Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsG0080048229.01.T01 | PNX63219.1 | 77.273 | 66 | 5 | 1 | 1 | 56 | 38 | 103 | 3.87E-24 | 96.3 |
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Gene ID | Type | Classification |
|---|
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| MsG0080048229.01 | MsG0080048230.01 | 0.878480 | 2.713527e-69 | 1.419296e-65 |
| MsG0080048229.01 | MsG0180000980.01 | 0.828114 | 1.076280e-54 | 1.059784e-51 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MsG0080048229.01.T01 | MTR_1g028300 | 81.818 | 66 | 2 | 1 | 1 | 56 | 321 | 386 | 1.49e-27 | 101 |
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Find 9 sgRNAs with CRISPR-Local
Find 10 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| AATGCTTCAAAGGTCAAATT+AGG | 0.290408 | contig247end:-7601 | MsG0080048229.01.T01:CDS |
| TAGATCTTAATGTTCCTCTT+AGG | 0.358874 | contig247end:+7462 | None:intergenic |
| GTCATAGTTGTTGACCTAAG+AGG | 0.501868 | contig247end:-7476 | MsG0080048229.01.T01:CDS |
| GTTGTAAGAAAATGCTTCAA+AGG | 0.519484 | contig247end:-7611 | MsG0080048229.01.T01:CDS |
| GTCTGAGATAGCATTGGCAA+AGG | 0.555565 | contig247end:-7519 | MsG0080048229.01.T01:CDS |
| AAATTAGGAGAGTTTGTCGT+GGG | 0.567260 | contig247end:-7586 | MsG0080048229.01.T01:intron |
| TCTGAGATAGCATTGGCAAA+GGG | 0.577103 | contig247end:-7518 | MsG0080048229.01.T01:CDS |
| ACTATTGTCTGAGATAGCAT+TGG | 0.602546 | contig247end:-7525 | MsG0080048229.01.T01:CDS |
| CAAATTAGGAGAGTTTGTCG+TGG | 0.666129 | contig247end:-7587 | MsG0080048229.01.T01:intron |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| AATGCTTCAAAGGTCAAATT+AGG | - | contig247end:7491-7510 | MsG0080048229.01.T01:CDS | 30.0% | |
| GTTGTAAGAAAATGCTTCAA+AGG | - | contig247end:7481-7500 | MsG0080048229.01.T01:CDS | 30.0% | |
| TAGATCTTAATGTTCCTCTT+AGG | + | contig247end:7633-7652 | None:intergenic | 30.0% | |
| !! | TGAAGCATTTTCTTACAACT+TGG | + | contig247end:7480-7499 | None:intergenic | 30.0% |
| AAATTAGGAGAGTTTGTCGT+GGG | - | contig247end:7506-7525 | MsG0080048229.01.T01:CDS | 35.0% | |
| ! | ACTATTGTCTGAGATAGCAT+TGG | - | contig247end:7567-7586 | MsG0080048229.01.T01:intron | 35.0% |
| CAAATTAGGAGAGTTTGTCG+TGG | - | contig247end:7505-7524 | MsG0080048229.01.T01:CDS | 40.0% | |
| GTCATAGTTGTTGACCTAAG+AGG | - | contig247end:7616-7635 | MsG0080048229.01.T01:CDS | 40.0% | |
| !! | TCTGAGATAGCATTGGCAAA+GGG | - | contig247end:7574-7593 | MsG0080048229.01.T01:intron | 40.0% |
| !! | GTCTGAGATAGCATTGGCAA+AGG | - | contig247end:7573-7592 | MsG0080048229.01.T01:intron | 45.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| contig247end | gene | 7457 | 7657 | 7457 | ID=MsG0080048229.01;Name=MsG0080048229.01 |
| contig247end | mRNA | 7457 | 7657 | 7457 | ID=MsG0080048229.01.T01;Parent=MsG0080048229.01;Name=MsG0080048229.01.T01;_AED=0.48;_eAED=0.49;_QI=0|0|0|1|0|0|2|0|56 |
| contig247end | exon | 7457 | 7557 | 7457 | ID=MsG0080048229.01.T01:exon:942;Parent=MsG0080048229.01.T01 |
| contig247end | exon | 7588 | 7657 | 7588 | ID=MsG0080048229.01.T01:exon:941;Parent=MsG0080048229.01.T01 |
| contig247end | CDS | 7588 | 7657 | 7588 | ID=MsG0080048229.01.T01:cds;Parent=MsG0080048229.01.T01 |
| contig247end | CDS | 7457 | 7557 | 7457 | ID=MsG0080048229.01.T01:cds;Parent=MsG0080048229.01.T01 |
| Gene Sequence |
| Protein sequence |
