Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mis matches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Gene ID | Type | Classification |
|---|
| Gene ID | Type | Classification |
|---|
Co-expression Network
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| MsG0580026564.01 | MsG0580026585.01 | 0.893439 | 6.280502e-75 | 5.981924e-71 |
PPI
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Find 6 sgRNAs with CRISPR-Local
Find 6 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|---|---|---|
| CTCTCTCCTTTGTGATGCTG+AGG | 0.508762 | 5:+39983888 | MsG0580026585.01.T01:CDS |
| ATGAGTTCTGCAGTGGCACT+AGG | 0.518046 | 5:+39983947 | MsG0580026585.01.T01:CDS |
| AAGAAATGGGATGCTCAAGA+AGG | 0.586753 | 5:+39983855 | None:intergenic |
| AAGCTCTATGAGTTCTGCAG+TGG | 0.649168 | 5:+39983940 | MsG0580026585.01.T01:CDS |
| GAGCAACCTCAGCATCACAA+AGG | 0.683343 | 5:-39983894 | None:intergenic |
| AGAACTCATAGAGCTTTCCA+CGG | 0.694795 | 5:-39983933 | None:intergenic |
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| AGAACTCATAGAGCTTTCCA+CGG | - | Chr5:39983936-39983955 | None:intergenic | 40.0% | |
| ! | CTCATTATTTTCTCTAGCCG+TGG | + | Chr5:39983916-39983935 | MsG0580026585.01.T01:CDS | 40.0% |
| AAGCTCTATGAGTTCTGCAG+TGG | + | Chr5:39983940-39983959 | MsG0580026585.01.T01:CDS | 45.0% | |
| ATGAGTTCTGCAGTGGCACT+AGG | + | Chr5:39983947-39983966 | MsG0580026585.01.T01:CDS | 50.0% | |
| CTCTCTCCTTTGTGATGCTG+AGG | + | Chr5:39983888-39983907 | MsG0580026585.01.T01:CDS | 50.0% | |
| GAGCAACCTCAGCATCACAA+AGG | - | Chr5:39983897-39983916 | None:intergenic | 50.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| Chr5 | gene | 39983860 | 39984015 | 39983860 | ID=MsG0580026585.01;Name=MsG0580026585.01 |
| Chr5 | mRNA | 39983860 | 39984015 | 39983860 | ID=MsG0580026585.01.T01;Parent=MsG0580026585.01;Name=MsG0580026585.01.T01;_AED=0.40;_eAED=1.00;_QI=0|-1|0|1|-1|0|1|0|51 |
| Chr5 | exon | 39983860 | 39984015 | 39983860 | ID=MsG0580026585.01.T01:exon:37192;Parent=MsG0580026585.01.T01 |
| Chr5 | CDS | 39983860 | 39984015 | 39983860 | ID=MsG0580026585.01.T01:cds;Parent=MsG0580026585.01.T01 |
| Gene Sequence |
| Protein sequence |
