Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG045222 | PNX79844.1 | 57.255 | 255 | 97 | 3 | 176 | 422 | 47 | 297 | 3.03e-94 | 296 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG045222 | tr|A0A2K3LMT7|A0A2K3LMT7_TRIPR | 57.255 | 255 | 97 | 3 | 176 | 422 | 47 | 297 | 1.45e-94 | 296 |
Gene ID | Type | Classification |
---|---|---|
MsaG045222 | TF | FAR1 |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000281 | MsaG045222 | 0.845834 | 5.959097e-59 | 2.806733e-56 |
MsaG000288 | MsaG045222 | 0.837975 | 6.951985e-57 | 2.547769e-54 |
MsaG000431 | MsaG045222 | 0.808184 | 5.970476e-50 | 9.759280e-48 |
MsaG000683 | MsaG045222 | 0.800259 | 2.619417e-48 | 3.562364e-46 |
MsaG000855 | MsaG045222 | 0.828289 | 1.746691e-54 | 4.815394e-52 |
MsaG001237 | MsaG045222 | 0.826179 | 5.561556e-54 | 1.445441e-51 |
MsaG001258 | MsaG045222 | 0.804526 | 3.494311e-49 | 5.239693e-47 |
MsaG001531 | MsaG045222 | 0.804905 | 2.914740e-49 | 4.409253e-47 |
MsaG001672 | MsaG045222 | 0.814739 | 2.285009e-51 | 4.388076e-49 |
MsaG001859 | MsaG045222 | 0.814581 | 2.475798e-51 | 4.735408e-49 |
MsaG002013 | MsaG045222 | 0.829457 | 9.137720e-55 | 2.603724e-52 |
MsaG002218 | MsaG045222 | 0.815448 | 1.592523e-51 | 3.113605e-49 |
MsaG002866 | MsaG045222 | 0.809350 | 3.371990e-50 | 5.668521e-48 |
MsaG003210 | MsaG045222 | 0.834959 | 4.037196e-56 | 1.350632e-53 |
MsaG003200 | MsaG045222 | 0.812650 | 6.552484e-51 | 1.194164e-48 |
MsaG003201 | MsaG045222 | 0.810420 | 1.990084e-50 | 3.433586e-48 |
MsaG003202 | MsaG045222 | 0.821339 | 7.477089e-53 | 1.703784e-50 |
MsaG003203 | MsaG045222 | 0.805640 | 2.048427e-49 | 3.152185e-47 |
MsaG003683 | MsaG045222 | 0.841471 | 8.639793e-58 | 3.532913e-55 |
MsaG004105 | MsaG045222 | 0.801985 | 1.166955e-48 | 1.650263e-46 |
MsaG004150 | MsaG045222 | 0.800700 | 2.132044e-48 | 2.928709e-46 |
MsaG004181 | MsaG045222 | 0.816235 | 1.065360e-51 | 2.124976e-49 |
MsaG004204 | MsaG045222 | 0.810345 | 2.065251e-50 | 3.556730e-48 |
MsaG004373 | MsaG045222 | 0.831734 | 2.547503e-55 | 7.751468e-53 |
MsaG005000 | MsaG045222 | 0.832300 | 1.849689e-55 | 5.720858e-53 |
MsaG005119 | MsaG045222 | 0.811705 | 1.051438e-50 | 1.871970e-48 |
MsaG005329 | MsaG045222 | 0.802157 | 1.075866e-48 | 1.527408e-46 |
MsaG005401 | MsaG045222 | 0.837858 | 7.447368e-57 | 2.719390e-54 |
MsaG005435 | MsaG045222 | 0.800640 | 2.193375e-48 | 3.008816e-46 |
MsaG005442 | MsaG045222 | 0.823195 | 2.786429e-53 | 6.673557e-51 |
MsaG005443 | MsaG045222 | 0.822484 | 4.073416e-53 | 9.570144e-51 |
MsaG005444 | MsaG045222 | 0.822960 | 3.160342e-53 | 7.521063e-51 |
MsaG005506 | MsaG045222 | 0.817532 | 5.465681e-52 | 1.127139e-49 |
MsaG005508 | MsaG045222 | 0.832939 | 1.285670e-55 | 4.051332e-53 |
MsaG005510 | MsaG045222 | 0.808226 | 5.849987e-50 | 9.571892e-48 |
MsaG005582 | MsaG045222 | 0.820646 | 1.078058e-52 | 2.411845e-50 |
MsaG005683 | MsaG045222 | 0.861979 | 1.385748e-63 | 1.162092e-60 |
MsaG005642 | MsaG045222 | 0.813372 | 4.559506e-51 | 8.460738e-49 |
MsaG005705 | MsaG045222 | 0.821207 | 8.019391e-53 | 1.821008e-50 |
MsaG005838 | MsaG045222 | 0.803043 | 7.078933e-49 | 1.025639e-46 |
MsaG005811 | MsaG045222 | 0.856762 | 5.023337e-62 | 3.460155e-59 |
MsaG005864 | MsaG045222 | 0.867561 | 2.519569e-65 | 2.639905e-62 |
MsaG006051 | MsaG045222 | 0.841125 | 1.064583e-57 | 4.305669e-55 |
MsaG006175 | MsaG045222 | 0.857002 | 4.270932e-62 | 2.967394e-59 |
MsaG006274 | MsaG045222 | 0.801013 | 1.841482e-48 | 2.547400e-46 |
MsaG006561 | MsaG045222 | 0.830339 | 5.584501e-55 | 1.631955e-52 |
MsaG006777 | MsaG045222 | 0.808449 | 5.246315e-50 | 8.630247e-48 |
MsaG006902 | MsaG045222 | 0.826641 | 4.322676e-54 | 1.137949e-51 |
MsaG006926 | MsaG045222 | 0.826732 | 4.113485e-54 | 1.085650e-51 |
MsaG007145 | MsaG045222 | 0.854309 | 2.586207e-61 | 1.630212e-58 |
MsaG007353 | MsaG045222 | 0.828316 | 1.721099e-54 | 4.748524e-52 |
MsaG007387 | MsaG045222 | 0.817455 | 5.689265e-52 | 1.170924e-49 |
MsaG007555 | MsaG045222 | 0.812386 | 7.481984e-51 | 1.354661e-48 |
MsaG007716 | MsaG045222 | 0.803352 | 6.113711e-49 | 8.921434e-47 |
MsaG007729 | MsaG045222 | 0.828256 | 1.779606e-54 | 4.901473e-52 |
MsaG007833 | MsaG045222 | 0.810320 | 2.090646e-50 | 3.598236e-48 |
MsaG008140 | MsaG045222 | 0.817404 | 5.839726e-52 | 1.200330e-49 |
MsaG008461 | MsaG045222 | 0.802107 | 1.101625e-48 | 1.562171e-46 |
MsaG008552 | MsaG045222 | 0.806210 | 1.557006e-49 | 2.428412e-47 |
MsaG009138 | MsaG045222 | 0.827664 | 2.465503e-54 | 6.678990e-52 |
MsaG009390 | MsaG045222 | 0.838182 | 6.153447e-57 | 2.269524e-54 |
MsaG009501 | MsaG045222 | 0.811670 | 1.069783e-50 | 1.902981e-48 |
MsaG009657 | MsaG045222 | 0.806167 | 1.589109e-49 | 2.475890e-47 |
MsaG010053 | MsaG045222 | 0.810274 | 2.138741e-50 | 3.676812e-48 |
MsaG010066 | MsaG045222 | 0.849263 | 6.868139e-60 | 3.630045e-57 |
MsaG010394 | MsaG045222 | 0.816388 | 9.848262e-52 | 1.972021e-49 |
MsaG010517 | MsaG045222 | 0.855743 | 9.960659e-62 | 6.609882e-59 |
MsaG010533 | MsaG045222 | 0.819115 | 2.403660e-52 | 5.164883e-50 |
MsaG010835 | MsaG045222 | 0.812055 | 8.825473e-51 | 1.584822e-48 |
MsaG010894 | MsaG045222 | 0.801591 | 1.404082e-48 | 1.967901e-46 |
MsaG011080 | MsaG045222 | 0.812188 | 8.259769e-51 | 1.488122e-48 |
MsaG011275 | MsaG045222 | 0.835950 | 2.273473e-56 | 7.835122e-54 |
MsaG011528 | MsaG045222 | 0.816646 | 8.626280e-52 | 1.738724e-49 |
MsaG011806 | MsaG045222 | 0.828482 | 1.569854e-54 | 4.351713e-52 |
MsaG012120 | MsaG045222 | 0.805153 | 2.589072e-49 | 3.939175e-47 |
MsaG012263 | MsaG045222 | 0.804617 | 3.345882e-49 | 5.027630e-47 |
MsaG012304 | MsaG045222 | 0.823901 | 1.909086e-53 | 4.660522e-51 |
MsaG012380 | MsaG045222 | 0.800241 | 2.642261e-48 | 3.591907e-46 |
MsaG012382 | MsaG045222 | 0.820138 | 1.408005e-52 | 3.108138e-50 |
MsaG012422 | MsaG045222 | 0.821736 | 6.059543e-53 | 1.395419e-50 |
MsaG041899 | MsaG045222 | 0.825786 | 6.888098e-54 | 1.770764e-51 |
MsaG041900 | MsaG045222 | 0.826595 | 4.431913e-54 | 1.165233e-51 |
MsaG041901 | MsaG045222 | 0.832438 | 1.709637e-55 | 5.309071e-53 |
MsaG041902 | MsaG045222 | 0.825555 | 7.812097e-54 | 1.995397e-51 |
MsaG041903 | MsaG045222 | 0.823227 | 2.739886e-53 | 6.567588e-51 |
MsaG041904 | MsaG045222 | 0.811556 | 1.132067e-50 | 2.008195e-48 |
MsaG043415 | MsaG045222 | 0.830210 | 6.002191e-55 | 1.747565e-52 |
MsaG044336 | MsaG045222 | 0.810351 | 2.058509e-50 | 3.545708e-48 |
MsaG044354 | MsaG045222 | 0.807246 | 9.426774e-50 | 1.506574e-47 |
MsaG044384 | MsaG045222 | 0.860759 | 3.252039e-63 | 2.602998e-60 |
MsaG044885 | MsaG045222 | 0.806667 | 1.248244e-49 | 1.967909e-47 |
MsaG045021 | MsaG045222 | 0.814999 | 2.001811e-51 | 3.869651e-49 |
MsaG045072 | MsaG045222 | 0.837762 | 7.878795e-57 | 2.868600e-54 |
MsaG045222 | MsaG045403 | 0.826564 | 4.508876e-54 | 1.184441e-51 |
MsaG045222 | MsaG045445 | 0.819149 | 2.361869e-52 | 5.079541e-50 |
MsaG045222 | MsaG045452 | 0.806369 | 1.441517e-49 | 2.256728e-47 |
MsaG045222 | MsaG045487 | 0.828852 | 1.279448e-54 | 3.583335e-52 |
MsaG045222 | MsaG045611 | 0.858686 | 1.358652e-62 | 1.005065e-59 |
MsaG045222 | MsaG046053 | 0.856963 | 4.385529e-62 | 3.042848e-59 |
MsaG045222 | MsaG046423 | 0.822134 | 4.905554e-53 | 1.141735e-50 |
MsaG045222 | MsaG046367 | 0.803194 | 6.590689e-49 | 9.582452e-47 |
MsaG045222 | MsaG046383 | 0.840570 | 1.486273e-57 | 5.906821e-55 |
MsaG045222 | MsaG046556 | 0.855179 | 1.450822e-61 | 9.433526e-59 |
MsaG045222 | MsaG046588 | 0.809424 | 3.252941e-50 | 5.478431e-48 |
MsaG045222 | MsaG046770 | 0.801352 | 1.571145e-48 | 2.190141e-46 |
MsaG045222 | MsaG046807 | 0.841572 | 8.127877e-58 | 3.334300e-55 |
MsaG045222 | MsaG046808 | 0.817495 | 5.571250e-52 | 1.147838e-49 |
MsaG045222 | MsaG046862 | 0.811446 | 1.196114e-50 | 2.116056e-48 |
MsaG045222 | MsaG047004 | 0.804662 | 3.275075e-49 | 4.926309e-47 |
MsaG045222 | MsaG047054 | 0.855561 | 1.124631e-61 | 7.414957e-59 |
MsaG045222 | MsaG047055 | 0.802315 | 9.988781e-49 | 1.423302e-46 |
MsaG045222 | MsaG004907 | 0.806781 | 1.181379e-49 | 1.867513e-47 |
MsaG045222 | MsaG002437 | 0.838236 | 5.960582e-57 | 2.202019e-54 |
MsaG045222 | MsaG000067 | 0.846936 | 2.994002e-59 | 1.462919e-56 |
MsaG045222 | MsaG003742 | 0.836487 | 1.662947e-56 | 5.824565e-54 |
MsaG045222 | MsaG008796 | 0.855146 | 1.483369e-61 | 9.633441e-59 |
MsaG045222 | MsaG009037 | 0.858117 | 2.003807e-62 | 1.451124e-59 |
MsaG045222 | MsaG009542 | 0.805366 | 2.336505e-49 | 3.572535e-47 |
MsaG045222 | MsaG013401 | 0.817323 | 6.088565e-52 | 1.248881e-49 |
MsaG045222 | MsaG014449 | 0.800706 | 2.125977e-48 | 2.920783e-46 |
MsaG045222 | MsaG014180 | 0.857738 | 2.593944e-62 | 1.852377e-59 |
MsaG045222 | MsaG011676 | 0.822458 | 4.129248e-53 | 9.694457e-51 |
MsaG045222 | MsaG014275 | 0.816576 | 8.944067e-52 | 1.799602e-49 |
MsaG045222 | MsaG012695 | 0.810039 | 2.401623e-50 | 4.105191e-48 |
MsaG045222 | MsaG026431 | 0.811563 | 1.128447e-50 | 2.002097e-48 |
MsaG045222 | MsaG029571 | 0.823120 | 2.900465e-53 | 6.932479e-51 |
MsaG045222 | MsaG031950 | 0.804224 | 4.037488e-49 | 6.012043e-47 |
MsaG045222 | MsaG032410 | 0.830632 | 4.738650e-55 | 1.396343e-52 |
MsaG045222 | MsaG032931 | 0.821305 | 7.612475e-53 | 1.733103e-50 |
MsaG045222 | MsaG032980 | 0.836022 | 2.180374e-56 | 7.530612e-54 |
MsaG045222 | MsaG032243 | 0.841209 | 1.012223e-57 | 4.104683e-55 |
MsaG045222 | MsaG032845 | 0.821248 | 7.846183e-53 | 1.783616e-50 |
MsaG045222 | MsaG031747 | 0.802346 | 9.842186e-49 | 1.403428e-46 |
MsaG045222 | MsaG033148 | 0.829727 | 7.862600e-55 | 2.257783e-52 |
MsaG045222 | MsaG033325 | 0.858095 | 2.033804e-62 | 1.471735e-59 |
MsaG045222 | MsaG034264 | 0.843104 | 3.205754e-58 | 1.381168e-55 |
MsaG045222 | MsaG040848 | 0.808009 | 6.504291e-50 | 1.058727e-47 |
MsaG045222 | MsaG036873 | 0.800082 | 2.845533e-48 | 3.854449e-46 |
MsaG045222 | MsaG037271 | 0.817282 | 6.219183e-52 | 1.274353e-49 |
MsaG045222 | MsaG038765 | 0.807519 | 8.255090e-50 | 1.328000e-47 |
MsaG045222 | MsaG037384 | 0.836817 | 1.371743e-56 | 4.852657e-54 |
MsaG045222 | MsaG037156 | 0.805408 | 2.290122e-49 | 3.504993e-47 |
MsaG045222 | MsaG037161 | 0.824674 | 1.258630e-53 | 3.137965e-51 |
MsaG045222 | MsaG040703 | 0.813558 | 4.151870e-51 | 7.740498e-49 |
MsaG045222 | MsaG037786 | 0.801678 | 1.348447e-48 | 1.893647e-46 |
MsaG045222 | MsaG036542 | 0.825077 | 1.012382e-53 | 2.552049e-51 |
MsaG045222 | MsaG039226 | 0.823176 | 2.814618e-53 | 6.737505e-51 |
MsaG045222 | MsaG039736 | 0.848455 | 1.148018e-59 | 5.902543e-57 |
MsaG045222 | MsaG036984 | 0.817947 | 4.410197e-52 | 9.192764e-50 |
MsaG045222 | MsaG039603 | 0.804631 | 3.323467e-49 | 4.995550e-47 |
MsaG045222 | MsaG043490 | 0.815058 | 1.942849e-51 | 3.761128e-49 |
MsaG045222 | MsaG045876 | 0.807725 | 7.468631e-50 | 1.207435e-47 |
MsaG045222 | MsaG043458 | 0.801191 | 1.694549e-48 | 2.353546e-46 |
MsaG013325 | MsaG045222 | 0.807828 | 7.102152e-50 | 1.151033e-47 |
MsaG013621 | MsaG045222 | 0.819262 | 2.226038e-52 | 4.801727e-50 |
MsaG013644 | MsaG045222 | 0.819110 | 2.410094e-52 | 5.178009e-50 |
MsaG013909 | MsaG045222 | 0.805944 | 1.769620e-49 | 2.742605e-47 |
MsaG013993 | MsaG045222 | 0.805910 | 1.799087e-49 | 2.786004e-47 |
MsaG014184 | MsaG045222 | 0.820680 | 1.058989e-52 | 2.371220e-50 |
MsaG014810 | MsaG045222 | 0.823281 | 2.661689e-53 | 6.389809e-51 |
MsaG014927 | MsaG045222 | 0.818765 | 2.885033e-52 | 6.142289e-50 |
MsaG015176 | MsaG045222 | 0.820380 | 1.239525e-52 | 2.753795e-50 |
MsaG015216 | MsaG045222 | 0.832262 | 1.889642e-55 | 5.838095e-53 |
MsaG015202 | MsaG045222 | 0.850261 | 3.624430e-60 | 1.981829e-57 |
MsaG015269 | MsaG045222 | 0.818355 | 3.570790e-52 | 7.521479e-50 |
MsaG015978 | MsaG045222 | 0.823151 | 2.853356e-53 | 6.825457e-51 |
MsaG016149 | MsaG045222 | 0.801064 | 1.798160e-48 | 2.490255e-46 |
MsaG016685 | MsaG045222 | 0.811254 | 1.316065e-50 | 2.317326e-48 |
MsaG017058 | MsaG045222 | 0.875378 | 6.697309e-68 | 9.792414e-65 |
MsaG017110 | MsaG045222 | 0.815510 | 1.542989e-51 | 3.021439e-49 |
MsaG017173 | MsaG045222 | 0.829049 | 1.147066e-54 | 3.230594e-52 |
MsaG017209 | MsaG045222 | 0.830621 | 4.769580e-55 | 1.404991e-52 |
MsaG017251 | MsaG045222 | 0.801994 | 1.162072e-48 | 1.643670e-46 |
MsaG017691 | MsaG045222 | 0.804459 | 3.609220e-49 | 5.403430e-47 |
MsaG017820 | MsaG045222 | 0.831087 | 3.670397e-55 | 1.095839e-52 |
MsaG018248 | MsaG045222 | 0.877365 | 1.392210e-68 | 2.225779e-65 |
MsaG018372 | MsaG045222 | 0.850208 | 3.751363e-60 | 2.047482e-57 |
MsaG018813 | MsaG045222 | 0.843478 | 2.551560e-58 | 1.112586e-55 |
MsaG018773 | MsaG045222 | 0.816208 | 1.080108e-51 | 2.152929e-49 |
MsaG019410 | MsaG045222 | 0.805936 | 1.776598e-49 | 2.752885e-47 |
MsaG019420 | MsaG045222 | 0.808373 | 5.443765e-50 | 8.938804e-48 |
MsaG019639 | MsaG045222 | 0.819616 | 1.850372e-52 | 4.028257e-50 |
MsaG019731 | MsaG045222 | 0.830359 | 5.523007e-55 | 1.614888e-52 |
MsaG020228 | MsaG045222 | 0.819112 | 2.407849e-52 | 5.173382e-50 |
MsaG020290 | MsaG045222 | 0.846731 | 3.403419e-59 | 1.651772e-56 |
MsaG020580 | MsaG045222 | 0.835616 | 2.760839e-56 | 9.419966e-54 |
MsaG020843 | MsaG045222 | 0.800267 | 2.609711e-48 | 3.549812e-46 |
MsaG020874 | MsaG045222 | 0.835582 | 2.814886e-56 | 9.594463e-54 |
MsaG020875 | MsaG045222 | 0.826972 | 3.606217e-54 | 9.581472e-52 |
MsaG021201 | MsaG045222 | 0.801191 | 1.694405e-48 | 2.353354e-46 |
MsaG021668 | MsaG045222 | 0.815083 | 1.917751e-51 | 3.714914e-49 |
MsaG021863 | MsaG045222 | 0.833357 | 1.013392e-55 | 3.232691e-53 |
MsaG021896 | MsaG045222 | 0.803149 | 6.732090e-49 | 9.777695e-47 |
MsaG023743 | MsaG045222 | 0.814396 | 2.718996e-51 | 5.176758e-49 |
MsaG023884 | MsaG045222 | 0.832977 | 1.258435e-55 | 3.969845e-53 |
MsaG023971 | MsaG045222 | 0.824961 | 1.077963e-53 | 2.708750e-51 |
MsaG025148 | MsaG045222 | 0.809521 | 3.101315e-50 | 5.235410e-48 |
MsaG025484 | MsaG045222 | 0.837750 | 7.933792e-57 | 2.887552e-54 |
MsaG025691 | MsaG045222 | 0.813730 | 3.807860e-51 | 7.129608e-49 |
MsaG026721 | MsaG045222 | 0.847723 | 1.824673e-59 | 9.155079e-57 |
MsaG026714 | MsaG045222 | 0.824724 | 1.225188e-53 | 3.058719e-51 |
MsaG026970 | MsaG045222 | 0.818667 | 3.035323e-52 | 6.445748e-50 |
MsaG027039 | MsaG045222 | 0.835295 | 3.324315e-56 | 1.123388e-53 |
MsaG027361 | MsaG045222 | 0.822440 | 4.168769e-53 | 9.782541e-51 |
MsaG027340 | MsaG045222 | 0.801867 | 1.233396e-48 | 1.739596e-46 |
MsaG027568 | MsaG045222 | 0.814682 | 2.351498e-51 | 4.509298e-49 |
MsaG027766 | MsaG045222 | 0.808726 | 4.581710e-50 | 7.587790e-48 |
MsaG027800 | MsaG045222 | 0.816166 | 1.103840e-51 | 2.197857e-49 |
MsaG027780 | MsaG045222 | 0.805090 | 2.667609e-49 | 4.052763e-47 |
MsaG028001 | MsaG045222 | 0.841122 | 1.066223e-57 | 4.311981e-55 |
MsaG028034 | MsaG045222 | 0.811516 | 1.154810e-50 | 2.046497e-48 |
MsaG028069 | MsaG045222 | 0.838038 | 6.699010e-57 | 2.459763e-54 |
MsaG028257 | MsaG045222 | 0.808841 | 4.330670e-50 | 7.191846e-48 |
MsaG028374 | MsaG045222 | 0.801620 | 1.385540e-48 | 1.943177e-46 |
MsaG028351 | MsaG045222 | 0.800627 | 2.206066e-48 | 3.025371e-46 |
MsaG028442 | MsaG045222 | 0.808474 | 5.182477e-50 | 8.530556e-48 |
MsaG028456 | MsaG045222 | 0.806205 | 1.560570e-49 | 2.433704e-47 |
MsaG028457 | MsaG045222 | 0.815197 | 1.809871e-51 | 3.516171e-49 |
MsaG028485 | MsaG045222 | 0.823539 | 2.317418e-53 | 5.602233e-51 |
MsaG028501 | MsaG045222 | 0.836293 | 1.862846e-56 | 6.486779e-54 |
MsaG028503 | MsaG045222 | 0.820965 | 9.112716e-53 | 2.056112e-50 |
MsaG028554 | MsaG045222 | 0.850106 | 4.004552e-60 | 2.177942e-57 |
MsaG028715 | MsaG045222 | 0.801523 | 1.449772e-48 | 2.028807e-46 |
MsaG028716 | MsaG045222 | 0.849083 | 7.702045e-60 | 4.046021e-57 |
MsaG028811 | MsaG045222 | 0.829803 | 7.536360e-55 | 2.168772e-52 |
MsaG028979 | MsaG045222 | 0.807366 | 8.893971e-50 | 1.425513e-47 |
MsaG028929 | MsaG045222 | 0.809950 | 2.509955e-50 | 4.281093e-48 |
MsaG029320 | MsaG045222 | 0.805282 | 2.433590e-49 | 3.713579e-47 |
MsaG029324 | MsaG045222 | 0.805426 | 2.270551e-49 | 3.476450e-47 |
MsaG029335 | MsaG045222 | 0.812326 | 7.710297e-51 | 1.393882e-48 |
MsaG029593 | MsaG045222 | 0.855015 | 1.619182e-61 | 1.046569e-58 |
MsaG029899 | MsaG045222 | 0.804170 | 4.141542e-49 | 6.159249e-47 |
MsaG029948 | MsaG045222 | 0.810641 | 1.783675e-50 | 3.093998e-48 |
MsaG030084 | MsaG045222 | 0.824605 | 1.306342e-53 | 3.250798e-51 |
MsaG030332 | MsaG045222 | 0.807219 | 9.552505e-50 | 1.525698e-47 |
MsaG030471 | MsaG045222 | 0.835171 | 3.571579e-56 | 1.202454e-53 |
MsaG030501 | MsaG045222 | 0.811566 | 1.126864e-50 | 1.999418e-48 |
MsaG030507 | MsaG045222 | 0.850514 | 3.081943e-60 | 1.700075e-57 |
MsaG030801 | MsaG045222 | 0.804908 | 2.911002e-49 | 4.403896e-47 |
MsaG031427 | MsaG045222 | 0.815334 | 1.688139e-51 | 3.291022e-49 |
MsaG031735 | MsaG045222 | 0.811190 | 1.358641e-50 | 2.388556e-48 |
MsaG032062 | MsaG045222 | 0.806427 | 1.402014e-49 | 2.197931e-47 |
MsaG032068 | MsaG045222 | 0.852711 | 7.406462e-61 | 4.410987e-58 |
MsaG033249 | MsaG045222 | 0.812183 | 8.278391e-51 | 1.491325e-48 |
MsaG033481 | MsaG045222 | 0.822748 | 3.538853e-53 | 8.373700e-51 |
MsaG033693 | MsaG045222 | 0.817616 | 5.233860e-52 | 1.081639e-49 |
MsaG033831 | MsaG045222 | 0.831797 | 2.458879e-55 | 7.495395e-53 |
MsaG034079 | MsaG045222 | 0.811620 | 1.096548e-50 | 1.948230e-48 |
MsaG034172 | MsaG045222 | 0.809871 | 2.609727e-50 | 4.442731e-48 |
MsaG034259 | MsaG045222 | 0.819365 | 2.110412e-52 | 4.564552e-50 |
MsaG034415 | MsaG045222 | 0.819940 | 1.562191e-52 | 3.430310e-50 |
MsaG034827 | MsaG045222 | 0.851180 | 2.004099e-60 | 1.131296e-57 |
MsaG034828 | MsaG045222 | 0.847494 | 2.107378e-59 | 1.049240e-56 |
MsaG034829 | MsaG045222 | 0.854529 | 2.235299e-61 | 1.420084e-58 |
MsaG036047 | MsaG045222 | 0.815095 | 1.906562e-51 | 3.694326e-49 |
MsaG036332 | MsaG045222 | 0.820101 | 1.435551e-52 | 3.165841e-50 |
MsaG038016 | MsaG045222 | 0.871761 | 1.093274e-66 | 1.365396e-63 |
MsaG038421 | MsaG045222 | 0.820659 | 1.070325e-52 | 2.395385e-50 |
MsaG039196 | MsaG045222 | 0.800845 | 1.992799e-48 | 2.746250e-46 |
MsaG039206 | MsaG045222 | 0.804127 | 4.227554e-49 | 6.280908e-47 |
MsaG039621 | MsaG045222 | 0.839104 | 3.564012e-57 | 1.352833e-54 |
MsaG040187 | MsaG045222 | 0.816018 | 1.190606e-51 | 2.361637e-49 |
MsaG040669 | MsaG045222 | 0.808602 | 4.867985e-50 | 8.037429e-48 |
MsaG041071 | MsaG045222 | 0.803050 | 7.055831e-49 | 1.022461e-46 |
MsaG041116 | MsaG045222 | 0.805447 | 2.248355e-49 | 3.444173e-47 |
MsaG041271 | MsaG045222 | 0.807330 | 9.049935e-50 | 1.449285e-47 |
MsaG041300 | MsaG045222 | 0.842260 | 5.359195e-58 | 2.247123e-55 |
MsaG041336 | MsaG045222 | 0.806491 | 1.359383e-49 | 2.134262e-47 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG045222 | MtrunA17_Chr1g0203051 | 52.514 | 179 | 75 | 2 | 1 | 177 | 1 | 171 | 6.25e-51 | 182 |
MsaG045222 | MtrunA17_Chr1g0203051 | 50.667 | 75 | 37 | 0 | 177 | 251 | 547 | 621 | 1.70e-16 | 82.0 |
MsaG045222 | MtrunA17_Chr8g0389811 | 47.863 | 117 | 59 | 1 | 61 | 175 | 58 | 174 | 3.78e-34 | 127 |
MsaG045222 | MtrunA17_Chr2g0331371 | 42.105 | 114 | 64 | 1 | 68 | 179 | 36 | 149 | 1.31e-23 | 98.2 |
MsaG045222 | MtrunA17_Chr6g0473421 | 37.984 | 129 | 73 | 3 | 35 | 160 | 6 | 130 | 2.01e-23 | 95.9 |
MsaG045222 | MtrunA17_Chr1g0171741 | 34.503 | 171 | 103 | 5 | 11 | 177 | 59 | 224 | 2.11e-20 | 90.5 |
MsaG045222 | MtrunA17_Chr1g0172931 | 41.818 | 110 | 62 | 1 | 60 | 167 | 49 | 158 | 1.83e-19 | 85.1 |
MsaG045222 | MtrunA17_Chr2g0308841 | 42.529 | 87 | 50 | 0 | 177 | 263 | 140 | 226 | 5.42e-15 | 74.7 |
MsaG045222 | MtrunA17_Chr2g0287651 | 36.364 | 110 | 68 | 1 | 70 | 177 | 58 | 167 | 8.03e-14 | 73.9 |
MsaG045222 | MtrunA17_Chr7g0228051 | 50.000 | 68 | 31 | 1 | 32 | 96 | 18 | 85 | 1.82e-11 | 60.1 |
MsaG045222 | MtrunA17_Chr1g0203721 | 29.218 | 243 | 137 | 11 | 49 | 266 | 393 | 625 | 8.78e-11 | 64.3 |
MsaG045222 | MtrunA17_Chr5g0448511 | 26.562 | 192 | 137 | 2 | 192 | 379 | 325 | 516 | 9.24e-11 | 63.9 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG045222 | AT2G27110.2 | 35.000 | 100 | 56 | 2 | 185 | 278 | 503 | 599 | 2.87e-11 | 66.2 |
MsaG045222 | AT2G27110.1 | 35.000 | 100 | 56 | 2 | 185 | 278 | 503 | 599 | 2.87e-11 | 66.2 |
MsaG045222 | AT2G27110.3 | 35.000 | 100 | 56 | 2 | 185 | 278 | 358 | 454 | 3.23e-11 | 65.9 |
Find 92 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
ATTTAAATGTCAACCGTTCT+TGG | 0.283454 | 8:-70190292 | None:intergenic |
CAACTAAACGATCCTGAAAA+TGG | 0.285819 | 8:-70188794 | None:intergenic |
CCTCTGAACCTTCCGCATTA+AGG | 0.302211 | 8:-70188472 | None:intergenic |
CGTTCCATCACAAGACATTC+TGG | 0.328402 | 8:-70190398 | None:intergenic |
GCTTAATGATTCCAATGTTT+CGG | 0.343715 | 8:-70190606 | None:intergenic |
TGCAAAAGATTCGAGACATT+TGG | 0.377751 | 8:+70190320 | MsaT045222.1:CDS |
GATTCCATCTTTAGCACGTT+TGG | 0.386420 | 8:-70190426 | None:intergenic |
GACATTTACAGTTCGTTGTA+TGG | 0.387972 | 8:+70188678 | MsaT045222.1:CDS |
CATCCACATATGCCACATTT+CGG | 0.392359 | 8:-70190770 | None:intergenic |
TTTGTCATAGAGAAGGTTAC+AGG | 0.397074 | 8:+70188919 | MsaT045222.1:CDS |
AGGGTATTTGAAAACATTGT+AGG | 0.400513 | 8:-70190237 | None:intergenic |
TATACACAAAACCATGGAAA+TGG | 0.430787 | 8:+70190571 | MsaT045222.1:CDS |
ATGATGAAGACTCGGAAGAT+TGG | 0.445167 | 8:+70190879 | MsaT045222.1:CDS |
AAAGCCGTGTTGTTAAGAAC+AGG | 0.447436 | 8:+70188868 | MsaT045222.1:CDS |
TAAGCAGTTTAGGCCCGTAT+TGG | 0.451250 | 8:+70190160 | MsaT045222.1:intron |
ACCAGTTATGTCGCTTACAT+TGG | 0.451744 | 8:-70188441 | None:intergenic |
GATGTTCGCAACTGATGAAC+CGG | 0.455923 | 8:+70191087 | MsaT045222.1:CDS |
ACCCTAGGGATGATATTCAT+TGG | 0.456636 | 8:+70190255 | MsaT045222.1:CDS |
CCCAATGTAAGCGACATAAC+TGG | 0.464104 | 8:+70188440 | MsaT045222.1:CDS |
CCAGTTATGTCGCTTACATT+GGG | 0.465368 | 8:-70188440 | None:intergenic |
TCACATATCAATGATGATCA+AGG | 0.468748 | 8:+70190854 | MsaT045222.1:CDS |
TCTTCATCTCGTAATGTAAG+TGG | 0.469724 | 8:+70190728 | MsaT045222.1:CDS |
GAGAGCAGAAGGCAACTAGT+AGG | 0.491224 | 8:+70188970 | MsaT045222.1:CDS |
AACTAGTAGGTGTGGTTGCA+TGG | 0.492607 | 8:+70188983 | MsaT045222.1:CDS |
AAACATTGGAATCATTAAGC+AGG | 0.500216 | 8:+70190609 | MsaT045222.1:CDS |
ACATTTACAGTTCGTTGTAT+GGG | 0.501983 | 8:+70188679 | MsaT045222.1:CDS |
CATAGAGAAGGTTACAGGGT+TGG | 0.507010 | 8:+70188924 | MsaT045222.1:CDS |
CCGACTAGATCTCTCCAATA+CGG | 0.511443 | 8:-70190174 | None:intergenic |
CATGGACAATAGCTATTGTT+CGG | 0.512713 | 8:+70188620 | MsaT045222.1:CDS |
CCTTAAAATTAATTCTGTCA+AGG | 0.525060 | 8:-70188743 | None:intergenic |
TGGACCAAACGTGCTAAAGA+TGG | 0.531683 | 8:+70190422 | MsaT045222.1:CDS |
TGCGGAAGGTTCAGAGGTAG+AGG | 0.537083 | 8:+70188478 | MsaT045222.1:CDS |
GCAACTGATGAACCGGAGAA+TGG | 0.538478 | 8:+70191094 | MsaT045222.1:CDS |
ACCTTTGTTTGTCATAGAGA+AGG | 0.542041 | 8:+70188912 | MsaT045222.1:CDS |
AAGCGGAGTTCGCCGAAATG+TGG | 0.543560 | 8:+70190758 | MsaT045222.1:CDS |
TCGCCGAAATGTGGCATATG+TGG | 0.547405 | 8:+70190767 | MsaT045222.1:CDS |
GTGCAACTTTGACGATGAAA+CGG | 0.547511 | 8:+70188701 | MsaT045222.1:CDS |
TCCACACTTCAACACGGCAT+TGG | 0.549156 | 8:-70190537 | None:intergenic |
TCTGTCACTGAACCGACCAC+GGG | 0.550131 | 8:-70190650 | None:intergenic |
ATGTGGCATATGTGGATGTA+AGG | 0.551576 | 8:+70190775 | MsaT045222.1:CDS |
TTCTGTCACTGAACCGACCA+CGG | 0.554234 | 8:-70190651 | None:intergenic |
CGATAGGAAAAGAGAGCAGA+AGG | 0.554726 | 8:+70188959 | MsaT045222.1:CDS |
AATTTGTACGGTTGTGTACG+TGG | 0.562187 | 8:+70188831 | MsaT045222.1:CDS |
CTTCGTAGGCGACAAGGCTG+CGG | 0.566588 | 8:-70190804 | None:intergenic |
AACATTGGAATCATTAAGCA+GGG | 0.567060 | 8:+70190610 | MsaT045222.1:CDS |
CCGCAACGGCTTAAGAAAAG+AGG | 0.575682 | 8:+70190689 | MsaT045222.1:CDS |
CAACGGCTTAAGAAAAGAGG+TGG | 0.576611 | 8:+70190692 | MsaT045222.1:CDS |
ATCCAATGAATATCATCCCT+AGG | 0.577004 | 8:-70190257 | None:intergenic |
ACATACGTAGTTACAAATGC+AGG | 0.577104 | 8:-70190485 | None:intergenic |
GGAGAGTGATGTATGTTCCT+CGG | 0.577170 | 8:+70188641 | MsaT045222.1:CDS |
TGAAACGGCGGTTGATTGCA+TGG | 0.577332 | 8:+70188716 | MsaT045222.1:CDS |
GGTCATCATACACCATTCTC+CGG | 0.578756 | 8:-70191106 | None:intergenic |
CGACTAGATCTCTCCAATAC+GGG | 0.579381 | 8:-70190173 | None:intergenic |
TCCAATGAATATCATCCCTA+GGG | 0.582068 | 8:-70190256 | None:intergenic |
CACATATCAATGATGATCAA+GGG | 0.585150 | 8:+70190855 | MsaT045222.1:CDS |
CAGAAGGCAACTAGTAGGTG+TGG | 0.587238 | 8:+70188975 | MsaT045222.1:CDS |
GTACACGTTGACGCTGGTAG+CGG | 0.591900 | 8:+70189017 | MsaT045222.1:CDS |
TTGACGCTGGTAGCGGTCGA+TGG | 0.592302 | 8:+70189024 | MsaT045222.1:CDS |
TAAATATATACACAAAACCA+TGG | 0.595738 | 8:+70190565 | MsaT045222.1:CDS |
CCTTAATGCGGAAGGTTCAG+AGG | 0.595778 | 8:+70188472 | MsaT045222.1:CDS |
CGTGTTGTTAAGAACAGGGA+TGG | 0.599865 | 8:+70188873 | MsaT045222.1:CDS |
TTGTCATAGAGAAGGTTACA+GGG | 0.601328 | 8:+70188920 | MsaT045222.1:CDS |
GTTGATGAATTGCCCGTGGT+CGG | 0.602393 | 8:+70190638 | MsaT045222.1:CDS |
CATCCCTGTTCTTAACAACA+CGG | 0.608258 | 8:-70188872 | None:intergenic |
GCCAATGCCGTGTTGAAGTG+TGG | 0.608683 | 8:+70190536 | MsaT045222.1:CDS |
TAAAGTCTTCGTAGGCGACA+AGG | 0.612256 | 8:-70190810 | None:intergenic |
GGATGCAACCTTAATGCGGA+AGG | 0.614546 | 8:+70188464 | MsaT045222.1:CDS |
AAAGTTTAGGTAATCCGCAA+CGG | 0.615547 | 8:+70190675 | MsaT045222.1:CDS |
TCTAGTCGGTGCAAAGTCGA+AGG | 0.615809 | 8:+70190188 | MsaT045222.1:CDS |
ACCTTCTCTATGACAAACAA+AGG | 0.615884 | 8:-70188913 | None:intergenic |
CGTTGAGCGATGTAAGAGGA+TGG | 0.618826 | 8:+70190514 | MsaT045222.1:CDS |
TGTTCGTTGAGCGATGTAAG+AGG | 0.622081 | 8:+70190510 | MsaT045222.1:CDS |
ATGTACATTAAAGTCTTCGT+AGG | 0.624035 | 8:-70190818 | None:intergenic |
TTGGAAGTAATGCTGCCGAT+AGG | 0.626637 | 8:+70188943 | MsaT045222.1:CDS |
TAGTTACAAATGCAGGATCA+CGG | 0.636049 | 8:-70190478 | None:intergenic |
GTCTTCGACATCTTCATCCG+AGG | 0.643998 | 8:-70188658 | None:intergenic |
AATGTAAGCGACATAACTGG+TGG | 0.647899 | 8:+70188443 | MsaT045222.1:CDS |
GGAAGATTGGAACACACCCA+TGG | 0.654797 | 8:+70190892 | MsaT045222.1:CDS |
TCAAGGGTATGATGAAGACT+CGG | 0.658393 | 8:+70190871 | MsaT045222.1:CDS |
AGGATCTCCACACTTCAACA+CGG | 0.660448 | 8:-70190543 | None:intergenic |
ATTCAAGTACACGTTGACGC+TGG | 0.666323 | 8:+70189011 | MsaT045222.1:CDS |
ACTGCCAGAATGTCTTGTGA+TGG | 0.666806 | 8:+70190394 | MsaT045222.1:CDS |
TGGTGGATGCAACCTTAATG+CGG | 0.674046 | 8:+70188460 | MsaT045222.1:CDS |
AAGCCGTGTTGTTAAGAACA+GGG | 0.681295 | 8:+70188869 | MsaT045222.1:CDS |
GTCGAAGGTGATGTGCGCAG+TGG | 0.682048 | 8:+70190203 | MsaT045222.1:CDS |
ACATGTAAGATATGTTCACA+AGG | 0.686637 | 8:-70190347 | None:intergenic |
CCGTATTGGAGAGATCTAGT+CGG | 0.690217 | 8:+70190174 | MsaT045222.1:CDS |
TGAAGTTGATGAATTGCCCG+TGG | 0.692394 | 8:+70190634 | MsaT045222.1:CDS |
CAACTTTGACGATGAAACGG+CGG | 0.704083 | 8:+70188704 | MsaT045222.1:CDS |
AATGTCTTGTGATGGAACGA+TGG | 0.705741 | 8:+70190402 | MsaT045222.1:CDS |
ACATTGGAATCATTAAGCAG+GGG | 0.706809 | 8:+70190611 | MsaT045222.1:CDS |
TAGGGTCGGATGAAATCATG+CGG | 0.716997 | 8:+70188769 | MsaT045222.1:CDS |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr8 | gene | 70188404 | 70191123 | 70188404 | ID=MsaG045222 |
Chr8 | mRNA | 70188404 | 70191123 | 70188404 | ID=MsaT045222.1;Parent=MsaG045222 |
Chr8 | exon | 70188404 | 70188499 | 70188404 | ID=MsaT045222.1.exon1;Parent=MsaT045222.1 |
Chr8 | CDS | 70188404 | 70188499 | 70188404 | ID=cds.MsaT045222.1;Parent=MsaT045222.1 |
Chr8 | exon | 70188618 | 70189045 | 70188618 | ID=MsaT045222.1.exon2;Parent=MsaT045222.1 |
Chr8 | CDS | 70188618 | 70189045 | 70188618 | ID=cds.MsaT045222.1;Parent=MsaT045222.1 |
Chr8 | exon | 70190172 | 70190913 | 70190172 | ID=MsaT045222.1.exon3;Parent=MsaT045222.1 |
Chr8 | CDS | 70190172 | 70190913 | 70190172 | ID=cds.MsaT045222.1;Parent=MsaT045222.1 |
Chr8 | exon | 70191070 | 70191123 | 70191070 | ID=MsaT045222.1.exon4;Parent=MsaT045222.1 |
Chr8 | CDS | 70191070 | 70191123 | 70191070 | ID=cds.MsaT045222.1;Parent=MsaT045222.1 |
Gene Sequence |
Protein sequence |