Alfalfa Gene Editing Database
Nr:
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MS.gene54111.t1 | RHN76863.1 | 79.3 | 58 | 12 | 0 | 1 | 58 | 304 | 361 | 2.40E-19 | 104 |
Swissprot:
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Trembl:
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|---|---|---|---|---|---|---|---|---|---|---|
MS.gene54111.t1 | A0A396JKP2 | 79.3 | 58 | 12 | 0 | 1 | 58 | 304 | 361 | 1.7e-19 | 104.0 |
TFs/TRs:
Gene ID | Type | Classification |
---|
Protein Kinases:
Gene ID | Type | Classification |
---|
Network:
Co-expression Network:
Gene1 | Gene2 | correlation coefficient | p_value | FDR |
---|---|---|---|---|
MS.gene051492 | MS.gene54111 | 0.819111 | 1.38E-52 | -1.69E-46 |
MS.gene051493 | MS.gene54111 | 0.802079 | 6.65E-49 | -1.69E-46 |
MS.gene058477 | MS.gene54111 | 0.820564 | 6.42E-53 | -1.69E-46 |
PPI:
Gene1 | Gene2 | Type |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Query id | Subject id | identity % | alignment length | mismatches | gap openings | q. start | q. end | s. start | s. end | e-value | bit score |
---|
Find 0 sgRNAs with CRISPR-Local
Find 12 sgRNAs with CRISPR-GE
CRISPR-Local
sgRNA_sequence | on_target_score | Position | Region |
---|
CRISPR-GE
badsite warning | sgRNA_sequence | Strand | Position | Region | GC_content |
---|---|---|---|---|---|
!! | CAAATTGTAACAACACTTTT+GGG | + | 10026:1810-1829 | MS.gene54111:CDS | 25.0% |
!! | TGTTACAATTTGCTTTACTT+AGG | - | 10026:1802-1821 | MS.gene54111:intergenic | 25.0% |
ATTTGATATGCATTTCCATC+AGG | - | 10026:1902-1921 | MS.gene54110:intergenic | 30.0% | |
! | GCAAATTGTAACAACACTTT+TGG | + | 10026:1809-1828 | MS.gene54111:CDS | 30.0% |
TTTGGAAATGGAACAAAGCT+AGG | + | 10026:1863-1882 | MS.gene54111:CDS | 35.0% | |
CCATTTCCAAATTGTCCGAT+CGG | - | 10026:1854-1873 | MS.gene54110:intergenic | 40.0% | |
GAAATGGAACAAAGCTAGGA+GGG | + | 10026:1867-1886 | MS.gene54111:CDS | 40.0% | |
!! | TACACTTGTTTCTGTCCGAT+CGG | + | 10026:1836-1855 | MS.gene54111:CDS | 40.0% |
CCGATCGGACAATTTGGAAA+TGG | + | 10026:1851-1870 | MS.gene54111:CDS | 45.0% | |
GGAAATGGAACAAAGCTAGG+AGG | + | 10026:1866-1885 | MS.gene54111:CDS | 45.0% | |
TTCTGTCCGATCGGACAATT+TGG | + | 10026:1845-1864 | MS.gene54111:CDS | 45.0% | |
! | GGAGGGTGCAAAGTACCTGA+TGG | + | 10026:1884-1903 | MS.gene54111:CDS | 55.0% |
Chromosome | Type | Strat | End | Strand | Name |
---|---|---|---|---|---|
10026 | gene | 1765 | 1941 | 1765 | ID=MS.gene54111 |
10026 | mRNA | 1765 | 1941 | 1765 | ID=MS.gene54111.t1;Parent=MS.gene54111 |
10026 | exon | 1765 | 1941 | 1765 | ID=MS.gene54111.t1.exon1;Parent=MS.gene54111.t1 |
10026 | CDS | 1765 | 1941 | 1765 | ID=cds.MS.gene54111.t1;Parent=MS.gene54111.t1 |
Gene Sequence |
Protein sequence |