 1 | 43 | 1.40e-23 | 95.5 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG040564 | tr|G7KWI0|G7KWI0_MEDTR | 97.674 | 43 | 1 | 0 | 1 | 43 | 1 | 43 | 6.67e-24 | 95.5 |
Gene ID | Type | Classification |
---|---|---|
MsaG040564 | TF | C2C2-GATA |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG040564 | MtrunA17_Chr7g0271861 | 97.674 | 43 | 1 | 0 | 1 | 43 | 1 | 43 | 1.28e-27 | 95.5 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Find 14 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
GACGCTGATTTGGAAAATTT+TGG | 0.219223 | 7:-101609388 | None:intergenic |
TCCTCTCCAAAGTGGTGTTT+TGG | 0.317787 | 7:-101608224 | None:intergenic |
AATGATACCTTGGGTCCATT+TGG | 0.368205 | 7:-101608250 | None:intergenic |
AATGGGAATCATGGATCAAA+TGG | 0.411033 | 7:+101608019 | None:intergenic |
ATGTTGTTCATACGATGAAA+TGG | 0.428480 | 7:+101608165 | MsaT040564.1:CDS |
AATCATGGATCAAATGGATA+AGG | 0.481862 | 7:+101608025 | MsaT040564.1:CDS |
CTTTGGAGAGGAGGACCAAA+TGG | 0.503109 | 7:+101608235 | MsaT040564.1:CDS |
TGTGAATCAAATGGGAATCA+TGG | 0.514991 | 7:+101608010 | None:intergenic |
AAACCACCAAAACACCACTT+TGG | 0.542523 | 7:+101608218 | MsaT040564.1:CDS |
TGTTGTTCATACGATGAAAT+GGG | 0.559954 | 7:+101608166 | MsaT040564.1:CDS |
TTTGGTCCTCCTCTCCAAAG+TGG | 0.621363 | 7:-101608232 | None:intergenic |
AAAACACCACTTTGGAGAGG+AGG | 0.625709 | 7:+101608226 | MsaT040564.1:CDS |
AGGAGGACCAAATGGACCCA+AGG | 0.633971 | 7:+101608243 | MsaT040564.1:CDS |
ACCAAAACACCACTTTGGAG+AGG | 0.669357 | 7:+101608223 | MsaT040564.1:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr7 | gene | 101608020 | 101609414 | 101608020 | ID=MsaG040564 |
Chr7 | mRNA | 101608020 | 101609414 | 101608020 | ID=MsaT040564.1;Parent=MsaG040564 |
Chr7 | exon | 101608020 | 101608046 | 101608020 | ID=MsaT040564.1.exon1;Parent=MsaT040564.1 |
Chr7 | CDS | 101608020 | 101608046 | 101608020 | ID=cds.MsaT040564.1;Parent=MsaT040564.1 |
Chr7 | exon | 101608163 | 101608264 | 101608163 | ID=MsaT040564.1.exon2;Parent=MsaT040564.1 |
Chr7 | CDS | 101608163 | 101608264 | 101608163 | ID=cds.MsaT040564.1;Parent=MsaT040564.1 |
Chr7 | exon | 101609385 | 101609414 | 101609385 | ID=MsaT040564.1.exon3;Parent=MsaT040564.1 |
Chr7 | CDS | 101609385 | 101609414 | 101609385 | ID=cds.MsaT040564.1;Parent=MsaT040564.1 |
Gene Sequence |
Protein sequence |