Alfalfa Gene Editing Database
Nr:
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MS.gene22498.t1 | XP_024639888.1 | 86.6 | 97 | 12 | 1 | 1 | 97 | 1 | 96 | 1.20E-36 | 162.2 |
Swissprot:
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Trembl:
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MS.gene22498.t1 | G7K9C1 | 86.6 | 97 | 12 | 1 | 1 | 97 | 1 | 96 | 9.0e-37 | 162.2 |
TFs/TRs:
| Gene ID | Type | Classification |
|---|
Protein Kinases:
| Gene ID | Type | Classification |
|---|
Network:
Co-expression Network:
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| MS.gene058111 | MS.gene22498 | 0.811886 | 5.59E-51 | -1.69E-46 |
PPI:
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MS.gene22498.t1 | MTR_5g009260 | 92.784 | 97 | 6 | 1 | 1 | 97 | 1 | 96 | 1.72e-58 | 174 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Find 0 sgRNAs with CRISPR-Local
Find 22 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| !! | CATCAATTAATGATACTAAA+GGG | - | 38105:13911-13930 | MS.gene22498:CDS | 20.0% |
| !! | TCATCAATTAATGATACTAA+AGG | - | 38105:13910-13929 | MS.gene22498:CDS | 20.0% |
| ! | AATGATACTAAAGGGAAAAA+TGG | - | 38105:13919-13938 | MS.gene22498:CDS | 25.0% |
| ! | ATATTTCAACTCAACAAGAA+AGG | - | 38105:13988-14007 | MS.gene22498:CDS | 25.0% |
| ! | GAAAATTGTACTAACAAAAG+AGG | - | 38105:13951-13970 | MS.gene22498:CDS | 25.0% |
| AAAGGTAGACAAAAAGTTGA+GGG | - | 38105:14048-14067 | MS.gene22498:CDS | 30.0% | |
| AATTGATCTCAAGCATTTCA+GGG | + | 38105:14107-14126 | MS.gene22498:intergenic | 30.0% | |
| TAACAAAAGAGGAGCTTAAA+TGG | - | 38105:13962-13981 | MS.gene22498:CDS | 30.0% | |
| ! | TCTAAAATGCTCTCTAATGA+AGG | + | 38105:14081-14100 | MS.gene22498:intergenic | 30.0% |
| ATTGATCTCAAGCATTTCAG+GGG | + | 38105:14106-14125 | MS.gene22498:intergenic | 35.0% | |
| CAATTGATCTCAAGCATTTC+AGG | + | 38105:14108-14127 | MS.gene22498:intergenic | 35.0% | |
| GAAAGGTAGACAAAAAGTTG+AGG | - | 38105:14047-14066 | MS.gene22498:CDS | 35.0% | |
| TTTCAACTCAACAAGAAAGG+AGG | - | 38105:13991-14010 | MS.gene22498:CDS | 35.0% | |
| CAAGAAAGGAGGAATGAAAG+TGG | - | 38105:14002-14021 | MS.gene22498:CDS | 40.0% | |
| GTAGACAAAAAGTTGAGGGA+TGG | - | 38105:14052-14071 | MS.gene22498:CDS | 40.0% | |
| GTGCTTGAAGAGATAGAGAA+AGG | - | 38105:14030-14049 | MS.gene22498:CDS | 40.0% | |
| GCATGGAGACATACCCTATG+AGG | - | 38105:13845-13864 | MS.gene22498:CDS | 50.0% | |
| TGTTGTTGCTCCATCTCCAC+TGG | + | 38105:13871-13890 | MS.gene22498:intergenic | 50.0% | |
| GACATACCCTATGAGGCCAG+TGG | - | 38105:13852-13871 | MS.gene22498:CDS | 55.0% | |
| ! | CCATCTCCACTGGCCTCATA+GGG | + | 38105:13861-13880 | MS.gene22498:intergenic | 55.0% |
| ! | TCCATCTCCACTGGCCTCAT+AGG | + | 38105:13862-13881 | MS.gene22498:intergenic | 55.0% |
| CCCTATGAGGCCAGTGGAGA+TGG | - | 38105:13858-13877 | MS.gene22498:CDS | 60.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| 38105 | gene | 13835 | 14128 | 13835 | ID=MS.gene22498 |
| 38105 | mRNA | 13835 | 14128 | 13835 | ID=MS.gene22498.t1;Parent=MS.gene22498 |
| 38105 | exon | 13835 | 14128 | 13835 | ID=MS.gene22498.t1.exon1;Parent=MS.gene22498.t1 |
| 38105 | CDS | 13835 | 14128 | 13835 | ID=cds.MS.gene22498.t1;Parent=MS.gene22498.t1 |
| Gene Sequence |
| Protein sequence |