Alfalfa Gene Editing Database
Alfalfa Gene Editing Database
Nr:
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MS.gene071610.t1 | XP_003629258.1 | 96.5 | 57 | 2 | 0 | 1 | 57 | 55 | 111 | 9.20E-22 | 112.1 |
Swissprot:
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Trembl:
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|---|---|---|---|---|---|---|---|---|---|---|
| MS.gene071610.t1 | G7LB61 | 96.5 | 57 | 2 | 0 | 1 | 57 | 55 | 111 | 6.6e-22 | 112.1 |
TFs/TRs:
| Gene ID | Type | Classification |
|---|
Protein Kinases:
| Gene ID | Type | Classification |
|---|
Network:
Co-expression Network:
| Gene1 | Gene2 | correlation coefficient | p_value | FDR |
|---|---|---|---|---|
| MS.gene050560 | MS.gene071610 | 0.816023 | 6.85E-52 | -1.69E-46 |
| MS.gene058736 | MS.gene071610 | 0.800561 | 1.36E-48 | -1.69E-46 |
PPI:
| Gene1 | Gene2 | Type |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
| Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
|---|
Find 0 sgRNAs with CRISPR-Local
Find 40 sgRNAs with CRISPR-GE
CRISPR-Local
| sgRNA_sequence | on_target_score | Position | Region |
|---|
CRISPR-GE
| badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
|---|---|---|---|---|---|
| !!! | TATTATATTTATCTTTTGTT+AGG | - | 54940:14902-14921 | MS.gene071610:CDS | 10.0% |
| !! | TAAGAATTTAGATTCTATAT+GGG | + | 54940:14542-14561 | MS.gene071610:intergenic | 15.0% |
| !! | TTAAGAATTTAGATTCTATA+TGG | + | 54940:14543-14562 | MS.gene071610:intergenic | 15.0% |
| !!! | TCTTTTTCTTTTCAATTAAT+TGG | - | 54940:14276-14295 | MS.gene071610:intron | 15.0% |
| !!! | TTGATTTTGTAGAAGTTTTT+AGG | + | 54940:14728-14747 | MS.gene071610:intergenic | 20.0% |
| ! | ATTAAGTGTTTATCCAAAAC+AGG | - | 54940:14825-14844 | MS.gene071610:intron | 25.0% |
| ! | TTAAGTGTTTATCCAAAACA+GGG | - | 54940:14826-14845 | MS.gene071610:intron | 25.0% |
| CAATTTCATTAACGAAAGTC+TGG | - | 54940:14466-14485 | MS.gene071610:intron | 30.0% | |
| TTATGAACAATGTCATAAGC+TGG | + | 54940:14645-14664 | MS.gene071610:intergenic | 30.0% | |
| ! | GGTATTTTCATAAGCTATCT+TGG | + | 54940:14707-14726 | MS.gene071610:intergenic | 30.0% |
| ! | TAGGGTTTTCTATCAGTAAT+AGG | + | 54940:14229-14248 | MS.gene071610:intergenic | 30.0% |
| ACTGATAAACACCTTGACTT+AGG | - | 54940:14353-14372 | MS.gene071610:intron | 35.0% | |
| ATTGCCTTAGCTAACAAGTA+TGG | - | 54940:14939-14958 | MS.gene071610:CDS | 35.0% | |
| CCTAACATGCAAAACTGTTT+GGG | - | 54940:14606-14625 | MS.gene071610:intron | 35.0% | |
| TAAATAATGAGCAGCTTGGT+TGG | - | 54940:14576-14595 | MS.gene071610:intron | 35.0% | |
| TAGCTAAATAATGAGCAGCT+TGG | - | 54940:14572-14591 | MS.gene071610:intron | 35.0% | |
| ! | ATACTTGTTAGCTAAGGCAA+TGG | + | 54940:14940-14959 | MS.gene071610:intergenic | 35.0% |
| !!! | AACCACAAGTCAGTGTTTTT+TGG | + | 54940:14874-14893 | MS.gene071610:intergenic | 35.0% |
| AAGACTGCAGAAATACAAGG+CGG | - | 54940:14505-14524 | MS.gene071610:intron | 40.0% | |
| AAGCACTTGTGAGACAGTTT+GGG | - | 54940:14403-14422 | MS.gene071610:intron | 40.0% | |
| AGAAAACCCTATCTCTCTGA+GGG | - | 54940:14238-14257 | MS.gene071610:intron | 40.0% | |
| GCCTAACATGCAAAACTGTT+TGG | - | 54940:14605-14624 | MS.gene071610:intron | 40.0% | |
| TAAGCACTTGTGAGACAGTT+TGG | - | 54940:14402-14421 | MS.gene071610:intron | 40.0% | |
| TAGAAAACCCTATCTCTCTG+AGG | - | 54940:14237-14256 | MS.gene071610:intron | 40.0% | |
| TCCAAACAAGTCCTAAGTCA+AGG | + | 54940:14367-14386 | MS.gene071610:intergenic | 40.0% | |
| TTAGTTCCCTCAGAGAGATA+GGG | + | 54940:14247-14266 | MS.gene071610:intergenic | 40.0% | |
| ! | ACCTTGACTTAGGACTTGTT+TGG | - | 54940:14363-14382 | MS.gene071610:intron | 40.0% |
| ! | AGCTCCATACTTGTTAGCTA+AGG | + | 54940:14946-14965 | MS.gene071610:intergenic | 40.0% |
| ! | CACAAAATAACGCCCTGTTT+TGG | + | 54940:14841-14860 | MS.gene071610:intergenic | 40.0% |
| ! | CCCAAACAGTTTTGCATGTT+AGG | + | 54940:14609-14628 | MS.gene071610:intergenic | 40.0% |
| ! | TTTAGTTCCCTCAGAGAGAT+AGG | + | 54940:14248-14267 | MS.gene071610:intergenic | 40.0% |
| !! | AAAACACTGACTTGTGGTTG+TGG | - | 54940:14875-14894 | MS.gene071610:intron | 40.0% |
| !! | CACCAAAAAACACTGACTTG+TGG | - | 54940:14869-14888 | MS.gene071610:intron | 40.0% |
| GCCAAGACTGCAGAAATACA+AGG | - | 54940:14502-14521 | MS.gene071610:intron | 45.0% | |
| GGAGCTGACATTACAGTTGT+AGG | - | 54940:14960-14979 | MS.gene071610:CDS | 45.0% | |
| TCAGTAGCTACAGCAACTTC+AGG | + | 54940:14175-14194 | MS.gene071610:intergenic | 45.0% | |
| ! | ACAGCAACTTCAGGTTCTTG+TGG | + | 54940:14166-14185 | MS.gene071610:intergenic | 45.0% |
| ! | GCCTTGTATTTCTGCAGTCT+TGG | + | 54940:14506-14525 | MS.gene071610:intergenic | 45.0% |
| ! | TCTCTCTGAGGGAACTAAAC+AGG | - | 54940:14249-14268 | MS.gene071610:intron | 45.0% |
| GCTATCTTGGACAGTCTCAC+AGG | + | 54940:14694-14713 | MS.gene071610:intergenic | 50.0% |
| Chromosome | Type | Strat | End | Strand | Name |
|---|---|---|---|---|---|
| 54940 | gene | 14156 | 14992 | 14156 | ID=MS.gene071610 |
| 54940 | mRNA | 14156 | 14992 | 14156 | ID=MS.gene071610.t1;Parent=MS.gene071610 |
| 54940 | exon | 14878 | 14992 | 14878 | ID=MS.gene071610.t1.exon1;Parent=MS.gene071610.t1 |
| 54940 | CDS | 14878 | 14992 | 14878 | ID=cds.MS.gene071610.t1;Parent=MS.gene071610.t1 |
| 54940 | exon | 14156 | 14224 | 14156 | ID=MS.gene071610.t1.exon2;Parent=MS.gene071610.t1 |
| 54940 | CDS | 14156 | 14224 | 14156 | ID=cds.MS.gene071610.t1;Parent=MS.gene071610.t1 |
| Gene Sequence |
| Protein sequence |
