Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa0218400 | RHN75380.1 | 95.000 | 60 | 3 | 0 | 2 | 61 | 1 | 60 | 3.34e-34 | 125 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa0218400 | A0A396JB43 | 95.000 | 60 | 3 | 0 | 2 | 61 | 1 | 60 | 1.59e-34 | 125 |
| Gene ID | Type | Classification |
|---|---|---|
| Msa0218400 | TR | Others |
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa0218400 | MtrunA17_Chr2g0320551 | 95.000 | 60 | 3 | 0 | 2 | 61 | 1 | 60 | 3.07e-38 | 125 |
| Msa0218400 | MtrunA17_Chr2g0320561 | 90.000 | 60 | 6 | 0 | 2 | 61 | 1 | 60 | 6.79e-36 | 121 |
| Msa0218400 | MtrunA17_Chr2g0320521 | 73.770 | 61 | 16 | 0 | 1 | 61 | 2 | 62 | 1.37e-29 | 105 |
| Msa0218400 | MtrunA17_Chr4g0020811 | 75.410 | 61 | 15 | 0 | 1 | 61 | 2 | 62 | 1.32e-28 | 100 |
| Msa0218400 | MtrunA17_Chr2g0308401 | 75.000 | 60 | 15 | 0 | 2 | 61 | 1 | 60 | 1.13e-27 | 98.2 |
| Msa0218400 | MtrunA17_Chr1g0179781 | 53.226 | 62 | 27 | 2 | 1 | 61 | 2 | 62 | 4.77e-13 | 61.6 |
| Msa0218400 | MtrunA17_Chr7g0265291 | 50.000 | 62 | 28 | 2 | 2 | 61 | 4 | 64 | 2.78e-12 | 59.3 |
| Msa0218400 | MtrunA17_Chr4g0040071 | 51.786 | 56 | 25 | 2 | 6 | 61 | 16 | 69 | 5.74e-11 | 56.2 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Msa0218400 | AT1G43000.2 | 47.541 | 61 | 30 | 2 | 1 | 61 | 12 | 70 | 7.99e-12 | 58.9 |
| Msa0218400 | AT1G43000.1 | 47.541 | 61 | 30 | 2 | 1 | 61 | 5 | 63 | 8.06e-12 | 58.9 |
| Msa0218400 | AT1G21000.1 | 45.902 | 61 | 31 | 2 | 1 | 61 | 12 | 70 | 9.64e-11 | 56.2 |
Find 6 sgRNAs with CRISPR-Local
Find 7 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| CAAAGATCATCAAGTAATTC+AGG | 0.304180 | 2_1:-65517335 | Msa0218400:intron |
| TCTATACAAGATTCACATAA+TGG | 0.352887 | 2_1:+65517367 | None:intergenic |
| ACCTTGGCTTGTAAACTTGC+TGG | 0.395128 | 2_1:-65517479 | Msa0218400:CDS |
| ATAATATTTCGTAATGATCT+AGG | 0.414487 | 2_1:-65517280 | Msa0218400:CDS |
| GCCAGCAAGTTTACAAGCCA+AGG | 0.514131 | 2_1:+65517478 | None:intergenic |
| AGGATATGATGTGTGTACCT+TGG | 0.542052 | 2_1:-65517495 | Msa0218400:CDS |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| !! | ATAATATTTCGTAATGATCT+AGG | - | chr2_1:65517435-65517454 | Msa0218400:CDS | 20.0% |
| ! | TCTATACAAGATTCACATAA+TGG | + | chr2_1:65517351-65517370 | None:intergenic | 25.0% |
| CAAAGATCATCAAGTAATTC+AGG | - | chr2_1:65517380-65517399 | Msa0218400:CDS | 30.0% | |
| CTAACAAGTCGAAAAATGAG+CGG | - | chr2_1:65517295-65517314 | Msa0218400:intron | 35.0% | |
| !! | CGCTCATTTTTCGACTTGTT+AGG | + | chr2_1:65517297-65517316 | None:intergenic | 40.0% |
| !! | ACCTTGGCTTGTAAACTTGC+TGG | - | chr2_1:65517236-65517255 | Msa0218400:CDS | 45.0% |
| GCCAGCAAGTTTACAAGCCA+AGG | + | chr2_1:65517240-65517259 | None:intergenic | 50.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| chr2_1 | gene | 65517222 | 65517515 | 65517222 | ID=Msa0218400;Name=Msa0218400 |
| chr2_1 | mRNA | 65517222 | 65517515 | 65517222 | ID=Msa0218400-mRNA-1;Parent=Msa0218400;Name=Msa0218400-mRNA-1;_AED=0.43;_eAED=0.54;_QI=0|0|0|1|0|0.5|2|0|88 |
| chr2_1 | exon | 65517336 | 65517515 | 65517336 | ID=Msa0218400-mRNA-1:exon:18304;Parent=Msa0218400-mRNA-1 |
| chr2_1 | exon | 65517222 | 65517308 | 65517222 | ID=Msa0218400-mRNA-1:exon:18303;Parent=Msa0218400-mRNA-1 |
| chr2_1 | CDS | 65517336 | 65517515 | 65517336 | ID=Msa0218400-mRNA-1:cds;Parent=Msa0218400-mRNA-1 |
| chr2_1 | CDS | 65517222 | 65517308 | 65517222 | ID=Msa0218400-mRNA-1:cds;Parent=Msa0218400-mRNA-1 |
| Gene Sequence |
| Protein sequence |