Alfalfa Gene Editing Database
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG046546 | Q40359.1 | 99.611 | 257 | 1 | 0 | 1 | 257 | 1 | 257 | 0.0 | 536 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG046546 | sp|Q40359|ALFIN_MEDSA | 99.611 | 257 | 1 | 0 | 1 | 257 | 1 | 257 | 0.0 | 536 |
Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG046546 | tr|A0A072UTR5|A0A072UTR5_MEDTR | 99.611 | 257 | 0 | 1 | 1 | 257 | 1 | 256 | 0.0 | 532 |
Gene ID | Type | Classification |
---|---|---|
MsaG046546 | TF | Alfin-like |
Gene ID | Type | Classification |
---|
Co-expression Network
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MsaG000093 | MsaG046546 | 0.842970 | 3.479495e-58 | 1.492635e-55 |
MsaG000117 | MsaG046546 | 0.851391 | 1.748502e-60 | 9.942076e-58 |
MsaG000309 | MsaG046546 | 0.818347 | 3.585114e-52 | 7.550119e-50 |
MsaG000578 | MsaG046546 | 0.815174 | 1.830943e-51 | 3.554968e-49 |
MsaG000514 | MsaG046546 | 0.855190 | 1.440353e-61 | 9.369058e-59 |
MsaG000547 | MsaG046546 | 0.818950 | 2.620103e-52 | 5.605458e-50 |
MsaG000759 | MsaG046546 | 0.822280 | 4.539482e-53 | 1.060668e-50 |
MsaG000760 | MsaG046546 | 0.829527 | 8.788704e-55 | 2.509327e-52 |
MsaG000828 | MsaG046546 | 0.818389 | 3.507335e-52 | 7.394506e-50 |
MsaG000982 | MsaG046546 | 0.822313 | 4.461129e-53 | 1.043314e-50 |
MsaG001001 | MsaG046546 | 0.884264 | 4.774137e-71 | 1.055149e-67 |
MsaG001366 | MsaG046546 | 0.822214 | 4.702695e-53 | 1.096845e-50 |
MsaG001496 | MsaG046546 | 0.827262 | 3.075296e-54 | 8.237553e-52 |
MsaG002021 | MsaG046546 | 0.832726 | 1.451703e-55 | 4.546127e-53 |
MsaG003423 | MsaG046546 | 0.813214 | 4.937203e-51 | 9.125546e-49 |
MsaG003657 | MsaG046546 | 0.817738 | 4.915553e-52 | 1.019046e-49 |
MsaG004012 | MsaG046546 | 0.857511 | 3.024852e-62 | 2.141873e-59 |
MsaG004279 | MsaG046546 | 0.853742 | 3.762682e-61 | 2.324080e-58 |
MsaG004479 | MsaG046546 | 0.864369 | 2.547229e-64 | 2.346634e-61 |
MsaG004480 | MsaG046546 | 0.811680 | 1.064452e-50 | 1.893962e-48 |
MsaG004754 | MsaG046546 | 0.880064 | 1.575978e-69 | 2.852472e-66 |
MsaG004760 | MsaG046546 | 0.804176 | 4.130526e-49 | 6.143662e-47 |
MsaG004793 | MsaG046546 | 0.828897 | 1.247805e-54 | 3.499265e-52 |
MsaG004830 | MsaG046546 | 0.834509 | 5.234187e-56 | 1.727714e-53 |
MsaG004827 | MsaG046546 | 0.828209 | 1.826059e-54 | 5.023015e-52 |
MsaG004910 | MsaG046546 | 0.803215 | 6.522894e-49 | 9.488526e-47 |
MsaG004929 | MsaG046546 | 0.917597 | 1.102686e-85 | 1.748785e-81 |
MsaG004938 | MsaG046546 | 0.803535 | 5.605226e-49 | 8.214124e-47 |
MsaG004977 | MsaG046546 | 0.839714 | 2.479681e-57 | 9.593381e-55 |
MsaG005051 | MsaG046546 | 0.817068 | 6.943557e-52 | 1.414930e-49 |
MsaG005405 | MsaG046546 | 0.883701 | 7.690846e-71 | 1.654300e-67 |
MsaG005537 | MsaG046546 | 0.843864 | 2.013653e-58 | 8.889066e-56 |
MsaG005830 | MsaG046546 | 0.809051 | 3.906629e-50 | 6.520470e-48 |
MsaG006029 | MsaG046546 | 0.806129 | 1.618531e-49 | 2.519464e-47 |
MsaG006133 | MsaG046546 | 0.851638 | 1.490145e-60 | 8.545929e-58 |
MsaG006249 | MsaG046546 | 0.825167 | 9.641733e-54 | 2.436541e-51 |
MsaG006304 | MsaG046546 | 0.837057 | 1.192162e-56 | 4.247981e-54 |
MsaG006334 | MsaG046546 | 0.819972 | 1.535934e-52 | 3.375596e-50 |
MsaG006572 | MsaG046546 | 0.824655 | 1.271571e-53 | 3.168544e-51 |
MsaG006561 | MsaG046546 | 0.811497 | 1.165866e-50 | 2.065169e-48 |
MsaG007109 | MsaG046546 | 0.852524 | 8.365579e-61 | 4.949159e-58 |
MsaG007159 | MsaG046546 | 0.824142 | 1.677089e-53 | 4.121002e-51 |
MsaG007296 | MsaG046546 | 0.845382 | 7.891232e-59 | 3.661891e-56 |
MsaG007274 | MsaG046546 | 0.826341 | 5.093181e-54 | 1.329674e-51 |
MsaG007568 | MsaG046546 | 0.801621 | 1.384679e-48 | 1.942028e-46 |
MsaG007861 | MsaG046546 | 0.839738 | 2.444046e-57 | 9.462776e-55 |
MsaG008035 | MsaG046546 | 0.808392 | 5.395231e-50 | 8.862889e-48 |
MsaG008085 | MsaG046546 | 0.832278 | 1.872818e-55 | 5.788714e-53 |
MsaG008479 | MsaG046546 | 0.801518 | 1.453720e-48 | 2.034064e-46 |
MsaG008615 | MsaG046546 | 0.825936 | 6.348677e-54 | 1.638996e-51 |
MsaG009059 | MsaG046546 | 0.829667 | 8.132458e-55 | 2.331254e-52 |
MsaG009068 | MsaG046546 | 0.840631 | 1.432516e-57 | 5.703919e-55 |
MsaG009265 | MsaG046546 | 0.877976 | 8.535345e-69 | 1.403147e-65 |
MsaG009701 | MsaG046546 | 0.814666 | 2.371166e-51 | 4.545118e-49 |
MsaG009703 | MsaG046546 | 0.865986 | 7.947077e-65 | 7.809920e-62 |
MsaG010213 | MsaG046546 | 0.802147 | 1.080830e-48 | 1.534117e-46 |
MsaG010571 | MsaG046546 | 0.856232 | 7.172515e-62 | 4.846235e-59 |
MsaG011235 | MsaG046546 | 0.810244 | 2.170812e-50 | 3.729238e-48 |
MsaG011528 | MsaG046546 | 0.832136 | 2.029594e-55 | 6.247998e-53 |
MsaG011824 | MsaG046546 | 0.815929 | 1.246043e-51 | 2.466043e-49 |
MsaG012186 | MsaG046546 | 0.821046 | 8.728661e-53 | 1.973681e-50 |
MsaG012206 | MsaG046546 | 0.855556 | 1.128690e-61 | 7.440123e-59 |
MsaG012261 | MsaG046546 | 0.807980 | 6.595214e-50 | 1.072783e-47 |
MsaG042142 | MsaG046546 | 0.803734 | 5.098508e-49 | 7.506228e-47 |
MsaG042222 | MsaG046546 | 0.822222 | 4.683571e-53 | 1.092608e-50 |
MsaG042327 | MsaG046546 | 0.819207 | 2.291817e-52 | 4.936368e-50 |
MsaG042557 | MsaG046546 | 0.810682 | 1.747659e-50 | 3.034465e-48 |
MsaG042898 | MsaG046546 | 0.813869 | 3.548351e-51 | 6.667205e-49 |
MsaG043414 | MsaG046546 | 0.804368 | 3.769808e-49 | 5.632114e-47 |
MsaG044227 | MsaG046546 | 0.817837 | 4.668636e-52 | 9.703741e-50 |
MsaG044218 | MsaG046546 | 0.807689 | 7.600793e-50 | 1.227706e-47 |
MsaG044411 | MsaG046546 | 0.806970 | 1.077933e-49 | 1.711539e-47 |
MsaG044389 | MsaG046546 | 0.800612 | 2.221624e-48 | 3.045689e-46 |
MsaG044786 | MsaG046546 | 0.815739 | 1.373230e-51 | 2.704665e-49 |
MsaG044849 | MsaG046546 | 0.812357 | 7.590440e-51 | 1.373309e-48 |
MsaG044885 | MsaG046546 | 0.856238 | 7.146165e-62 | 4.829458e-59 |
MsaG044894 | MsaG046546 | 0.831431 | 3.023776e-55 | 9.118514e-53 |
MsaG045004 | MsaG046546 | 0.843060 | 3.294325e-58 | 1.417276e-55 |
MsaG045108 | MsaG046546 | 0.804196 | 4.090452e-49 | 6.086931e-47 |
MsaG045109 | MsaG046546 | 0.822294 | 4.505680e-53 | 1.053165e-50 |
MsaG045225 | MsaG046546 | 0.804373 | 3.759433e-49 | 5.617366e-47 |
MsaG045345 | MsaG046546 | 0.853453 | 4.551871e-61 | 2.782802e-58 |
MsaG045392 | MsaG046546 | 0.812517 | 7.007184e-51 | 1.272841e-48 |
MsaG045576 | MsaG046546 | 0.846403 | 4.177821e-59 | 2.005352e-56 |
MsaG045974 | MsaG046546 | 0.869820 | 4.723384e-66 | 5.431995e-63 |
MsaG046247 | MsaG046546 | 0.826009 | 6.101914e-54 | 1.578417e-51 |
MsaG046313 | MsaG046546 | 0.822453 | 4.141426e-53 | 9.721434e-51 |
MsaG046546 | MsaG046554 | 0.841118 | 1.069144e-57 | 4.323107e-55 |
MsaG046546 | MsaG046746 | 0.817284 | 6.212527e-52 | 1.273052e-49 |
MsaG046546 | MsaG046807 | 0.806076 | 1.660427e-49 | 2.581432e-47 |
MsaG046546 | MsaG047014 | 0.855727 | 1.006606e-61 | 6.675795e-59 |
MsaG046546 | MsaG047067 | 0.832418 | 1.729276e-55 | 5.366848e-53 |
MsaG046546 | MsaG047095 | 0.805475 | 2.217418e-49 | 3.399028e-47 |
MsaG046546 | MsaG047152 | 0.823145 | 2.862187e-53 | 6.845573e-51 |
MsaG046546 | MsaG047135 | 0.823258 | 2.695136e-53 | 6.465880e-51 |
MsaG046546 | MsaG000630 | 0.817436 | 5.743944e-52 | 1.181621e-49 |
MsaG046546 | MsaG001986 | 0.885706 | 1.392548e-71 | 3.301478e-68 |
MsaG046546 | MsaG003672 | 0.822564 | 3.903388e-53 | 9.190398e-51 |
MsaG046546 | MsaG003742 | 0.806440 | 1.393251e-49 | 2.184881e-47 |
MsaG046546 | MsaG000974 | 0.846212 | 4.707502e-59 | 2.245322e-56 |
MsaG046546 | MsaG008772 | 0.850368 | 3.384634e-60 | 1.857566e-57 |
MsaG046546 | MsaG010579 | 0.805911 | 1.798274e-49 | 2.784784e-47 |
MsaG046546 | MsaG008766 | 0.812564 | 6.843197e-51 | 1.244512e-48 |
MsaG046546 | MsaG014425 | 0.820718 | 1.037817e-52 | 2.326202e-50 |
MsaG046546 | MsaG016780 | 0.851189 | 1.992590e-60 | 1.125121e-57 |
MsaG046546 | MsaG013226 | 0.804687 | 3.235977e-49 | 4.870308e-47 |
MsaG046546 | MsaG013115 | 0.806119 | 1.626758e-49 | 2.531626e-47 |
MsaG046546 | MsaG014177 | 0.855022 | 1.611555e-61 | 1.041907e-58 |
MsaG046546 | MsaG015710 | 0.839969 | 2.128968e-57 | 8.303083e-55 |
MsaG046546 | MsaG015507 | 0.862796 | 7.793321e-64 | 6.747806e-61 |
MsaG046546 | MsaG019831 | 0.836975 | 1.250614e-56 | 4.445069e-54 |
MsaG046546 | MsaG023443 | 0.888804 | 9.326777e-73 | 2.583283e-69 |
MsaG046546 | MsaG028462 | 0.833605 | 8.792230e-56 | 2.825306e-53 |
MsaG046546 | MsaG028141 | 0.815466 | 1.577944e-51 | 3.086493e-49 |
MsaG046546 | MsaG027790 | 0.830795 | 4.325788e-55 | 1.280663e-52 |
MsaG046546 | MsaG028538 | 0.802874 | 7.667109e-49 | 1.106531e-46 |
MsaG046546 | MsaG033149 | 0.839673 | 2.540879e-57 | 9.817516e-55 |
MsaG046546 | MsaG033548 | 0.858118 | 2.002240e-62 | 1.450050e-59 |
MsaG046546 | MsaG032288 | 0.843562 | 2.423895e-58 | 1.059741e-55 |
MsaG046546 | MsaG030315 | 0.809642 | 2.920991e-50 | 4.945310e-48 |
MsaG046546 | MsaG030190 | 0.827407 | 2.840895e-54 | 7.640499e-52 |
MsaG046546 | MsaG034520 | 0.867347 | 2.947973e-65 | 3.061572e-62 |
MsaG046546 | MsaG034532 | 0.825286 | 9.038064e-54 | 2.291434e-51 |
MsaG046546 | MsaG032266 | 0.814944 | 2.058826e-51 | 3.974200e-49 |
MsaG046546 | MsaG030214 | 0.817182 | 6.549635e-52 | 1.338581e-49 |
MsaG046546 | MsaG032941 | 0.802335 | 9.893220e-49 | 1.410343e-46 |
MsaG046546 | MsaG030000 | 0.843541 | 2.454428e-58 | 1.072391e-55 |
MsaG046546 | MsaG031914 | 0.820792 | 9.980888e-53 | 2.241594e-50 |
MsaG046546 | MsaG031699 | 0.812223 | 8.117251e-51 | 1.463677e-48 |
MsaG046546 | MsaG036784 | 0.881326 | 5.588176e-70 | 1.072862e-66 |
MsaG046546 | MsaG038287 | 0.818413 | 3.463414e-52 | 7.306395e-50 |
MsaG046546 | MsaG036873 | 0.810487 | 1.925266e-50 | 3.327077e-48 |
MsaG046546 | MsaG037156 | 0.827733 | 2.373848e-54 | 6.443285e-52 |
MsaG046546 | MsaG035112 | 0.874944 | 9.408294e-68 | 1.349767e-64 |
MsaG046546 | MsaG036457 | 0.804599 | 3.375304e-49 | 5.069621e-47 |
MsaG046546 | MsaG040777 | 0.830448 | 5.253167e-55 | 1.539857e-52 |
MsaG046546 | MsaG038711 | 0.851875 | 1.276998e-60 | 7.385620e-58 |
MsaG046546 | MsaG036751 | 0.826019 | 6.068047e-54 | 1.570102e-51 |
MsaG046546 | MsaG036540 | 0.801827 | 1.257023e-48 | 1.771284e-46 |
MsaG046546 | MsaG036671 | 0.831645 | 2.678796e-55 | 8.129466e-53 |
MsaG046546 | MsaG038291 | 0.825998 | 6.140236e-54 | 1.587840e-51 |
MsaG046546 | MsaG036963 | 0.810034 | 2.408165e-50 | 4.115844e-48 |
MsaG046546 | MsaG039091 | 0.804006 | 4.478999e-49 | 6.635831e-47 |
MsaG046546 | MsaG035498 | 0.815525 | 1.531353e-51 | 2.999778e-49 |
MsaG046546 | MsaG042833 | 0.833296 | 1.048916e-55 | 3.340127e-53 |
MsaG046546 | MsaG043823 | 0.828474 | 1.577313e-54 | 4.371331e-52 |
MsaG046546 | MsaG043826 | 0.833556 | 9.039839e-56 | 2.900717e-53 |
MsaG046546 | MsaG043146 | 0.833627 | 8.683639e-56 | 2.792190e-53 |
MsaG046546 | MsaG042299 | 0.811495 | 1.167350e-50 | 2.067673e-48 |
MsaG012761 | MsaG046546 | 0.804486 | 3.561622e-49 | 5.335593e-47 |
MsaG013374 | MsaG046546 | 0.869667 | 5.296866e-66 | 6.052898e-63 |
MsaG015082 | MsaG046546 | 0.822303 | 4.484299e-53 | 1.048448e-50 |
MsaG016368 | MsaG046546 | 0.843065 | 3.284480e-58 | 1.413262e-55 |
MsaG016544 | MsaG046546 | 0.801128 | 1.745250e-48 | 2.420512e-46 |
MsaG016571 | MsaG046546 | 0.883620 | 8.231317e-71 | 1.763563e-67 |
MsaG016826 | MsaG046546 | 0.804117 | 4.247909e-49 | 6.309694e-47 |
MsaG017313 | MsaG046546 | 0.811754 | 1.025850e-50 | 1.828598e-48 |
MsaG017437 | MsaG046546 | 0.835143 | 3.630798e-56 | 1.221379e-53 |
MsaG017441 | MsaG046546 | 0.829181 | 1.065580e-54 | 3.012185e-52 |
MsaG017543 | MsaG046546 | 0.832588 | 1.570178e-55 | 4.897130e-53 |
MsaG017762 | MsaG046546 | 0.860579 | 3.685156e-63 | 2.929445e-60 |
MsaG017772 | MsaG046546 | 0.874090 | 1.827692e-67 | 2.525691e-64 |
MsaG018290 | MsaG046546 | 0.812905 | 5.767097e-51 | 1.057733e-48 |
MsaG018367 | MsaG046546 | 0.866548 | 5.282598e-65 | 5.311120e-62 |
MsaG018417 | MsaG046546 | 0.807744 | 7.400205e-50 | 1.196880e-47 |
MsaG018565 | MsaG046546 | 0.813351 | 4.608997e-51 | 8.547859e-49 |
MsaG018648 | MsaG046546 | 0.830607 | 4.806696e-55 | 1.415349e-52 |
MsaG018738 | MsaG046546 | 0.857378 | 3.310372e-62 | 2.332478e-59 |
MsaG018902 | MsaG046546 | 0.867627 | 2.399174e-65 | 2.520621e-62 |
MsaG018961 | MsaG046546 | 0.804320 | 3.855601e-49 | 5.754014e-47 |
MsaG018988 | MsaG046546 | 0.817748 | 4.889646e-52 | 1.013937e-49 |
MsaG019055 | MsaG046546 | 0.828030 | 2.015534e-54 | 5.516389e-52 |
MsaG019221 | MsaG046546 | 0.853394 | 4.729946e-61 | 2.885802e-58 |
MsaG019303 | MsaG046546 | 0.893812 | 9.912607e-75 | 3.579453e-71 |
MsaG019265 | MsaG046546 | 0.823967 | 1.842620e-53 | 4.506357e-51 |
MsaG019296 | MsaG046546 | 0.826892 | 3.767954e-54 | 9.988881e-52 |
MsaG019542 | MsaG046546 | 0.815018 | 1.982169e-51 | 3.833486e-49 |
MsaG019784 | MsaG046546 | 0.811801 | 1.001950e-50 | 1.788108e-48 |
MsaG020104 | MsaG046546 | 0.873629 | 2.611453e-67 | 3.536079e-64 |
MsaG020296 | MsaG046546 | 0.857853 | 2.399376e-62 | 1.720755e-59 |
MsaG020393 | MsaG046546 | 0.810125 | 2.302035e-50 | 3.943151e-48 |
MsaG020402 | MsaG046546 | 0.815834 | 1.307740e-51 | 2.581941e-49 |
MsaG020616 | MsaG046546 | 0.817954 | 4.396022e-52 | 9.164533e-50 |
MsaG020731 | MsaG046546 | 0.867988 | 1.840171e-65 | 1.961809e-62 |
MsaG020787 | MsaG046546 | 0.811113 | 1.411559e-50 | 2.476892e-48 |
MsaG020963 | MsaG046546 | 0.867191 | 3.304468e-65 | 3.410259e-62 |
MsaG021238 | MsaG046546 | 0.860132 | 5.024357e-63 | 3.926485e-60 |
MsaG021986 | MsaG046546 | 0.849412 | 6.243792e-60 | 3.317163e-57 |
MsaG021997 | MsaG046546 | 0.811529 | 1.147472e-50 | 2.034141e-48 |
MsaG022116 | MsaG046546 | 0.812932 | 5.689929e-51 | 1.044276e-48 |
MsaG022079 | MsaG046546 | 0.800396 | 2.457753e-48 | 3.352901e-46 |
MsaG022494 | MsaG046546 | 0.828273 | 1.762182e-54 | 4.855938e-52 |
MsaG022806 | MsaG046546 | 0.802356 | 9.797184e-49 | 1.397313e-46 |
MsaG023133 | MsaG046546 | 0.851478 | 1.652782e-60 | 9.426690e-58 |
MsaG023396 | MsaG046546 | 0.845262 | 8.501956e-59 | 3.929175e-56 |
MsaG023609 | MsaG046546 | 0.890929 | 1.394004e-73 | 4.311191e-70 |
MsaG023787 | MsaG046546 | 0.873405 | 3.103759e-67 | 4.161873e-64 |
MsaG023974 | MsaG046546 | 0.801155 | 1.723443e-48 | 2.391702e-46 |
MsaG024998 | MsaG046546 | 0.806059 | 1.674316e-49 | 2.601958e-47 |
MsaG025290 | MsaG046546 | 0.811984 | 9.146168e-51 | 1.639588e-48 |
MsaG025428 | MsaG046546 | 0.809015 | 3.975798e-50 | 6.630167e-48 |
MsaG025722 | MsaG046546 | 0.825144 | 9.759823e-54 | 2.464788e-51 |
MsaG027027 | MsaG046546 | 0.803215 | 6.523481e-49 | 9.489353e-47 |
MsaG027361 | MsaG046546 | 0.839521 | 2.781762e-57 | 1.069682e-54 |
MsaG027416 | MsaG046546 | 0.815957 | 1.228262e-51 | 2.432620e-49 |
MsaG027569 | MsaG046546 | 0.834350 | 5.735332e-56 | 1.884202e-53 |
MsaG027618 | MsaG046546 | 0.828301 | 1.735583e-54 | 4.786367e-52 |
MsaG027774 | MsaG046546 | 0.827911 | 2.152010e-54 | 5.870354e-52 |
MsaG027749 | MsaG046546 | 0.860890 | 2.967056e-63 | 2.386381e-60 |
MsaG027862 | MsaG046546 | 0.884038 | 5.782790e-71 | 1.264274e-67 |
MsaG027966 | MsaG046546 | 0.850164 | 3.859689e-60 | 2.103400e-57 |
MsaG028246 | MsaG046546 | 0.869437 | 6.288532e-66 | 7.117420e-63 |
MsaG028339 | MsaG046546 | 0.802566 | 8.868901e-49 | 1.271033e-46 |
MsaG028530 | MsaG046546 | 0.801289 | 1.618379e-48 | 2.252740e-46 |
MsaG028713 | MsaG046546 | 0.845706 | 6.451372e-59 | 3.026019e-56 |
MsaG028951 | MsaG046546 | 0.834384 | 5.622681e-56 | 1.849078e-53 |
MsaG029232 | MsaG046546 | 0.816703 | 8.379120e-52 | 1.691427e-49 |
MsaG029481 | MsaG046546 | 0.840181 | 1.875481e-57 | 7.363045e-55 |
MsaG029548 | MsaG046546 | 0.808835 | 4.342931e-50 | 7.211108e-48 |
MsaG029600 | MsaG046546 | 0.815485 | 1.562600e-51 | 3.057865e-49 |
MsaG029773 | MsaG046546 | 0.814163 | 3.059581e-51 | 5.791099e-49 |
MsaG029763 | MsaG046546 | 0.877265 | 1.507458e-68 | 2.399024e-65 |
MsaG029887 | MsaG046546 | 0.850224 | 3.713689e-60 | 2.027981e-57 |
MsaG029987 | MsaG046546 | 0.837851 | 7.476557e-57 | 2.729471e-54 |
MsaG030158 | MsaG046546 | 0.821811 | 5.822895e-53 | 1.343559e-50 |
MsaG030359 | MsaG046546 | 0.800908 | 1.934430e-48 | 2.669577e-46 |
MsaG030905 | MsaG046546 | 0.811884 | 9.612889e-51 | 1.719060e-48 |
MsaG030955 | MsaG046546 | 0.912329 | 5.402717e-83 | 5.945039e-79 |
MsaG030986 | MsaG046546 | 0.869369 | 6.614048e-66 | 7.464406e-63 |
MsaG032101 | MsaG046546 | 0.825254 | 9.198455e-54 | 2.330000e-51 |
MsaG032294 | MsaG046546 | 0.857671 | 2.714167e-62 | 1.933260e-59 |
MsaG032332 | MsaG046546 | 0.824130 | 1.687497e-53 | 4.145335e-51 |
MsaG032448 | MsaG046546 | 0.848459 | 1.145098e-59 | 5.888277e-57 |
MsaG032786 | MsaG046546 | 0.814748 | 2.274434e-51 | 4.368761e-49 |
MsaG033134 | MsaG046546 | 0.813228 | 4.902424e-51 | 9.064550e-49 |
MsaG033298 | MsaG046546 | 0.859212 | 9.474574e-63 | 7.149355e-60 |
MsaG033400 | MsaG046546 | 0.884175 | 5.150346e-71 | 1.133348e-67 |
MsaG033519 | MsaG046546 | 0.819529 | 1.937133e-52 | 4.207557e-50 |
MsaG033596 | MsaG046546 | 0.878740 | 4.616243e-69 | 7.861683e-66 |
MsaG033694 | MsaG046546 | 0.883582 | 8.501725e-71 | 1.818414e-67 |
MsaG033796 | MsaG046546 | 0.812727 | 6.304602e-51 | 1.151203e-48 |
MsaG034132 | MsaG046546 | 0.871459 | 1.374653e-66 | 1.694678e-63 |
MsaG034444 | MsaG046546 | 0.814209 | 2.989180e-51 | 5.664492e-49 |
MsaG034875 | MsaG046546 | 0.875138 | 8.083388e-68 | 1.169606e-64 |
MsaG035054 | MsaG046546 | 0.802405 | 9.569465e-49 | 1.366392e-46 |
MsaG035190 | MsaG046546 | 0.830787 | 4.344452e-55 | 1.285922e-52 |
MsaG035148 | MsaG046546 | 0.805387 | 2.313532e-49 | 3.539097e-47 |
MsaG035465 | MsaG046546 | 0.811119 | 1.407087e-50 | 2.469416e-48 |
MsaG035439 | MsaG046546 | 0.803304 | 6.255739e-49 | 9.118351e-47 |
MsaG035660 | MsaG046546 | 0.822887 | 3.285331e-53 | 7.803040e-51 |
MsaG035935 | MsaG046546 | 0.804864 | 2.973353e-49 | 4.493625e-47 |
MsaG036047 | MsaG046546 | 0.847416 | 2.214284e-59 | 1.099557e-56 |
MsaG036056 | MsaG046546 | 0.824357 | 1.493057e-53 | 3.690566e-51 |
MsaG039160 | MsaG046546 | 0.836846 | 1.348670e-56 | 4.775044e-54 |
MsaG039196 | MsaG046546 | 0.836829 | 1.361831e-56 | 4.819277e-54 |
MsaG039679 | MsaG046546 | 0.802242 | 1.033709e-48 | 1.470400e-46 |
MsaG039932 | MsaG046546 | 0.863701 | 4.103393e-64 | 3.681606e-61 |
MsaG039995 | MsaG046546 | 0.809544 | 3.065920e-50 | 5.178481e-48 |
MsaG040546 | MsaG046546 | 0.801746 | 1.305528e-48 | 1.836251e-46 |
MsaG040679 | MsaG046546 | 0.827662 | 2.468513e-54 | 6.686750e-52 |
MsaG040682 | MsaG046546 | 0.800570 | 2.266237e-48 | 3.103813e-46 |
MsaG040909 | MsaG046546 | 0.807840 | 7.062782e-50 | 1.144954e-47 |
MsaG041335 | MsaG046546 | 0.809268 | 3.511479e-50 | 5.891304e-48 |
PPI
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG046546 | MtrunA17_Chr4g0076771 | 99.611 | 257 | 0 | 1 | 1 | 257 | 1 | 256 | 0.0 | 532 |
MsaG046546 | MtrunA17_Chr8g0343441 | 71.311 | 244 | 70 | 0 | 10 | 253 | 9 | 252 | 3.42e-111 | 320 |
MsaG046546 | MtrunA17_Chr1g0150821 | 67.589 | 253 | 75 | 2 | 10 | 255 | 10 | 262 | 2.98e-105 | 305 |
MsaG046546 | MtrunA17_Chr2g0300241 | 68.548 | 248 | 69 | 4 | 10 | 255 | 12 | 252 | 1.77e-104 | 303 |
MsaG046546 | MtrunA17_Chr2g0329821 | 67.194 | 253 | 77 | 2 | 1 | 253 | 1 | 247 | 2.56e-103 | 300 |
MsaG046546 | MtrunA17_Chr7g0242511 | 62.302 | 252 | 84 | 5 | 4 | 255 | 1 | 241 | 1.36e-93 | 275 |
MsaG046546 | MtrunA17_Chr4g0006381 | 61.508 | 252 | 86 | 5 | 4 | 255 | 1 | 241 | 2.78e-90 | 267 |
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MsaG046546 | AT2G02470.1 | 79.151 | 259 | 46 | 5 | 1 | 255 | 1 | 255 | 3.52e-130 | 369 |
MsaG046546 | AT1G14510.1 | 78.656 | 253 | 49 | 3 | 1 | 253 | 1 | 248 | 5.26e-128 | 363 |
MsaG046546 | AT2G02470.2 | 76.744 | 258 | 45 | 5 | 1 | 255 | 1 | 246 | 4.40e-124 | 353 |
MsaG046546 | AT5G20510.1 | 67.568 | 259 | 80 | 3 | 1 | 255 | 1 | 259 | 8.81e-112 | 322 |
MsaG046546 | AT3G42790.1 | 66.275 | 255 | 80 | 3 | 1 | 255 | 1 | 249 | 1.06e-108 | 314 |
MsaG046546 | AT5G05610.2 | 63.347 | 251 | 79 | 5 | 5 | 255 | 3 | 240 | 1.73e-95 | 280 |
MsaG046546 | AT5G05610.1 | 63.347 | 251 | 79 | 5 | 5 | 255 | 3 | 240 | 1.73e-95 | 280 |
MsaG046546 | AT5G26210.1 | 67.331 | 251 | 72 | 3 | 10 | 255 | 9 | 254 | 5.23e-93 | 275 |
MsaG046546 | AT3G11200.1 | 63.137 | 255 | 84 | 4 | 1 | 255 | 1 | 245 | 7.65e-89 | 263 |
MsaG046546 | AT5G20510.2 | 66.512 | 215 | 68 | 3 | 45 | 255 | 4 | 218 | 5.70e-86 | 255 |
MsaG046546 | AT2G02470.3 | 82.927 | 164 | 24 | 3 | 1 | 164 | 1 | 160 | 2.71e-85 | 255 |
MsaG046546 | AT5G20510.3 | 73.171 | 164 | 42 | 2 | 1 | 162 | 1 | 164 | 2.97e-75 | 227 |
MsaG046546 | AT3G11200.2 | 62.844 | 218 | 71 | 4 | 38 | 255 | 25 | 232 | 6.78e-75 | 228 |
Find 75 sgRNAs with CRISPR-Local
Find sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|---|---|---|
CTCGCTGTTGCTTTCTATTT+TGG | 0.091188 | 8:+85697666 | MsaT046546.1:CDS |
AAGGAGAATTTGTGCCTCTA+TGG | 0.272744 | 8:+85697492 | MsaT046546.1:CDS |
GTTCAGAGCTATCCAATTCT+TGG | 0.273239 | 8:-85699953 | None:intergenic |
ATTATGGCACCGATGAATTC+TGG | 0.291624 | 8:+85699819 | MsaT046546.1:CDS |
TTCACTTCCCATGTTTCATT+TGG | 0.302703 | 8:-85697519 | None:intergenic |
TTTGGTGCCCGCTTTGGATT+TGG | 0.319624 | 8:+85697684 | MsaT046546.1:CDS |
TTGGATTTGGTAAGAATGAT+AGG | 0.350809 | 8:+85697697 | MsaT046546.1:CDS |
TCTTCAACAGTTCGAGGTAC+TGG | 0.366061 | 8:-85696574 | None:intergenic |
ACATCTTCACACCCTTGGTC+TGG | 0.386000 | 8:-85699706 | None:intergenic |
TCAGGAGGCACTTCCTCAAC+AGG | 0.419078 | 8:-85697546 | None:intergenic |
ACAGTCTTTGAGCTTGCAAC+AGG | 0.426181 | 8:+85699489 | MsaT046546.1:CDS |
GGTGCTTGTGGTGATAATTA+TGG | 0.428882 | 8:+85699803 | MsaT046546.1:CDS |
CATTGGGTATAAACTTTGCT+CGG | 0.446703 | 8:+85697583 | MsaT046546.1:CDS |
AGTATCAAGAAGCCAAGAAT+TGG | 0.452358 | 8:+85699941 | MsaT046546.1:CDS |
AAAACTTCTTCAACAGTTCG+AGG | 0.455840 | 8:-85696580 | None:intergenic |
AATGCTGGCTCGGGAAGTTC+AGG | 0.456279 | 8:-85697564 | None:intergenic |
CTGTCAACCTCTTCTTTGAC+CGG | 0.460633 | 8:-85699734 | None:intergenic |
GGCTTCTTGATACTGCAGCC+AGG | 0.465655 | 8:-85699932 | None:intergenic |
TGAACTTCCCGAGCCAGCAT+TGG | 0.471886 | 8:+85697566 | MsaT046546.1:CDS |
GTTTATACCCAATGCTGGCT+CGG | 0.475497 | 8:-85697574 | None:intergenic |
CTTTGCTCGGGATGGAATGC+AGG | 0.478727 | 8:+85697596 | MsaT046546.1:CDS |
GGTTGACAGTGGAGAAGAAG+AGG | 0.483798 | 8:+85699748 | MsaT046546.1:CDS |
TGCAGACATCTTCACACCCT+TGG | 0.486335 | 8:-85699711 | None:intergenic |
CATCTTCACACCCTTGGTCT+GGG | 0.494259 | 8:-85699705 | None:intergenic |
AGGAGAATTTGTGCCTCTAT+GGG | 0.495200 | 8:+85697493 | MsaT046546.1:CDS |
GAACTTCCCGAGCCAGCATT+GGG | 0.495975 | 8:+85697567 | MsaT046546.1:CDS |
TTGATGTGTTCAGCCTTGGC+AGG | 0.497341 | 8:-85699896 | None:intergenic |
CTTCAACAGTTCGAGGTACT+GGG | 0.497593 | 8:-85696573 | None:intergenic |
TTGATCAAAGCTCTCACTAC+TGG | 0.498155 | 8:+85696631 | MsaT046546.1:CDS |
GGTATAAACTTTGCTCGGGA+TGG | 0.501826 | 8:+85697588 | MsaT046546.1:CDS |
TTGCTTGATGTGTTCAGCCT+TGG | 0.502589 | 8:-85699900 | None:intergenic |
TTTATACCCAATGCTGGCTC+GGG | 0.504159 | 8:-85697573 | None:intergenic |
ATTGGGTATAAACTTTGCTC+GGG | 0.520391 | 8:+85697584 | MsaT046546.1:CDS |
AGTGAGAGCTTTGATCAAAC+CGG | 0.520678 | 8:-85696626 | None:intergenic |
CATTGTTGTGAGCAGTCAGT+TGG | 0.529254 | 8:-85699533 | None:intergenic |
GCTTCTTGATACTGCAGCCA+GGG | 0.530817 | 8:-85699931 | None:intergenic |
ACTAACCGGGATCGCAGAGC+TGG | 0.531212 | 8:-85696767 | None:intergenic |
AAATTGAAATTGAGGATGGA+AGG | 0.531943 | 8:+85696538 | None:intergenic |
GAAATTGAGGATGGAAGGAA+TGG | 0.537738 | 8:+85696543 | None:intergenic |
CCTTGGTCTGGGATTCAGAC+TGG | 0.538724 | 8:-85699694 | None:intergenic |
TTGCAGTTCACAGTGACTCA+TGG | 0.543636 | 8:+85697640 | MsaT046546.1:CDS |
GTTGTGATATGTGCGAGAAA+TGG | 0.560529 | 8:+85699846 | MsaT046546.1:CDS |
TTTCATTTGGAAACCCATAG+AGG | 0.561848 | 8:-85697506 | None:intergenic |
GCAAAGTTTATACCCAATGC+TGG | 0.563847 | 8:-85697579 | None:intergenic |
GGAGAAGGACTGGTTATCAC+TGG | 0.565404 | 8:+85697617 | MsaT046546.1:CDS |
TCGGGATGGAATGCAGGAGA+AGG | 0.567649 | 8:+85697602 | MsaT046546.1:CDS |
ATGGGTTTCCAAATGAAACA+TGG | 0.572525 | 8:+85697511 | MsaT046546.1:CDS |
ATTATCACCACAAGCACCAC+AGG | 0.573675 | 8:-85699798 | None:intergenic |
ATCAAGCAATACAAGTGCCC+TGG | 0.578416 | 8:+85699914 | MsaT046546.1:CDS |
GGTCTGGGATTCAGACTGGC+GGG | 0.580455 | 8:-85699690 | None:intergenic |
TGTTAAAATTACTCCTGCCA+AGG | 0.581201 | 8:+85699883 | MsaT046546.1:CDS |
ATGGAATGCAGGAGAAGGAC+TGG | 0.581252 | 8:+85697607 | MsaT046546.1:CDS |
CAAATACAAATCAAGTGGAA+AGG | 0.584281 | 8:+85699566 | MsaT046546.1:CDS |
TGTTGCAAGCTCAAAGACTG+TGG | 0.590482 | 8:-85699487 | None:intergenic |
ATTCTTACCAAATCCAAAGC+GGG | 0.591224 | 8:-85697691 | None:intergenic |
AATAGCAAATACAAATCAAG+TGG | 0.591787 | 8:+85699561 | MsaT046546.1:CDS |
GTCTGCACCGGTCAAAGAAG+AGG | 0.597402 | 8:+85699727 | MsaT046546.1:CDS |
TGGTCTGGGATTCAGACTGG+CGG | 0.601563 | 8:-85699691 | None:intergenic |
GGGTGTGAAGATGTCTGCAC+CGG | 0.601595 | 8:+85699715 | MsaT046546.1:CDS |
TGGGTTTCCAAATGAAACAT+GGG | 0.604798 | 8:+85697512 | MsaT046546.1:CDS |
GATTACAAAGGCAGACGCGC+CGG | 0.610248 | 8:+85696607 | MsaT046546.1:CDS |
GGTGCAACCTGTGGTGCTTG+TGG | 0.611921 | 8:+85699791 | MsaT046546.1:CDS |
GTTGCAAGCTCAAAGACTGT+GGG | 0.616342 | 8:-85699486 | None:intergenic |
GGAAGTGAACTTGCCTGTTG+AGG | 0.623158 | 8:+85697533 | MsaT046546.1:CDS |
AGGAACTGCTAAGCAATCAA+AGG | 0.625294 | 8:+85699509 | MsaT046546.1:CDS |
ATGTGCGAGAAATGGTTCCA+TGG | 0.628526 | 8:+85699854 | MsaT046546.1:CDS |
CAGTCTGAATCCCAGACCAA+GGG | 0.635249 | 8:+85699695 | MsaT046546.1:CDS |
ACAACAGATCCAGAATTCAT+CGG | 0.639218 | 8:-85699828 | None:intergenic |
CCAGTCTGAATCCCAGACCA+AGG | 0.643258 | 8:+85699694 | MsaT046546.1:CDS |
CAACTGACTGCTCACAACAA+TGG | 0.646947 | 8:+85699534 | MsaT046546.1:CDS |
GCTGGCTCGGGAAGTTCAGG+AGG | 0.654216 | 8:-85697561 | None:intergenic |
GTCAAAGAAGAGGTTGACAG+TGG | 0.669063 | 8:+85699737 | MsaT046546.1:CDS |
GAAGAAGATGATGATGAACA+AGG | 0.695245 | 8:+85699770 | MsaT046546.1:CDS |
GATGAACAAGGTGCAACCTG+TGG | 0.715909 | 8:+85699782 | MsaT046546.1:CDS |
CATTCTTACCAAATCCAAAG+CGG | 0.722080 | 8:-85697692 | None:intergenic |
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
Chr8 | gene | 85696553 | 85699967 | 85696553 | ID=MsaG046546 |
Chr8 | mRNA | 85696553 | 85699967 | 85696553 | ID=MsaT046546.1;Parent=MsaG046546 |
Chr8 | exon | 85696553 | 85696652 | 85696553 | ID=MsaT046546.1.exon1;Parent=MsaT046546.1 |
Chr8 | CDS | 85696553 | 85696652 | 85696553 | ID=cds.MsaT046546.1;Parent=MsaT046546.1 |
Chr8 | exon | 85696751 | 85696783 | 85696751 | ID=MsaT046546.1.exon2;Parent=MsaT046546.1 |
Chr8 | CDS | 85696751 | 85696783 | 85696751 | ID=cds.MsaT046546.1;Parent=MsaT046546.1 |
Chr8 | exon | 85697490 | 85697718 | 85697490 | ID=MsaT046546.1.exon3;Parent=MsaT046546.1 |
Chr8 | CDS | 85697490 | 85697718 | 85697490 | ID=cds.MsaT046546.1;Parent=MsaT046546.1 |
Chr8 | exon | 85699455 | 85699587 | 85699455 | ID=MsaT046546.1.exon4;Parent=MsaT046546.1 |
Chr8 | CDS | 85699455 | 85699587 | 85699455 | ID=cds.MsaT046546.1;Parent=MsaT046546.1 |
Chr8 | exon | 85699689 | 85699967 | 85699689 | ID=MsaT046546.1.exon5;Parent=MsaT046546.1 |
Chr8 | CDS | 85699689 | 85699967 | 85699689 | ID=cds.MsaT046546.1;Parent=MsaT046546.1 |
Gene Sequence |
Protein sequence |